The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	834100	955076	3414934	protease,head,capsid,tRNA,tail,transposase	Liberibacter_phage(11.54%)	99	NA	NA
WP_072311617.1|834100_835528_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_072311641.1|835520_836855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311616.1|836957_837224_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	48.9	3.4e-14
WP_012625359.1|837786_838182_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_072311615.1|838274_839201_-	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_096152583.1|839349_840495_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072312152.1|840883_841720_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_072312162.1|841792_842932_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_072312153.1|843077_843977_-	ComF family protein	NA	NA	NA	NA	NA
WP_072312154.1|844004_844700_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_072312155.1|844696_845323_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.8	5.9e-25
WP_096152615.1|847325_848660_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012625351.1|848861_849854_+	ATPase	NA	H6WG28	Cyanophage	45.5	9.0e-60
WP_072312156.1|849856_851302_+	hypothetical protein	NA	A0A0K2FIA0	Achromobacter_phage	33.5	6.6e-19
WP_012625349.1|851320_851815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012625348.1|851921_852794_-	ModD protein	NA	NA	NA	NA	NA
WP_012625347.1|853421_855209_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.7	5.6e-60
WP_012625346.1|855465_855660_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_083577940.1|856343_858254_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_012625344.1|858280_859429_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_072312158.1|859448_860852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312159.1|860885_861197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012625341.1|861193_861838_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072312161.1|862169_863354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143142639.1|863681_864179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152616.1|864240_865209_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	1.2e-45
WP_072312255.1|866568_867282_+|head,protease	HK97 family phage prohead protease	head,protease	B0VK32	Azospirillum_phage	42.8	9.1e-30
WP_072312254.1|867285_868491_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	39.3	2.2e-68
WP_027174632.1|868502_868943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312253.1|868999_869596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312252.1|869596_869911_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_072312251.1|870110_870320_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	58.3	9.8e-17
WP_072312250.1|870316_871834_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	54.7	2.5e-154
WP_072312249.1|871830_872058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312248.1|872054_873578_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	53.3	1.6e-137
WP_072312247.1|873574_874753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312246.1|874745_877700_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	41.1	3.1e-217
WP_072312245.1|877722_879885_+	DNA methyltransferase	NA	Q684G2	Sulfolobus_virus	24.3	3.1e-12
WP_072312244.1|879884_882536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312243.1|882540_884145_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_096152618.1|885002_886165_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.5	3.2e-24
WP_157735139.1|886186_886462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152589.1|887676_888645_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	7.2e-46
WP_072312625.1|888702_888888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312624.1|888928_889195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312623.1|889207_889966_-	ParA family protein	NA	S5VTM9	Leptospira_phage	34.1	1.1e-12
WP_072312622.1|890221_890506_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_072312621.1|890526_890961_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_096152583.1|890943_892089_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096152619.1|892799_893477_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_096152804.1|893900_895292_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.7	1.7e-11
WP_096152604.1|895273_896509_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_096152620.1|896573_896942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152621.1|897026_898262_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_096152622.1|898311_898932_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_072312619.1|898988_899897_-	recombination-associated protein RdgC	NA	NA	NA	NA	NA
WP_157735141.1|899917_901426_-	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	31.7	5.8e-34
WP_096152624.1|901528_903031_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	23.9	7.3e-13
WP_096152580.1|903020_903770_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	36.9	1.5e-35
WP_072312558.1|903890_904535_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_072312557.1|904554_904833_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_072312556.1|904829_905159_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_083577998.1|905142_906144_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_072312555.1|906140_906578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312554.1|906582_907317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152625.1|907393_907696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312552.1|907692_908943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312551.1|909166_909511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312641.1|909882_911031_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_143142614.1|911309_911873_-	bacteriophage CI repressor	NA	NA	NA	NA	NA
WP_072311935.1|911872_912277_-	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	49.6	2.9e-25
WP_041724923.1|912881_914909_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	39.7	6.9e-107
WP_096152805.1|915000_915810_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.2	3.2e-15
WP_041724920.1|916322_917057_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_072311934.1|917043_917976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012625335.1|918035_919388_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_012625334.1|919453_920326_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.5	6.2e-65
WP_012625333.1|920524_922909_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_012625332.1|923100_924393_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_072311933.1|924815_927392_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_012625330.1|927789_928155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311932.1|928241_930989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072311931.1|931285_932230_-	permease	NA	NA	NA	NA	NA
WP_096152806.1|932292_933918_-	benzoylformate decarboxylase	NA	NA	NA	NA	NA
WP_012625326.1|934196_934544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072311929.1|934750_937447_-	magnesium-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	24.0	4.3e-40
WP_012625324.1|937697_937865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012625323.1|938285_938825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311928.1|938890_939970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012625321.1|940227_940809_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_072311927.1|940885_941296_+	OsmC family protein	NA	NA	NA	NA	NA
WP_157735144.1|941644_942115_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_096152626.1|941832_942621_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_072311925.1|942983_944339_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.0	3.6e-19
WP_012625317.1|944594_944840_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_012625316.1|944846_945119_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_012625315.1|945533_947093_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_072311924.1|947128_947731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152583.1|953930_955076_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	961552	1023557	3414934	transposase	Staphylococcus_phage(40.0%)	55	NA	NA
WP_096152583.1|961552_962698_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072312542.1|962775_963954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312541.1|964022_964724_-	ERF family protein	NA	A0A0H4A6R9	Pseudoalteromonas_phage	49.2	1.3e-25
WP_072312539.1|966467_966767_+	immunity protein	NA	NA	NA	NA	NA
WP_072312538.1|966834_967137_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143142707.1|967221_968223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143142706.1|968219_969800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152632.1|969821_970963_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	9.1e-40
