The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023435	Mycobacterium sp. PYR15 chromosome, complete genome	6037017	1420812	1476295	6037017	tRNA,transposase	Burkholderia_virus(25.0%)	49	NA	NA
WP_071947173.1|1420812_1421829_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_071947172.1|1421849_1422887_+	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_096310501.1|1423988_1425247_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.6	6.6e-84
WP_071947171.1|1425744_1426980_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	28.9	2.9e-07
WP_071950040.1|1427047_1428046_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_071947170.1|1428036_1429416_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_174714109.1|1429412_1429934_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096310503.1|1430050_1431553_+	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_096310505.1|1431553_1433083_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_096310508.1|1433079_1434822_-	APC family permease	NA	NA	NA	NA	NA
WP_071947166.1|1434943_1435522_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_096310510.1|1435615_1436794_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_096310512.1|1436795_1437902_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_083542942.1|1437910_1438396_+	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096310514.1|1438392_1438830_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_096312738.1|1438826_1440029_+	thiolase family protein	NA	NA	NA	NA	NA
WP_096310516.1|1440028_1440436_+	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_096310518.1|1440432_1442025_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	24.6	1.7e-07
WP_071947158.1|1441996_1442767_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_071947157.1|1442766_1444521_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_071947156.1|1444539_1445001_-	succinate dehydrogenase hydrophobic membrane anchor subunit	NA	NA	NA	NA	NA
WP_071947155.1|1444997_1445420_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_071947154.1|1445600_1446014_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_071947153.1|1446010_1447297_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	42.5	3.2e-81
WP_096310520.1|1447293_1448382_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_096310522.1|1448360_1448696_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096310524.1|1448787_1450812_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.3	2.1e-92
WP_096310526.1|1450821_1453968_+	RND family transporter	NA	NA	NA	NA	NA
WP_096310528.1|1453968_1455231_-	primosomal protein	NA	NA	NA	NA	NA
WP_096310530.1|1455275_1455848_+	YdcF family protein	NA	NA	NA	NA	NA
WP_071947146.1|1455869_1456493_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_071947145.1|1456493_1458086_-	phospho-sugar mutase	NA	NA	NA	NA	NA
WP_071947144.1|1458082_1458517_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071947143.1|1458603_1459716_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_096312740.1|1459634_1460426_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_096310532.1|1460457_1461645_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_071947140.1|1461641_1462811_+	amidohydrolase	NA	NA	NA	NA	NA
WP_071947139.1|1462810_1463770_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	34.4	3.9e-44
WP_071947138.1|1463766_1464249_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_071950038.1|1464349_1465765_+	NAD(P)H-quinone dehydrogenase	NA	NA	NA	NA	NA
WP_096310534.1|1465774_1467520_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_096310536.1|1467516_1468389_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071947135.1|1468421_1468979_+	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_096310538.1|1468947_1469715_-	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_096310540.1|1470125_1470416_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096310542.1|1470412_1471345_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	31.5	3.3e-32
WP_096310544.1|1472452_1473714_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.3	9.3e-70
WP_096312741.1|1473662_1473944_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071948729.1|1475215_1476295_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023435	Mycobacterium sp. PYR15 chromosome, complete genome	6037017	1866865	1874550	6037017		Bacillus_phage(33.33%)	8	NA	NA
WP_096310896.1|1866865_1867732_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	30.1	2.9e-06
WP_096312767.1|1867728_1868772_-	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	26.2	6.4e-16
WP_164520042.1|1868768_1869377_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096310897.1|1869459_1870002_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.7	3.3e-08
WP_096310898.1|1870055_1870886_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071946603.1|1871664_1871904_+	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	64.4	2.2e-20
WP_096310899.1|1871932_1872415_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A217ER62	Bacillus_phage	27.9	2.8e-06
WP_174714112.1|1872432_1874550_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.0	3.6e-207
>prophage 3
NZ_CP023435	Mycobacterium sp. PYR15 chromosome, complete genome	6037017	2440535	2447605	6037017	integrase,protease	Mycobacterium_phage(57.14%)	12	2435207:2435229	2452178:2452200
2435207:2435229	attL	TGGTGCGCGATACTGGGATTGAA	NA	NA	NA	NA
WP_096312820.1|2440535_2441756_+|integrase	site-specific integrase	integrase	A0A1D8EV90	Mycobacterium_phage	34.8	9.1e-54
WP_096311234.1|2441755_2442214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096311235.1|2442311_2442515_+	excisionase family DNA-binding protein	NA	A0A2P1CHK7	Mycobacterium_phage	82.5	4.5e-19
WP_096311236.1|2442651_2443134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164520060.1|2443243_2444182_+	AAA family ATPase	NA	A0A2D1GDF8	Mycobacterium_phage	46.3	3.7e-71
WP_164520061.1|2444432_2444606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096311238.1|2444595_2444853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096311239.1|2444849_2445242_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174714180.1|2445322_2445838_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A142K8P6	Gordonia_phage	64.2	8.3e-41
WP_096311241.1|2445839_2446223_+	DUF2190 family protein	NA	A0A142K9Z3	Gordonia_phage	59.5	1.1e-26
WP_096311242.1|2446234_2447116_+	hypothetical protein	NA	A0A2K9VEV5	Mycobacterium_phage	38.5	2.4e-56
WP_096311243.1|2447128_2447605_+	hypothetical protein	NA	A0A1B3AZ47	Gordonia_phage	34.1	2.5e-07
2452178:2452200	attR	TGGTGCGCGATACTGGGATTGAA	NA	NA	NA	NA
>prophage 4
