The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018624	Clostridium chauvoei strain DSM 7528 chromosome, complete genome	2872664	138222	194373	2872664	integrase,protease,tRNA,transposase,coat	Clostridium_phage(22.22%)	53	154231:154290	176241:176397
WP_021876638.1|138222_139233_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.9	3.5e-67
WP_079481647.1|139260_140283_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021876636.1|140439_141702_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	6.6e-15
WP_079481646.1|141898_142198_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_021876634.1|142310_142727_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_096145304.1|142842_143931_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
WP_021876632.1|143939_145076_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_079481645.1|145059_146187_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_021876630.1|146339_147332_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_131431664.1|147399_148134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079481875.1|148126_149173_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_021876627.1|149223_150345_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_021876626.1|150450_151452_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_021876625.1|151541_152426_+	sporulation peptidase YabG	NA	NA	NA	NA	NA
WP_079481036.1|152790_154230_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
154231:154290	attL	AATAACGACATCCTTTCATGTGTGATTTTGTTTGGTTAGAGATTCAATTTTAACATGAAA	NA	NA	NA	NA
WP_079481644.1|154408_154645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876624.1|155141_156722_+	DUF3794 domain-containing protein	NA	NA	NA	NA	NA
WP_021876623.1|156901_157738_+	cyanophycinase	NA	NA	NA	NA	NA
WP_079481643.1|157718_160343_+	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_079481642.1|160482_161325_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_079481641.1|161386_162040_+	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_079481640.1|162120_163110_+	DUF814 domain-containing protein	NA	NA	NA	NA	NA
WP_021876618.1|163119_163536_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_079481639.1|163672_163978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876615.1|166135_167530_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_021876614.1|167544_168654_-	diacylglycerol synthase	NA	NA	NA	NA	NA
WP_021876613.1|168791_168998_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_079481638.1|169281_169869_+	thymidine kinase	NA	A0A249XXF6	Clostridium_phage	51.6	1.0e-50
WP_079481637.1|169894_171652_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_021876610.1|171715_172801_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_079481636.1|172857_173445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876608.1|173464_174508_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	36.3	1.8e-47
WP_079481036.1|174800_176240_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_021876607.1|176418_176868_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
176241:176397	attR	AATAACGACATCCTTTCATGTGTGATTTTGTTTGGTTAGAGATTCAATTTTAACATGAAATTAGGGGGTCGTTATTTTTTTATACAAAAAAACTGGCGAAACCTTGATATATAAAGATTTAAAAAGAAAAGTAGTGTAAAAAACTTTACACTAACAA	NA	NA	NA	NA
WP_021876606.1|176914_177544_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_021876605.1|177726_178221_+	hypothetical protein	NA	A0A2H5BMD7	Streptomyces_phage	38.6	2.6e-15
WP_021876604.1|178238_179390_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	29.2	4.3e-29
WP_021876603.1|179508_180690_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_079481635.1|181414_181777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876601.1|181777_182458_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_021876600.1|182477_182711_+	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_021876599.1|182751_183231_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_021876598.1|183233_183773_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_021876597.1|183783_185298_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_021876596.1|185334_186186_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_021876595.1|186201_187590_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_131431660.1|188203_188851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079481633.1|188872_190132_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_021876591.1|190306_191356_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	38.5	1.5e-36
WP_079481632.1|191544_192288_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_021876589.1|192371_192623_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	57.3	3.1e-17
WP_021876588.1|192750_193785_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_079481631.1|193842_194373_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.3	2.3e-17
>prophage 2
NZ_CP018624	Clostridium chauvoei strain DSM 7528 chromosome, complete genome	2872664	792697	829927	2872664	integrase,portal,head,capsid,terminase,transposase,tail	Clostridium_phage(45.45%)	46	787500:787517	824489:824506
787500:787517	attL	AAATAAAAATATAAATAT	NA	NA	NA	NA
WP_079481794.1|792697_794326_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	30.3	1.7e-55
WP_079481478.1|794438_795143_-	LrgB family protein	NA	NA	NA	NA	NA
WP_021876074.1|795142_795517_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_021876073.1|795657_796629_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_021876072.1|796780_797038_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_079481477.1|797079_798693_-	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	39.7	9.4e-91
WP_021876070.1|798766_799225_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTX7	Clostridium_phage	50.7	1.9e-33
WP_079481476.1|799447_799711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161493100.1|799685_801422_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_096145344.1|801538_802390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876067.1|802428_803334_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_021876066.1|803453_803828_-	helix-turn-helix transcriptional regulator	NA	A0A0A8WJ60	Clostridium_phage	40.8	6.9e-13
WP_161493099.1|804000_804192_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021876064.1|804303_804477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876063.1|804541_804733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079481473.1|804912_805404_+	transcriptional regulator	NA	A0A2K9V3J3	Faecalibacterium_phage	40.2	3.9e-24
WP_021876060.1|806413_807718_+	replicative DNA helicase	NA	O80281	Escherichia_phage	41.8	1.0e-79
WP_021876059.1|807719_807917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151901569.1|807879_808134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876056.1|808515_808905_+	hypothetical protein	NA	A0A0A7RTL7	Clostridium_phage	40.2	8.5e-22