WP_072312628.1|971062_971728_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.9	2.0e-39
WP_072312629.1|971724_972021_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083578011.1|972113_972866_-	DUF4851 domain-containing protein	NA	NA	NA	NA	NA
WP_143142724.1|972983_973178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152634.1|973260_974229_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	1.5e-46
WP_072312568.1|974225_974978_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_072312567.1|975102_975915_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	2.0e-17
WP_027189484.1|975983_976841_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_083578000.1|976843_977644_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_027189486.1|977640_978636_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_084502013.1|978904_979645_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	40.2	7.5e-35
WP_072312577.1|979580_980357_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_072312579.1|980883_981537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312580.1|981533_983801_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	32.7	2.4e-31
WP_072312535.1|985772_986174_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_012625292.1|986177_987260_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_012625293.1|987256_987724_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_012625294.1|987742_988300_-	NADH-quinone oxidoreductase subunit B family protein	NA	NA	NA	NA	NA
WP_012625295.1|988312_989164_-	NADH-quinone oxidoreductase subunit H	NA	NA	NA	NA	NA
WP_041724909.1|989163_991122_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_072312536.1|991792_992551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152604.1|992584_993820_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_072312582.1|993985_994609_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_012625298.1|994839_995388_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_012625299.1|995502_996522_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_072312581.1|998040_998298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152587.1|998498_999725_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.3	1.9e-51
WP_096152604.1|999928_1001164_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_096152589.1|1001247_1002216_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	7.2e-46
WP_012625290.1|1003015_1005130_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012625289.1|1005214_1005721_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_012625288.1|1005876_1006251_+	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_096152807.1|1006238_1006790_+	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_012625286.1|1006771_1007332_+	NADH dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_081428297.1|1007324_1008650_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_012625284.1|1008731_1009700_+	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_072312267.1|1009757_1010462_+	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_072312276.1|1010567_1011212_+	NADH-ubiquinone/plastoquinone oxidoreductase chain 6	NA	NA	NA	NA	NA
WP_012625281.1|1011208_1011511_+	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_072312268.1|1011513_1013442_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_072312269.1|1013460_1014948_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_072312270.1|1014970_1016485_+	NADH-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_072312271.1|1016564_1017815_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012625275.1|1018934_1019243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312272.1|1019354_1019957_-	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_072312273.1|1019949_1022226_-	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_096152808.1|1022381_1023557_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	37.9	2.0e-37
>prophage 3
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	1062303	1071949	3414934	tRNA	Staphylococcus_phage(42.86%)	9	NA	NA
WP_012625246.1|1062303_1064817_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.1	2.1e-198
WP_012625245.1|1064830_1065325_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_012625244.1|1065328_1065799_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.3	7.1e-31
WP_072311596.1|1065992_1066667_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	33.7	5.8e-26
WP_012625242.1|1066673_1067831_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.2	5.6e-37
WP_012625241.1|1067833_1068310_-	cytidine deaminase	NA	G3MA58	Bacillus_virus	40.8	1.2e-25
WP_072311598.1|1068750_1069995_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	49.9	5.9e-93
WP_072311599.1|1070393_1071644_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_012625238.1|1071715_1071949_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	37.5	5.1e-06
>prophage 5
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	1552403	1605969	3414934	transposase,tRNA	uncultured_Caudovirales_phage(40.0%)	42	NA	NA
WP_072312641.1|1552403_1553552_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012624750.1|1554207_1554639_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_012624751.1|1554668_1554878_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_072312602.1|1555075_1556953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152583.1|1557218_1558364_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_083578013.1|1558360_1559482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152583.1|1559474_1560620_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072312055.1|1560697_1561387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143142625.1|1561680_1561920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312056.1|1562003_1562258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312057.1|1562276_1562666_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.3	2.2e-22
WP_072312058.1|1562674_1563001_+	hypothetical protein	NA	A0A2H4J2R0	uncultured_Caudovirales_phage	41.3	3.3e-19
WP_072312072.1|1563367_1564453_-	DUF3179 domain-containing protein	NA	NA	NA	NA	NA
WP_072312059.1|1564686_1565574_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_012624758.1|1565737_1566520_+	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
WP_072312060.1|1566528_1567368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312061.1|1567651_1568398_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_012624761.1|1568659_1569718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012624762.1|1569740_1570481_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_072312062.1|1570670_1571051_-	RidA family protein	NA	NA	NA	NA	NA
WP_012624764.1|1571062_1572292_-	tryptophan permease	NA	NA	NA	NA	NA
WP_083577928.1|1572291_1573362_-	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_072312063.1|1575256_1576867_+	DUF4139 domain-containing protein	NA	NA	NA	NA	NA
WP_072312064.1|1576968_1577622_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_072312065.1|1577961_1579149_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_072312074.1|1579220_1580444_-	aspartate kinase	NA	A0A1X9I5D0	Streptococcus_phage	25.5	5.4e-06
WP_012624771.1|1580515_1581001_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_096152663.1|1580988_1582593_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_072312067.1|1582648_1583023_-	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_012624774.1|1583196_1584531_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.2	1.5e-78
WP_072312069.1|1584895_1586464_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_072312070.1|1587223_1588429_+	ammonium transporter	NA	NA	NA	NA	NA
WP_012624777.1|1588447_1588786_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_072312071.1|1588841_1591034_+	glutamine synthetase type III	NA	NA	NA	NA	NA
WP_096152583.1|1591410_1592556_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012624779.1|1592648_1593512_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_072312620.1|1593532_1594759_+	LL-diaminopimelate aminotransferase	NA	NA	NA	NA	NA
WP_072312641.1|1595177_1596326_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072312526.1|1596336_1601427_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_012624920.1|1601758_1604077_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_096152635.1|1604272_1604725_-	hypothetical protein	NA	A0A220NQR7	Corynebacterium_phage	37.6	8.1e-16
WP_096152583.1|1604823_1605969_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	1618084	1681389	3414934	transposase,tRNA	uncultured_virus(33.33%)	50	NA	NA
WP_012624909.1|1618084_1619521_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_072311985.1|1619719_1620568_-	menaquinone biosynthesis protein	NA	NA	NA	NA	NA
WP_096152665.1|1620695_1621841_-	dehypoxanthine futalosine cyclase	NA	A9ZMK9	Mamastrovirus	51.7	7.3e-29
WP_012624906.1|1621837_1622980_-	aminofutalosine synthase MqnE	NA	NA	NA	NA	NA