NZ_CP023435	Mycobacterium sp. PYR15 chromosome, complete genome	6037017	2514190	2523422	6037017		uncultured_Mediterranean_phage(16.67%)	9	NA	NA
WP_096311271.1|2514190_2515453_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	27.8	1.4e-20
WP_096311272.1|2515459_2517112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083542643.1|2517108_2517636_+	adenine phosphoribosyltransferase	NA	A0A2K9L0U5	Tupanvirus	27.3	4.7e-07
WP_096311273.1|2517726_2520078_+	RelA/SpoT family protein	NA	A0A2I2L310	Orpheovirus	37.9	8.8e-13
WP_164520063.1|2520091_2520376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096311274.1|2520501_2520744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096311275.1|2520755_2521751_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	32.7	1.2e-08
WP_096311276.1|2521757_2522645_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	31.1	1.3e-06
WP_096311277.1|2522753_2523422_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.0	1.8e-19
>prophage 5
NZ_CP023435	Mycobacterium sp. PYR15 chromosome, complete genome	6037017	3407688	3416184	6037017	transposase,integrase	Staphylococcus_phage(33.33%)	7	3399324:3399339	3419720:3419735
3399324:3399339	attL	GGCCTCGGTGGCGATG	NA	NA	NA	NA
WP_071944019.1|3407688_3409242_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.1	1.5e-16
WP_164520088.1|3409693_3410440_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_125477522.1|3411681_3412881_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.8	7.3e-32
WP_174714194.1|3413215_3413779_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	52.5	3.7e-18
WP_096311611.1|3413775_3414570_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	46.9	2.6e-41
WP_125477522.1|3414659_3415859_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.8	7.3e-32
WP_164520089.1|3415842_3416184_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	62.8	5.3e-28
3419720:3419735	attR	CATCGCCACCGAGGCC	NA	NA	NA	NA
>prophage 6
NZ_CP023435	Mycobacterium sp. PYR15 chromosome, complete genome	6037017	3961037	4023506	6037017	transposase,protease,tRNA	Streptomyces_phage(16.67%)	52	NA	NA
WP_174714091.1|3961037_3961466_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	50.4	2.5e-27
WP_096310927.1|3961527_3962665_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.4	1.3e-33
WP_096311543.1|3963327_3964487_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.4	4.4e-34
WP_096311544.1|3964744_3966005_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	60.1	3.0e-84
WP_125477458.1|3966230_3966836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096311810.1|3966914_3968015_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.9	4.8e-54
WP_071943109.1|3968011_3969460_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_096311811.1|3969541_3969802_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_071943105.1|3969816_3970140_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_096311812.1|3970298_3973205_-	ribonuclease E/G	NA	NA	NA	NA	NA
WP_096311813.1|3973488_3973899_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	50.0	1.1e-27
WP_096311814.1|3973916_3974315_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_096311815.1|3974311_3975718_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_096311816.1|3975714_3978366_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.9	1.6e-140
WP_096311817.1|3978392_3979652_-	saccharopine dehydrogenase NADP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_096311818.1|3979675_3981661_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_096311819.1|3981697_3982864_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071943091.1|3982889_3983381_-	transglycosylase family protein	NA	A0A1J0GVU2	Streptomyces_phage	59.5	1.4e-26
WP_174714135.1|3983561_3983969_-	transglycosylase family protein	NA	A0A1J0GVU2	Streptomyces_phage	69.1	2.6e-29
WP_096311820.1|3984529_3985765_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.9	1.5e-109
WP_096311821.1|3986088_3986667_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_071943087.1|3986685_3987762_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_071943085.1|3987758_3989705_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_096311822.1|3989986_3990835_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_096311823.1|3990936_3991941_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_096311824.1|3992022_3993183_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_096311825.1|3993179_3994184_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_096311826.1|3994180_3995053_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_096311827.1|3995049_3996027_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_071943072.1|3996573_3997389_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	5.7e-12
WP_071943070.1|3997396_3998455_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096311828.1|3998474_3999464_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_096311829.1|3999583_4000357_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_096311830.1|4000358_4001114_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_096312934.1|4001110_4002478_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_071949701.1|4002724_4003456_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071943060.1|4003609_4004581_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_071943058.1|4004573_4005452_+	aldolase	NA	NA	NA	NA	NA
WP_096311831.1|4005455_4006331_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_096311832.1|4006333_4008283_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_096311833.1|4008295_4009213_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_096312935.1|4009230_4010250_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_096311834.1|4010251_4011127_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_071949700.1|4011135_4012626_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_096311835.1|4012675_4013395_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_096311836.1|4013366_4013945_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_096311837.1|4014013_4014694_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_096311838.1|4014757_4016932_-	glutamine synthetase III	NA	NA	NA	NA	NA
WP_096311839.1|4017129_4018554_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_096311840.1|4018991_4021334_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_071943038.1|4021321_4022149_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_071943036.1|4022225_4023506_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.5	1.2e-141
>prophage 7
NZ_CP023435	Mycobacterium sp. PYR15 chromosome, complete genome	6037017	4306015	4365780	6037017	transposase	Corynebacterium_phage(25.0%)	49	NA	NA