WP_165489634.1|809142_809301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876055.1|809293_809932_+|integrase	tyrosine-type recombinase/integrase	integrase	F6K8Q2	Clostridium_phage	40.6	2.6e-28
WP_021876054.1|810351_810930_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	50.8	1.9e-46
WP_079481471.1|810969_811743_+	hypothetical protein	NA	A0A1L2BWH4	Clostridium_phage	38.1	7.1e-36
WP_079481470.1|811735_813046_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	1.9e-137
WP_079481469.1|813138_814602_+|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	41.0	8.8e-96
WP_079481468.1|814591_815950_+|capsid	minor capsid protein	capsid	H7BWE7	unidentified_phage	33.8	7.5e-25
WP_079481467.1|815942_816254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876048.1|816467_816743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876047.1|816930_817524_+	hypothetical protein	NA	A0A0A7S0J5	Clostridium_phage	47.4	1.5e-25
WP_021876046.1|817539_818427_+	hypothetical protein	NA	A0A0A7AQF5	Bacillus_phage	52.7	2.0e-74
WP_021876045.1|818470_818791_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_079481466.1|818787_819102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079481465.1|819094_819505_+	hypothetical protein	NA	A0A0A7AQU9	Bacillus_phage	40.2	6.6e-09
WP_021876042.1|819505_819859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876041.1|819859_820417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079481464.1|820487_820790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876039.1|821103_823863_+|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	52.6	3.0e-81
WP_079481463.1|823859_824564_+	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	39.2	1.4e-38
824489:824506	attR	AAATAAAAATATAAATAT	NA	NA	NA	NA
WP_021876038.1|824563_825997_+|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	44.4	6.8e-85
WP_021876037.1|825997_826276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096145345.1|826277_827558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096145346.1|827512_828130_+	SGNH/GDSL hydrolase family protein	NA	A0A0S2SXG8	Bacillus_phage	28.3	1.3e-16
WP_021876035.1|828140_828374_+	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_021876034.1|828393_828801_+	hypothetical protein	NA	I2E8W8	Clostridium_phage	46.8	5.0e-25
WP_079481462.1|828871_829927_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1L6BY22	Clostridium_phage	38.6	1.9e-20
>prophage 3
NZ_CP018624	Clostridium chauvoei strain DSM 7528 chromosome, complete genome	2872664	1538371	1551452	2872664		Cyanophage(25.0%)	12	NA	NA
WP_021875371.1|1538371_1539874_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.2	9.1e-64
WP_079481269.1|1539891_1540503_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	4.6e-22
WP_021875369.1|1540490_1541492_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SQF5	Cyanophage	45.9	5.3e-68
WP_021875368.1|1541501_1542929_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	33.3	1.6e-57
WP_021875367.1|1542981_1543686_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	42.1	2.4e-43
WP_021875366.1|1543685_1544165_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.0	1.8e-29
WP_021875365.1|1544177_1547924_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.4	2.4e-28
WP_021875364.1|1548272_1548899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021875363.1|1549132_1549288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008677523.1|1549592_1549748_-	cytochrome c551	NA	NA	NA	NA	NA
WP_079481268.1|1550037_1550448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021875361.1|1550513_1551452_-	SPFH/Band 7/PHB domain protein	NA	A0A2K9KZA2	Tupanvirus	34.9	1.7e-23
>prophage 4
NZ_CP018624	Clostridium chauvoei strain DSM 7528 chromosome, complete genome	2872664	2036595	2083627	2872664	tRNA,transposase,protease	Planktothrix_phage(33.33%)	38	NA	NA
WP_021874908.1|2036595_2038506_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	41.3	4.3e-151
WP_021874907.1|2039062_2040502_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021874906.1|2040645_2040969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096145419.1|2041109_2041592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874904.1|2041700_2042513_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_021874903.1|2042613_2043207_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_079481129.1|2043301_2044000_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	36.1	4.6e-26
WP_079481128.1|2044211_2046746_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_021874900.1|2047240_2049232_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_079481127.1|2049333_2053638_-	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_021874898.1|2053999_2054452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874897.1|2054624_2055662_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_079481126.1|2056242_2056653_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.4	3.0e-17
WP_021874895.1|2056723_2057998_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_021874894.1|2057998_2059045_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_161493081.1|2059279_2060017_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021874891.1|2061922_2063395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481125.1|2063435_2063912_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079481124.1|2064038_2064704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874888.1|2064693_2065029_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021874887.1|2065160_2065655_-	DUF3997 domain-containing protein	NA	NA	NA	NA	NA
WP_021874886.1|2065875_2066397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096145420.1|2066497_2067682_-	amidohydrolase	NA	NA	NA	NA	NA
WP_079481776.1|2067792_2068101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874881.1|2069405_2069558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161493080.1|2069802_2071785_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_021874879.1|2071762_2072545_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	2.2e-29
WP_079481122.1|2072677_2073694_-	sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	33.3	7.4e-09
WP_021874877.1|2073695_2074370_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_021874875.1|2075217_2078007_-	DEAD/DEAH box helicase	NA	A0A248SJQ0	Salicola_phage	34.4	1.2e-56
WP_079481121.1|2078174_2078357_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_079481120.1|2078557_2079427_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_079481119.1|2079456_2079723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079481118.1|2079752_2080634_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_079481115.1|2080663_2081509_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_079481117.1|2081538_2082432_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_079481116.1|2082461_2082752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079481115.1|2082781_2083627_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