WP_072311979.1|1623064_1623922_+	1,4-dihydroxy-6-naphthoate synthase	NA	NA	NA	NA	NA
WP_072311984.1|1624469_1625912_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012624903.1|1625968_1627468_-	response regulator	NA	NA	NA	NA	NA
WP_072311978.1|1627571_1627976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311977.1|1628124_1628739_-	bifunctional nuclease family protein	NA	NA	NA	NA	NA
WP_012624900.1|1628732_1630097_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_072311976.1|1630102_1630477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049757408.1|1630846_1631374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041724071.1|1631418_1631709_-	DUF5334 domain-containing protein	NA	NA	NA	NA	NA
WP_081428285.1|1631707_1632802_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_012624895.1|1632912_1633527_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_012624894.1|1633526_1634510_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	25.0	3.7e-05
WP_012624893.1|1634757_1635135_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_072311975.1|1635224_1637315_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.3	9.6e-96
WP_012624891.1|1637344_1637785_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096152638.1|1644929_1646156_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.3	1.9e-51
WP_096152668.1|1646180_1646885_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	40.2	7.1e-35
WP_096152669.1|1647254_1648406_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	35.6	3.4e-58
WP_096152619.1|1648424_1649102_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_143142646.1|1649337_1649841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312216.1|1650015_1650474_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012624603.1|1650475_1650919_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_012624604.1|1650953_1651886_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	38.3	1.3e-12
WP_012624605.1|1651952_1652492_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_072312217.1|1652652_1654077_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_012624607.1|1654383_1656027_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.1e-158
WP_012624608.1|1656287_1657097_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012624609.1|1657343_1658486_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_072312218.1|1658647_1661650_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_083577946.1|1661642_1665164_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_012624612.1|1665388_1666342_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012624613.1|1666580_1667003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012624614.1|1667181_1667607_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_012624615.1|1667685_1669107_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_096152638.1|1669991_1671218_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.3	1.9e-51
WP_072312532.1|1671214_1671916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312533.1|1672152_1673307_-	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	42.5	6.8e-43
WP_012624707.1|1673311_1674148_-	Fe-S cluster assembly protein NifU	NA	A0A218MKD1	uncultured_virus	47.1	3.0e-24
WP_012624708.1|1674131_1674575_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_012624709.1|1674609_1675554_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_012624710.1|1675745_1676468_-	4Fe-4S ferredoxin	NA	NA	NA	NA	NA
WP_012624711.1|1676470_1677127_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_012624712.1|1677397_1678291_+	aspartate/ornithine carbamoyltransferase Asp/Orn-binding region	NA	NA	NA	NA	NA
WP_096152583.1|1678592_1679738_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157735167.1|1679815_1680211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152589.1|1680420_1681389_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	7.2e-46
>prophage 7
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	1710154	1743472	3414934	transposase,tRNA,protease	Staphylococcus_phage(22.22%)	31	NA	NA
WP_072312106.1|1710154_1711468_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	27.5	2.9e-37
WP_096152638.1|1711573_1712800_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.3	1.9e-51
WP_012625085.1|1713536_1714226_+	MotA/TolQ/ExbB proton channel	NA	NA	NA	NA	NA
WP_072312613.1|1714228_1714705_+	ExbD/TolR family protein	NA	NA	NA	NA	NA
WP_012625087.1|1714701_1715379_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_096152589.1|1715670_1716639_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	7.2e-46
WP_096152583.1|1716863_1718009_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096152671.1|1718637_1719267_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_157735169.1|1719202_1719640_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	45.0	1.5e-27
WP_096152672.1|1719722_1720046_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157735238.1|1720046_1720418_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_072312641.1|1720404_1721553_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072311755.1|1721651_1721963_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	48.9	1.2e-21
WP_072311754.1|1722304_1723900_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012624844.1|1723966_1724803_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012624843.1|1724802_1725837_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012624842.1|1725847_1726375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012624841.1|1726392_1727016_-	recombination-associated protein RdgC	NA	NA	NA	NA	NA
WP_072311757.1|1727634_1728366_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_072311753.1|1728365_1728794_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_072311752.1|1729117_1730761_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_072311751.1|1730922_1732350_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.8	3.4e-20
WP_012624836.1|1732364_1733834_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_012624835.1|1734110_1734788_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012624833.1|1737392_1737950_-	elongation factor P	NA	NA	NA	NA	NA
WP_072311749.1|1738138_1738744_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_072311748.1|1738757_1740224_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_012624830.1|1740277_1741009_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_072311747.1|1741001_1741928_-	FAD-dependent oxidoreductase	NA	A0A2K9L4X0	Tupanvirus	39.4	2.7e-58
WP_012624828.1|1741924_1742248_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.6	4.7e-18
WP_157735170.1|1742428_1743472_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.5	5.2e-66
>prophage 8
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	1771585	1830615	3414934	transposase	Staphylococcus_phage(22.22%)	48	NA	NA
WP_096152673.1|1771585_1772554_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	9.4e-46
WP_072312496.1|1772623_1773649_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_083577992.1|1773651_1774689_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_072312495.1|1774960_1776679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012624798.1|1776675_1777434_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_012624797.1|1777430_1778654_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	36.9	1.5e-69
WP_072312494.1|1778656_1779490_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_143142695.1|1779661_1779850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735171.1|1779897_1780065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152619.1|1781592_1782270_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012624793.1|1782479_1782800_-	cupin	NA	NA	NA	NA	NA
WP_143142690.1|1783214_1783676_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_012624791.1|1783860_1785300_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_012624790.1|1785373_1785946_+	methylphosphotriester-DNA--protein-cysteine methyltransferase family protein	NA	NA	NA	NA	NA
WP_072312474.1|1786025_1786526_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	39.1	3.4e-23
WP_083577987.1|1786503_1787211_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_012624787.1|1787477_1787987_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_072312476.1|1788169_1789315_-	glutamate synthase	NA	NA	NA	NA	NA
WP_072312477.1|1789337_1790963_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_072312478.1|1790950_1792057_-	glutamate synthase	NA	NA	NA	NA	NA
WP_143142691.1|1792161_1792371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152674.1|1793200_1794427_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.3	1.9e-51
WP_096152675.1|1794462_1795041_+	hypothetical protein	NA	A0A220NQR7	Corynebacterium_phage	37.5	1.6e-21
WP_072312561.1|1795287_1797408_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_012624782.1|1797416_1798409_-	transglutaminase	NA	NA	NA	NA	NA