WP_071942689.1|4306015_4307419_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_071942680.1|4307955_4309191_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	50.1	1.4e-110
WP_125477522.1|4310976_4312176_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.8	7.3e-32
WP_071949674.1|4313633_4314104_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096312005.1|4314244_4315177_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_071942677.1|4315300_4315591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083542881.1|4315773_4316970_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_071949673.1|4316984_4319321_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_071942673.1|4319639_4320842_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071949672.1|4320952_4324450_+	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_071942671.1|4325165_4325852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071942669.1|4325911_4326214_-	toxin	NA	NA	NA	NA	NA
WP_096312006.1|4326210_4326438_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_174714139.1|4326924_4328220_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096312963.1|4328814_4329807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096312007.1|4329799_4330288_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_096312964.1|4330299_4330578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096312965.1|4330717_4331023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096312008.1|4331019_4331331_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_096312009.1|4331466_4332870_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_125477475.1|4333101_4333485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125477476.1|4333593_4333851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071942658.1|4333859_4334918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071942656.1|4334948_4336787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096312012.1|4336817_4336997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174714202.1|4337351_4338146_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071942689.1|4338546_4339950_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_083542563.1|4340113_4341382_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_071942651.1|4341497_4341959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083542562.1|4341961_4343491_+	cytosine permease	NA	NA	NA	NA	NA
WP_071942649.1|4343487_4344870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071942647.1|4344866_4345118_+	ferredoxin	NA	NA	NA	NA	NA
WP_096312014.1|4345167_4345488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071942645.1|4345484_4346528_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_083542560.1|4346517_4349472_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_071942643.1|4349496_4349829_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_071949669.1|4352543_4354073_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.1	1.1e-19
WP_071942641.1|4354146_4354863_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_071942639.1|4354872_4356081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071942637.1|4356067_4356901_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_071942635.1|4356908_4358078_-	sulfotransferase	NA	NA	NA	NA	NA
WP_071942633.1|4358074_4359202_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096312015.1|4359201_4360020_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_096312016.1|4360047_4360692_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096312017.1|4360774_4361275_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_096312018.1|4361274_4362390_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096312019.1|4362386_4363172_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096312020.1|4363168_4364134_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_096311544.1|4364518_4365780_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	60.1	3.0e-84
>prophage 8
NZ_CP023435	Mycobacterium sp. PYR15 chromosome, complete genome	6037017	5536913	5566476	6037017	protease,transposase,tRNA	Bacillus_phage(20.0%)	30	NA	NA
WP_125477502.1|5536913_5538155_-|protease	PecA family PE domain-processing aspartic protease	protease	NA	NA	NA	NA
WP_125477503.1|5538189_5538549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174714216.1|5538880_5539075_-	PASTA domain-containing protein	NA	NA	NA	NA	NA
WP_071950254.1|5539224_5540274_-	DNA polymerase domain-containing protein	NA	NA	NA	NA	NA
WP_071948786.1|5540314_5541379_+	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_071948785.1|5541375_5541774_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_047333857.1|5541797_5542067_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_071948784.1|5542293_5543673_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_071948783.1|5543697_5544471_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_071948782.1|5544481_5544970_-	bacterioferritin	NA	NA	NA	NA	NA
WP_071948781.1|5545383_5547942_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.8	1.5e-29
WP_071950253.1|5547938_5549699_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	2.8e-24
WP_071948780.1|5549733_5550618_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_083542810.1|5550663_5552136_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_071948779.1|5552132_5552909_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	5.8e-22
WP_071948778.1|5552938_5554312_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096312475.1|5554313_5555534_-	cytochrome P450	NA	NA	NA	NA	NA
WP_174714150.1|5555633_5556857_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	34.2	9.7e-56
WP_096312476.1|5556878_5557778_-	haloalkane dehalogenase	NA	NA	NA	NA	NA
WP_071948774.1|5557962_5558472_+	lipoprotein LpqH	NA	NA	NA	NA	NA
WP_071948773.1|5558542_5559910_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_125477504.1|5559995_5560268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071948771.1|5560378_5560786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164520153.1|5560841_5561186_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.6	9.1e-28
WP_125477506.1|5561403_5562603_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	6.6e-33
WP_071948769.1|5562550_5563222_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	46.4	4.8e-41
WP_164520154.1|5563218_5563497_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	56.9	4.6e-14
WP_096312477.1|5564102_5564342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071947841.1|5564611_5565847_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.2	1.4e-81
WP_125477507.1|5566164_5566476_+	DNA-binding protein	NA	A0A2P1N3P2	Mycobacterium_phage	35.6	4.7e-07