WP_012624781.1|1798934_1800284_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_157735172.1|1800591_1800768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152624.1|1800832_1802335_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	23.9	7.3e-13
WP_096152580.1|1802324_1803074_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	36.9	1.5e-35
WP_083577969.1|1804023_1804521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012624859.1|1804740_1805325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312357.1|1805321_1806137_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_072312356.1|1806351_1809834_+	DNA polymerase III subunit alpha	NA	A0A291AVS4	Streptomyces_phage	37.9	1.5e-218
WP_072312355.1|1809847_1811005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012624863.1|1811230_1812313_-	teichoic acid biosynthesis protein	NA	NA	NA	NA	NA
WP_072312354.1|1812777_1813362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152815.1|1813720_1814464_+	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_012624866.1|1814471_1815791_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_012624867.1|1815790_1816753_+	RnfABCDGE type electron transport complex subunit D	NA	NA	NA	NA	NA
WP_012624868.1|1816749_1817328_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_012624869.1|1817354_1818032_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_012624870.1|1818170_1818743_+	electron transport complex protein RnfA	NA	NA	NA	NA	NA
WP_012624871.1|1818848_1819760_+	Fe-S cluster domain-containing protein	NA	NA	NA	NA	NA
WP_072312352.1|1819771_1820815_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_096152589.1|1821224_1822193_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	7.2e-46
WP_012624873.1|1823641_1824952_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_072312550.1|1824951_1829016_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072312641.1|1829466_1830615_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	1845818	1900177	3414934	transposase,integrase,tRNA	uncultured_virus(28.57%)	39	1866042:1866089	1888055:1888102
WP_072312373.1|1845818_1846937_-|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	27.2	1.6e-09
WP_096152632.1|1847935_1849076_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	9.1e-40
WP_072312180.1|1849077_1849485_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	40.3	3.7e-20
WP_012624878.1|1849844_1850639_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_012624879.1|1850660_1851431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312182.1|1851923_1853171_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_072312179.1|1853186_1854944_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.8	2.2e-32
WP_012624882.1|1854943_1855426_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_012624883.1|1855454_1855808_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_072312181.1|1855854_1856988_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_072312178.1|1856984_1858760_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_072312177.1|1858756_1860172_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_072312176.1|1860334_1862194_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_072312175.1|1862219_1863074_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_072312174.1|1863185_1865612_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
1866042:1866089	attL	CCTTTCACGCCGTCGACAGGGGTTCAAATCCCCTTGGGGACGCCAAAT	NA	NA	NA	NA
WP_072312173.1|1866246_1867524_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_072312172.1|1867894_1869154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152677.1|1869367_1871170_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_072312170.1|1871196_1871553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152678.1|1871839_1872985_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_143142723.1|1873169_1873463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152679.1|1875250_1876396_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072312465.1|1876727_1876871_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072312464.1|1877022_1877673_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072312463.1|1877798_1879526_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	59.7	6.1e-189
WP_072312462.1|1880193_1880937_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_072312461.1|1880956_1882111_+	sulfotransferase	NA	NA	NA	NA	NA
WP_072312460.1|1882230_1883727_+	citrate transporter	NA	NA	NA	NA	NA
WP_083577985.1|1883886_1885743_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_072312459.1|1885918_1886422_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_072312458.1|1887128_1887854_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_096152638.1|1889620_1890847_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.3	1.9e-51
1888055:1888102	attR	CCTTTCACGCCGTCGACAGGGGTTCAAATCCCCTTGGGGACGCCAAAT	NA	NA	NA	NA
WP_096152681.1|1890958_1891636_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_096152682.1|1891686_1892797_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_096152683.1|1892940_1893219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152583.1|1893654_1894800_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_083578009.1|1894898_1896515_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_096152638.1|1898162_1899389_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.3	1.9e-51
WP_096152684.1|1899385_1900177_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	1920097	2007306	3414934	transposase,holin	Tupanvirus(33.33%)	52	NA	NA
WP_096152583.1|1920097_1921243_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157735176.1|1921543_1922038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311565.1|1922320_1923112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012624938.1|1924346_1925657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072311567.1|1925659_1928770_+	ssrAB activated protein	NA	NA	NA	NA	NA
WP_012624940.1|1928785_1931422_+	type III effector HopL1	NA	NA	NA	NA	NA
WP_072311568.1|1931425_1932490_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_012624942.1|1932600_1934616_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_072311569.1|1934639_1935452_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	1.0e-16
WP_083577884.1|1935448_1936732_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_096152687.1|1936721_1938431_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_012624946.1|1938447_1939353_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_072311570.1|1939455_1941495_+	1,4-alpha-glucan branching protein	NA	NA	NA	NA	NA
WP_083577885.1|1941772_1943377_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.6	1.4e-09
WP_012624950.1|1944389_1944926_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_072311571.1|1945967_1946426_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072311572.1|1946773_1947517_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_157735178.1|1947618_1948455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311574.1|1948339_1950055_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.5	2.9e-21
WP_083577887.1|1950051_1951845_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.1	4.8e-27
WP_072311576.1|1951841_1953167_-	crotonyl-CoA carboxylase/reductase	NA	NA	NA	NA	NA
WP_072311577.1|1953178_1953922_-	thioesterase	NA	NA	NA	NA	NA
WP_083577888.1|1953914_1962605_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.4	1.4e-47
WP_072311579.1|1962601_1965916_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.0	3.7e-41
WP_072311580.1|1965912_1970310_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_072311581.1|1970306_1973783_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.5	1.8e-54
WP_072311582.1|1973772_1975443_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_072311583.1|1975592_1976813_-	MFS transporter	NA	NA	NA	NA	NA
WP_072311585.1|1977964_1978918_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	1.3e-18
WP_157735179.1|1978914_1979586_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_157735180.1|1979537_1979867_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_012624969.1|1979954_1982222_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_072311587.1|1982288_1982723_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_096152816.1|1983643_1984126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152632.1|1984016_1985157_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	9.1e-40
WP_157735181.1|1985018_1986290_-	Isochorismate synthase (salicylate biosynthesis)	NA	NA	NA	NA	NA
WP_012624972.1|1986282_1986606_-	isochorismate lyase	NA	NA	NA	NA	NA
WP_143142689.1|1987117_1987375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152690.1|1987437_1988352_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_072312626.1|1988900_1990397_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_096152583.1|1990679_1991825_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072312127.1|1991893_1992814_-	DUF2333 family protein	NA	NA	NA	NA	NA
WP_012624975.1|1993047_1994877_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_083577934.1|1995573_1997064_-	DUF4125 family protein	NA	NA	NA	NA	NA
WP_012624977.1|1996996_1997932_-	DUF4037 domain-containing protein	NA	NA	NA	NA	NA
WP_072312128.1|1998008_1998875_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012624979.1|1999320_1999587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012624980.1|1999593_2000691_-	membrane protein	NA	NA	NA	NA	NA
WP_012624981.1|2001558_2002155_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_072312129.1|2002181_2003660_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_072312130.1|2003719_2006266_+|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
WP_083577935.1|2006373_2007306_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
>prophage 11
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	2020805	2079047	3414934	transposase,protease	Staphylococcus_phage(27.27%)	48	NA	NA
WP_096152589.1|2020805_2021774_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	7.2e-46
WP_096152691.1|2022118_2022436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312641.1|2022513_2023662_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072312637.1|2023672_2024224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735182.1|2024906_2025554_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	40.2	6.5e-35
WP_096152583.1|2025564_2026710_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096152693.1|2026787_2027144_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012625003.1|2027321_2028392_+	chemotaxis response regulator protein-glutamate methylesterase	NA	W8CYM9	Bacillus_phage	28.6	3.1e-05
WP_072311902.1|2028418_2030350_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_072311922.1|2031177_2032014_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_072311903.1|2032020_2032797_+	ParA family protein	NA	Q8JL10	Natrialba_phage	33.7	9.0e-15
WP_072311904.1|2032790_2033528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012625008.1|2033790_2034159_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	34.1	1.8e-13
WP_012625010.1|2037523_2037733_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_072311923.1|2037790_2038768_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012625012.1|2039244_2039433_-	rubredoxin	NA	NA	NA	NA	NA
WP_012625013.1|2039459_2039999_-	bacterioferritin	NA	NA	NA	NA	NA
WP_012625014.1|2040252_2040663_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_072311906.1|2041804_2042836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012625017.1|2042846_2044313_-	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A0K0KVL9	Prochlorococcus_phage	39.3	1.1e-18
WP_072311907.1|2044355_2046320_-	glycosyltransferase	NA	G9BWD6	Planktothrix_phage	38.8	7.1e-32
WP_072311908.1|2046387_2047578_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072311909.1|2047842_2049021_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012625021.1|2049091_2049769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311910.1|2049931_2051032_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_072311911.1|2051480_2052494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072311912.1|2052493_2053279_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_072311913.1|2053401_2054304_+	EamA family transporter	NA	NA	NA	NA	NA
WP_072311914.1|2054316_2055372_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_072311915.1|2055431_2056952_+	radical SAM protein	NA	NA	NA	NA	NA
WP_072311916.1|2057271_2057853_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_012625029.1|2058071_2058329_+	FmdB family regulatory protein	NA	NA	NA	NA	NA
WP_072311917.1|2058486_2059368_+	YicC family protein	NA	NA	NA	NA	NA
WP_012625031.1|2059371_2059626_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_072311918.1|2059625_2060234_+	guanylate kinase	NA	G0XXC0	Cowpox_virus	34.1	5.0e-21
WP_072311919.1|2060308_2061016_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_012625034.1|2061031_2061889_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012625035.1|2061912_2063649_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.7	2.2e-61
WP_072311920.1|2063874_2065068_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_072311921.1|2065152_2065554_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_143142612.1|2065511_2065835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152589.1|2067153_2068122_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	7.2e-46
WP_072312641.1|2069171_2070320_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012625039.1|2070546_2072079_-	outer membrane homotrimeric porin	NA	NA	NA	NA	NA
WP_096152587.1|2072741_2073968_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.3	1.9e-51
WP_072312612.1|2075503_2076889_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012625043.1|2076912_2077293_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_096152682.1|2077936_2079047_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	2346991	2406137	3414934	transposase,tRNA,protease	Staphylococcus_phage(16.67%)	51	NA	NA
WP_072311868.1|2346991_2348644_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_072311867.1|2348989_2349874_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_012624374.1|2349881_2350685_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012624373.1|2350686_2351208_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_041724701.1|2351652_2352195_-	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	30.9	7.9e-10
WP_012624371.1|2352584_2353289_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_072311865.1|2353388_2355947_+	ribonuclease R	NA	NA	NA	NA	NA
WP_012624369.1|2355946_2357560_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_072311864.1|2357582_2358110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072311863.1|2358310_2358877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311862.1|2359407_2359935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152583.1|2360394_2361540_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096152819.1|2361562_2364793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312413.1|2364888_2368140_-	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_072312412.1|2368182_2369505_-	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_096152820.1|2369504_2371112_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_072312411.1|2371195_2371975_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	7.1e-20
WP_072312410.1|2371979_2372384_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_072312409.1|2372436_2372820_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_012624360.1|2373085_2373514_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_012624359.1|2374556_2375234_-	helix-turn-helix transcriptional regulator	NA	A7Y8H7	Pseudomonas_virus	35.9	7.8e-23
WP_072312408.1|2375558_2375822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152705.1|2376116_2377266_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	9.2e-40
WP_072312509.1|2377371_2377875_+	regulatory protein GemA	NA	A0A2I7S9B8	Vibrio_phage	39.1	6.2e-17
WP_072312510.1|2377858_2378191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143142699.1|2378388_2378769_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072312512.1|2378983_2379574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312513.1|2379685_2381191_+	hypothetical protein	NA	T1SBJ2	Salmonella_phage	31.0	1.2e-07
WP_012624343.1|2381192_2381549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312518.1|2381551_2383621_+	hypothetical protein	NA	W6MWW6	Pseudomonas_phage	34.0	1.9e-83
WP_072312514.1|2383862_2384321_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072312515.1|2384320_2384896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735191.1|2385162_2385375_+	DUF4417 domain-containing protein	NA	NA	NA	NA	NA
WP_072312517.1|2385374_2385725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152645.1|2385743_2386712_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	9.4e-46
WP_072312330.1|2386850_2387291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312331.1|2387308_2387986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083577962.1|2387979_2388489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312332.1|2388737_2390126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312333.1|2390532_2391342_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_049757395.1|2391559_2391997_+	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_072312335.1|2392016_2393336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012624329.1|2393335_2394115_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_072312336.1|2394358_2394781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312337.1|2395189_2397631_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	47.0	3.0e-189
WP_012624325.1|2398306_2399599_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	52.0	5.5e-118
WP_012624324.1|2399601_2400210_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	54.3	1.1e-55
WP_012624323.1|2400303_2401662_-	trigger factor	NA	NA	NA	NA	NA
WP_083577961.1|2402193_2403252_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_012624321.1|2403774_2404488_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096152589.1|2405168_2406137_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	7.2e-46
>prophage 13
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	2550685	2595902	3414934	transposase	Enterobacteria_phage(42.86%)	36	NA	NA
WP_096152808.1|2550685_2551861_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	37.9	2.0e-37
WP_150083000.1|2552008_2552242_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_012624195.1|2552660_2553104_-	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_012624194.1|2553549_2554527_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_012624193.1|2554837_2555497_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_083577938.1|2555546_2558585_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_012624191.1|2559042_2560722_-	trehalose-binding protein	NA	NA	NA	NA	NA
WP_072312146.1|2560938_2561607_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_012624189.1|2561896_2562385_+	CvpA family protein	NA	NA	NA	NA	NA
WP_012624187.1|2562707_2563505_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_012624186.1|2563594_2565805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312147.1|2565801_2568180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312148.1|2568969_2569761_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_012624183.1|2569806_2570946_+	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_072312149.1|2571188_2572655_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_072312150.1|2573029_2573689_-	DUF4956 domain-containing protein	NA	NA	NA	NA	NA
WP_083577939.1|2573723_2576060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152583.1|2576208_2577354_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096152649.1|2578085_2579231_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096152672.1|2579356_2579680_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157735238.1|2579680_2580052_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_072312641.1|2580038_2581187_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157735193.1|2581309_2581990_+	VTC domain-containing protein	NA	NA	NA	NA	NA
WP_072312450.1|2582169_2582709_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.4	3.3e-48
WP_072312451.1|2582699_2583593_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.5	1.5e-93
WP_072312452.1|2583589_2584681_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.7	8.3e-83
WP_072312455.1|2585307_2586948_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012624176.1|2587206_2587743_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	45.6	1.6e-31
WP_041723854.1|2587924_2588557_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_012624174.1|2588590_2589328_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012624173.1|2589740_2590556_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.3	1.7e-16
WP_012624172.1|2591027_2591480_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_012624171.1|2591482_2592127_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012624170.1|2592116_2592965_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_072312454.1|2593354_2594521_-	MFS transporter	NA	NA	NA	NA	NA
WP_096152638.1|2594675_2595902_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.3	1.9e-51
>prophage 14
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	2789505	2863854	3414934	transposase,integrase,tRNA	Staphylococcus_phage(27.27%)	58	2803726:2803785	2863808:2864890
WP_012623996.1|2789505_2790702_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_072311538.1|2790877_2791126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311529.1|2791639_2792545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152583.1|2792727_2793873_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012624000.1|2794617_2795349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012624001.1|2795351_2796614_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012624002.1|2796994_2797771_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_012624004.1|2798273_2799167_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_072312482.1|2799178_2799592_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_072312481.1|2799953_2801642_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.3	4.2e-41
WP_083577988.1|2801656_2802172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312480.1|2802333_2803275_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_072312479.1|2803516_2803723_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
2803726:2803785	attL	CGCGGTTTCAAGTTCAAAGTGCAACACCCAGTCCTTGGGTATTGGCGTCTTCTAAAAAAA	NA	NA	NA	NA
WP_096152589.1|2803738_2804707_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	7.2e-46
WP_072312398.1|2804652_2805093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041723819.1|2805359_2806184_+	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_072312397.1|2806570_2807452_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_012624011.1|2807454_2808834_+	cytochrome c	NA	NA	NA	NA	NA
WP_072312396.1|2808836_2810444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012624013.1|2810752_2811514_-	hypothetical protein	NA	A0A1B1INT3	uncultured_Mediterranean_phage	56.1	7.9e-40
WP_012624014.1|2811591_2812515_+	GTPase Era	NA	NA	NA	NA	NA
WP_072312395.1|2812518_2813232_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012624016.1|2813375_2814014_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_072312393.1|2814310_2814883_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_083577973.1|2814887_2815541_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_096152725.1|2815584_2816268_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_072312392.1|2816359_2816629_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_072312391.1|2817042_2817849_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_049757389.1|2818000_2819653_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072312381.1|2825553_2826381_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_072312380.1|2826486_2828382_-	anaerobic carbon-monoxide dehydrogenase catalytic subunit	NA	NA	NA	NA	NA
WP_012624026.1|2828525_2829203_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_012624027.1|2829459_2829708_-	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_072312379.1|2830146_2832963_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	26.5	2.7e-77
WP_096152726.1|2832996_2833503_+	signal peptidase II	NA	NA	NA	NA	NA
WP_012624030.1|2833499_2833706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012624032.1|2834785_2835421_+	chemotaxis protein CheZ	NA	NA	NA	NA	NA
WP_072312378.1|2835748_2836573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012624034.1|2837233_2838031_+	flagellar hook-basal body protein	NA	NA	NA	NA	NA
WP_012624035.1|2838134_2838920_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_072312377.1|2838938_2840189_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_012624037.1|2840237_2840957_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_096152682.1|2841511_2842623_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157735200.1|2843646_2845452_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059XK29	uncultured_phage	30.9	4.1e-18
WP_072312388.1|2845454_2847731_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_143142674.1|2848159_2848393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312386.1|2848532_2851352_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	31.0	1.6e-45
WP_072312385.1|2851424_2851775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312384.1|2851863_2852745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152823.1|2852747_2855225_-	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	30.4	1.1e-45
WP_083577970.1|2856078_2856639_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_072312382.1|2856714_2857695_-	ADP-glyceromanno-heptose 6-epimerase	NA	A0A2H4N7X9	Lake_Baikal_phage	31.3	2.3e-23
WP_096152728.1|2857758_2858712_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.3e-42
WP_143142718.1|2858822_2859710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083578006.1|2859729_2861154_-	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A0K0KVL9	Prochlorococcus_phage	42.6	5.9e-20
WP_072312592.1|2861329_2862391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312593.1|2862466_2862796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152589.1|2862885_2863854_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	7.2e-46
2863808:2864890	attR	TTTTTTTAGAAGACGCCAATACCCAAGGACTGGGTGTTGCACTTTGAACTTGAAACCGCGAGATGTAACTGGTCGATTAAAATTTTAAATTTTTGATCAAACGCGTCAATTAGGTCCCGCTCGCAATAGCCGCCAACAATAAGTATTTGATACCCTTTATTGGCAAAATATTCTCCAACTTGTGAAAATTTTTCGACCCCCCAGCGTCGTCGTACATCTGCATTGCCGACATGCAGTACTATGTAATTACCACGAACGTATCGAGATGCTAAACAAGCTGACCGATGAAAAACAGTTCGTCGGGGGGGTGTCTCTATGATTTTGCCAAAGACATGTTTATAAAATTGGGGGATTCTTCGAAATTCACTGCGAATATCACTGACGTCTACACAGTTCATTTTTTTCTTAGTACACCATTGTTGGAACAATACCTTCTGAGCATGGTCACTATTTTCATGAGCGGCAATAGCCTTGTTTCGTCCACTTATGACCAACATCAATCGGTCCGTGATGTATCTTGGCTTCCACCTAAGATTGCATAAAACATAAGAAAAATAATATTTTTTCAGATATCTGTATAGTGAGAGTCTATAAAGAAAATTCGTCTCAAATTTCTGTTTATTGAAAAAAAACACAGCGCTGTCAGGATGTAACTCTTTTTCTAACCCTTTCCAAGTTTCTGTAGCAAGGATCAGTACGCGGTCTTTTCTAAAGTGCATCCTTTCTATTAAATAATCAGAATAAGCTTTATTAATAATAGCATCACCCAGACCATTTGGCTGTACTAGAAGTAGGTCCATATGTCGATGTTTTTTGAATGGCTTTTCAAAAAAATGAAGCAGATTGAAAAAAAATATTTCAATTTGTAAAGAGAACTTTCCATATTTTTGTGTTAAAAAGCACCGAGAAAAAACCCACCGTATCCCAGATATACAGAATTTTACCCTTCCTAAACCTCCTGAATATTTAGGCGAAGATGCCTTCTCTTTTGCGAAGTTTAAAATACTTTTCAAGCTTTCATCGATGGTAGTGGCTTTTTCTTCAACGAACTCAGGATAAGAATTGAAAATTTCTTCAGTAATA	NA	NA	NA	NA
>prophage 15
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	2884684	2930475	3414934	tail,head,integrase,terminase,transposase,plate	uncultured_Caudovirales_phage(18.52%)	58	2901477:2901492	2931119:2931134
WP_096152734.1|2884684_2885830_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072312587.1|2886014_2886338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312586.1|2886321_2886603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312585.1|2886691_2887324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083578004.1|2887659_2888460_-	hypothetical protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	35.3	8.4e-16
WP_096152735.1|2888752_2890159_+	hypothetical protein	NA	A0A059XK29	uncultured_phage	30.3	3.2e-18
WP_096152634.1|2890216_2891185_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	1.5e-46
WP_157735202.1|2891120_2891900_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_083577994.1|2892093_2892378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312505.1|2892491_2893031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083577993.1|2893041_2893605_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_072312504.1|2893869_2894127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143142697.1|2894212_2894464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312503.1|2894592_2895843_-|integrase	site-specific integrase	integrase	A0A096VKD7	Synechococcus_phage	25.6	8.2e-10
WP_072312502.1|2896394_2897312_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	44.5	1.2e-58
WP_096152737.1|2898012_2898345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312500.1|2898469_2899267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735203.1|2899272_2899431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152738.1|2899370_2899796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152739.1|2900245_2901157_-	hypothetical protein	NA	A0A2P1A4E8	Alteromonadaceae_phage	48.3	5.3e-06
WP_072312617.1|2901165_2901732_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	39.9	5.0e-23
2901477:2901492	attL	CGGCAAGCTGGGCGAT	NA	NA	NA	NA
WP_096152811.1|2901721_2901856_-	ribonucleoside-triphosphate reductase	NA	NA	NA	NA	NA
WP_072312615.1|2901891_2902950_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	40.7	9.6e-60
WP_072312614.1|2902952_2903306_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.5	2.2e-32
WP_096152740.1|2903375_2904023_-|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	32.9	3.8e-19
WP_096152653.1|2904032_2905127_-	hypothetical protein	NA	A0A2H4J9E6	uncultured_Caudovirales_phage	37.8	9.9e-60
WP_096152741.1|2905116_2906478_-	hypothetical protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	26.6	3.6e-27
WP_083577870.1|2906483_2908568_-|tail	phage tail tape measure protein	tail	B5TAA4	Burkholderia_phage	35.5	5.5e-51
WP_072311442.1|2908727_2909054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311441.1|2909057_2909435_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_072311440.1|2909544_2910006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311439.1|2910144_2911023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311438.1|2911112_2912546_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	43.8	5.6e-87
WP_072311450.1|2912549_2912726_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_072311437.1|2912742_2913435_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_072311436.1|2913434_2913887_-	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	32.0	8.4e-05
WP_072311435.1|2913891_2914200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311434.1|2914208_2915138_-|head	head protein	head	A0A1C6ZDN1	Pseudomonas_phage	58.6	7.5e-101
WP_072311433.1|2915140_2916319_-	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	39.6	6.5e-49
WP_072311432.1|2916430_2916976_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_072311431.1|2917093_2918389_-	hypothetical protein	NA	Q6QIB9	Burkholderia_phage	45.8	3.4e-59
WP_072311430.1|2918516_2920106_-	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	41.1	4.0e-94
WP_072311429.1|2920108_2921809_-|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	54.3	5.1e-172
WP_072311428.1|2921801_2922314_-	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	42.8	1.3e-30
WP_072311427.1|2922313_2922565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311426.1|2922579_2922837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311425.1|2922838_2923465_-	hypothetical protein	NA	A0A2I7RBM4	Vibrio_phage	28.8	2.8e-06
WP_083577867.1|2923567_2924074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311424.1|2924073_2924400_-	DUF4406 domain-containing protein	NA	A0A2K8I958	Pseudomonas_phage	47.1	3.5e-21
WP_072311422.1|2924828_2925254_-	regulatory protein GemA	NA	A0A2P9JZH5	Alteromonadaceae_phage	36.6	7.8e-13
WP_072311421.1|2925250_2925718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311420.1|2925671_2925881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311419.1|2925885_2926152_-	hypothetical protein	NA	A0A0U5KSG7	unidentified_phage	47.3	3.3e-09
WP_072311418.1|2926226_2926757_-	host-nuclease inhibitor protein Gam	NA	NA	NA	NA	NA
WP_072311417.1|2926758_2927076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152825.1|2927068_2927593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311415.1|2927619_2928363_-	ATP-binding protein	NA	R9U430	Rhizobium_phage	36.5	5.4e-33
WP_072311414.1|2928378_2930475_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JEQ4	uncultured_Caudovirales_phage	37.4	4.1e-94
2931119:2931134	attR	CGGCAAGCTGGGCGAT	NA	NA	NA	NA
>prophage 16
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	3053803	3106156	3414934	transposase,tail,tRNA,integrase	Bacillus_thuringiensis_phage(16.67%)	46	3056253:3056269	3092414:3092430
WP_096152604.1|3053803_3055039_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_143142680.1|3055068_3055407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312416.1|3055378_3056503_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
3056253:3056269	attL	GCCTTGCCGGGCTGGGC	NA	NA	NA	NA
WP_072312417.1|3056506_3056833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312418.1|3056885_3057629_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_072312419.1|3057638_3058532_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_083577978.1|3058561_3059749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312421.1|3059868_3061899_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_072312422.1|3061895_3062420_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_096152751.1|3062439_3062958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312423.1|3062944_3065080_+	DUF1738 domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	41.2	1.4e-41
WP_072312424.1|3065076_3067236_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	32.9	2.9e-71
WP_072312425.1|3067532_3068396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312426.1|3068407_3069286_+	recombination-associated protein RdgC	NA	NA	NA	NA	NA
WP_096152752.1|3069334_3069943_+|tail	tail fiber protein	tail	A0A7D3	Microcystis_virus	47.8	6.6e-05
WP_096152753.1|3070423_3071320_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.3e-36
WP_096152754.1|3072701_3074465_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.2	1.2e-19
WP_096152755.1|3074680_3075334_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_096152756.1|3075400_3076504_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_072312122.1|3076976_3077219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143142630.1|3077193_3077757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312126.1|3077821_3079321_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_157735211.1|3079338_3079548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312120.1|3079644_3079980_-	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
WP_072312119.1|3079979_3080834_-	Rha family transcriptional regulator	NA	A0A0P0ZGC2	Escherichia_phage	56.0	8.1e-25
WP_072312118.1|3081500_3083153_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	27.1	5.8e-11
WP_012623853.1|3083806_3084076_+	DUF5320 domain-containing protein	NA	NA	NA	NA	NA
WP_072312125.1|3084477_3084765_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_012623851.1|3084848_3085322_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_012623850.1|3085436_3085865_-	DMT family transporter	NA	NA	NA	NA	NA
WP_072312124.1|3086177_3086630_-	glyoxalase	NA	NA	NA	NA	NA
WP_072312117.1|3086763_3087720_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_072312116.1|3087850_3088174_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_072312115.1|3088297_3088984_+	endonuclease III	NA	NA	NA	NA	NA
WP_072312114.1|3089277_3090231_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	35.9	5.6e-51
WP_012623844.1|3091332_3092904_+	MFS transporter	NA	NA	NA	NA	NA
3092414:3092430	attR	GCCTTGCCGGGCTGGGC	NA	NA	NA	NA
WP_012623843.1|3093025_3093817_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_072312113.1|3094078_3095470_-|tRNA	glutamate--tRNA ligase	tRNA	A0A1V0SK72	Klosneuvirus	29.6	1.0e-08
WP_072312111.1|3095705_3097706_-	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	35.5	2.0e-50
WP_072312110.1|3097952_3098735_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_072312109.1|3098850_3100308_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_096152827.1|3100442_3101048_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_096152757.1|3101450_3102824_-	sigma-54-dependent Fis family transcriptional regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	36.1	7.2e-07
WP_143142631.1|3102882_3104391_-	two-component system sensor histidine kinase ZraS	NA	W8CYF6	Bacillus_phage	28.2	7.6e-18
WP_083577932.1|3104627_3105044_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_096152706.1|3105475_3106156_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	3127475	3173515	3414934	transposase,integrase	Erysipelothrix_phage(30.0%)	37	3142009:3142032	3173099:3173122
WP_096152583.1|3127475_3128621_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072312569.1|3128999_3129776_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.4	2.6e-22
WP_012623821.1|3129772_3130453_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_072312570.1|3130641_3131394_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_072312571.1|3131549_3132674_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_072312641.1|3133266_3134415_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072312601.1|3136359_3136740_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_072312600.1|3136945_3137974_-	MFS transporter	NA	NA	NA	NA	NA
WP_096152583.1|3137992_3139138_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072312633.1|3139583_3139796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312634.1|3140141_3140759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152604.1|3140740_3141976_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
3142009:3142032	attL	GCTACCCACGGAAAACCCGGAAGA	NA	NA	NA	NA
WP_072312519.1|3143109_3143703_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S8G1	Streptococcus_phage	37.4	3.8e-21
WP_072312520.1|3143904_3144318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312521.1|3144407_3144674_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_072312522.1|3145159_3145480_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072312523.1|3145492_3146350_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_072312524.1|3146761_3148006_+|integrase	site-specific integrase	integrase	K7PHM9	Enterobacterial_phage	27.8	6.7e-12
WP_072312525.1|3148032_3149055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152759.1|3149379_3149541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096152760.1|3149797_3151528_-	VWA domain-containing protein	NA	A0A2D0Z996	Vibrio_phage	27.3	1.4e-12
WP_096152761.1|3151433_3152471_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_096152762.1|3152480_3153824_-	AAA domain-containing protein	NA	L7TKP0	Rhizobium_phage	35.3	8.8e-34
WP_072312327.1|3153893_3154322_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_072312326.1|3154324_3154546_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072312325.1|3154679_3155843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312324.1|3155911_3156613_-	ERF family protein	NA	A0A0H4A6R9	Pseudoalteromonas_phage	50.0	5.1e-25
WP_072312323.1|3157029_3160194_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	32.9	9.7e-116
WP_096152763.1|3160190_3161228_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	44.6	1.5e-73
WP_072312322.1|3161224_3163300_-	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	30.5	2.3e-81
WP_072312321.1|3163304_3164192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072312320.1|3164242_3164908_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_072312319.1|3164904_3168171_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B253	Erysipelothrix_phage	42.8	3.0e-237
WP_072312318.1|3168587_3170318_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072312317.1|3170304_3171723_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_096152764.1|3171857_3173093_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_096152765.1|3173290_3173515_+|transposase	transposase	transposase	NA	NA	NA	NA
3173099:3173122	attR	GCTACCCACGGAAAACCCGGAAGA	NA	NA	NA	NA
>prophage 18
NZ_CP023415	Desulfovibrio sp. G11 chromosome, complete genome	3414934	3214825	3267062	3414934	transposase,integrase,tRNA,protease	Moumouvirus(12.5%)	41	3209012:3209026	3227142:3227156
3209012:3209026	attL	CATGCCGCCGCCTCT	NA	NA	NA	NA
WP_072311705.1|3214825_3216190_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	38.0	1.7e-80
WP_072311704.1|3216678_3217725_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015939276.1|3217790_3218753_+	aminotransferase	NA	NA	NA	NA	NA
WP_157735215.1|3218752_3219682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735217.1|3219597_3220095_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015939278.1|3220155_3221067_+	adenine nucleotide alpha hydrolase family protein	NA	NA	NA	NA	NA
WP_157735219.1|3221315_3221453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072311702.1|3221627_3222776_+|integrase	site-specific integrase	integrase	A0A173G9H3	Propionibacterium_phage	23.5	1.5e-05
WP_157735221.1|3222772_3223816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072311700.1|3223994_3224201_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096152772.1|3224449_3224758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152773.1|3224831_3226301_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_096152774.1|3226503_3226896_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	43.3	6.1e-20
WP_096152775.1|3227185_3227899_+	hypothetical protein	NA	NA	NA	NA	NA
3227142:3227156	attR	AGAGGCGGCGGCATG	NA	NA	NA	NA
WP_096152776.1|3227829_3228531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312563.1|3228706_3229363_+	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_143142714.1|3229609_3230212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152604.1|3231915_3233151_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_157735223.1|3233536_3234157_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_096152778.1|3234203_3234689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083577926.1|3235041_3235338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312017.1|3235687_3236203_+	BREX-3 system P-loop-containing protein BrxF	NA	NA	NA	NA	NA
WP_072312018.1|3236981_3237596_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_072312035.1|3237613_3238204_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_096152779.1|3238215_3241767_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_072312020.1|3241851_3242712_+	DNA damage-inducible protein D	NA	A0A2P1JVY7	Mycobacterium_phage	44.4	5.3e-24
WP_072312021.1|3242711_3246203_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_072312022.1|3246215_3248714_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_072312023.1|3248728_3250798_+|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
WP_072312024.1|3250799_3253376_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072312025.1|3253380_3254610_+	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_072312026.1|3254621_3257897_+	AAA family ATPase	NA	A0A0E3FCH5	Synechococcus_phage	27.0	1.5e-07
WP_072312027.1|3257898_3258210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312028.1|3258315_3259356_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	72.1	1.1e-143
WP_072312029.1|3259498_3260548_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_072312030.1|3260798_3261650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312031.1|3261659_3263045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312036.1|3263083_3263515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072312032.1|3263733_3264435_+	ERF family protein	NA	A0A2H4FU11	Methylophilaceae_phage	42.5	6.2e-23
WP_096152780.1|3264503_3265667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096152587.1|3265835_3267062_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.3	1.9e-51
