The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023429	Neisseria sp. 10022 chromosome, complete genome	2511904	1012583	1060321	2511904	plate,tail,head,integrase,transposase	Burkholderia_phage(28.95%)	60	1028665:1028681	1060829:1060845
WP_096295069.1|1012583_1013024_-	phage virion morphogenesis protein	NA	A0A076FSU1	Pseudomonas_phage	44.0	7.3e-22
WP_096295070.1|1013210_1014116_-|head	phage head morphogenesis protein	head	A0A0M4UTA3	Ralstonia_phage	46.9	1.8e-62
WP_096295071.1|1014112_1015618_-	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	43.5	4.6e-108
WP_096295072.1|1015705_1015915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096295073.1|1015897_1017385_-	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	67.8	2.1e-198
WP_096295074.1|1018017_1018335_-	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	64.9	1.1e-27
WP_096295075.1|1018331_1018652_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	38.1	4.0e-09
WP_096295076.1|1018654_1018867_-	conjugal transfer protein TraR	NA	A0A0M3LS11	Mannheimia_phage	47.7	1.2e-09
WP_096296102.1|1018859_1019105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096295077.1|1019058_1019457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096296103.1|1019440_1019695_-	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	43.5	4.7e-05
WP_096295078.1|1019694_1019877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096295079.1|1019880_1020384_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	60.0	5.6e-50
WP_096295080.1|1020470_1020953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096295081.1|1020949_1021918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096295082.1|1021947_1022571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096295083.1|1022567_1023215_-	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	36.3	2.4e-29
WP_096295084.1|1023356_1023560_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	48.2	2.8e-08
WP_096295085.1|1023556_1023841_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096295086.1|1023875_1024733_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	40.1	4.4e-47
WP_096295087.1|1024734_1026516_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	48.5	1.2e-150
WP_096295088.1|1026556_1027699_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	52.5	3.3e-106
WP_096295089.1|1027698_1027902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096295090.1|1027898_1028111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096295091.1|1028112_1028361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096295092.1|1028357_1028876_+	hypothetical protein	NA	NA	NA	NA	NA
1028665:1028681	attL	CAGGCCGTCTGAAAACA	NA	NA	NA	NA
WP_096295093.1|1028859_1029327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096295094.1|1029292_1029925_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	55.9	2.0e-57
WP_096295095.1|1030127_1030403_+	HU family DNA-binding protein	NA	Q2A099	Sodalis_phage	52.8	2.9e-16
WP_096295096.1|1030549_1031026_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.9	4.7e-22
WP_096295097.1|1031018_1031360_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	42.1	1.9e-17
WP_096295098.1|1031573_1032686_+	2-oxoacid:acceptor oxidoreductase	NA	Q6QIB7	Burkholderia_phage	41.8	1.1e-69
WP_096295099.1|1032709_1033648_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	37.3	1.9e-43
WP_096295100.1|1033713_1034049_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_096295101.1|1034051_1034315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096295102.1|1034314_1034761_+	DUF1320 domain-containing protein	NA	A0A2D1GNP0	Pseudomonas_phage	31.2	7.2e-09
WP_096295103.1|1034760_1035258_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	33.3	2.9e-19
WP_096295104.1|1035261_1036662_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	46.7	1.2e-105
WP_096295105.1|1036673_1037192_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	49.7	5.2e-43
WP_096295106.1|1037301_1037586_+|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	51.9	1.4e-10
WP_096295107.1|1037769_1038048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096295108.1|1038098_1040792_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	22.6	4.7e-18
WP_096295109.1|1040791_1041688_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	38.0	4.4e-21
WP_096295110.1|1041684_1041912_+	hypothetical protein	NA	R9U1D8	Rhizobium_phage	36.1	1.9e-05
WP_096295111.1|1041911_1043015_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	43.2	7.4e-71
WP_096296104.1|1043028_1043577_+|plate	phage baseplate assembly protein V	plate	R9U0U6	Rhizobium_phage	34.5	6.6e-12
WP_096295112.1|1043655_1044033_+|plate	phage baseplate protein	plate	Q6QIA0	Burkholderia_phage	43.6	5.1e-16
WP_096295113.1|1044023_1045166_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	41.1	1.2e-60
WP_096295114.1|1046428_1046944_+	hypothetical protein	NA	I6YY04	Aeromonas_phage	38.2	1.5e-05
WP_096295115.1|1047024_1047834_+|tail	tail fiber protein	tail	A0A1W6JT73	Escherichia_phage	45.1	2.6e-33
WP_096295116.1|1047866_1048613_+	hypothetical protein	NA	K7PMC4	Enterobacterial_phage	35.9	7.3e-06
WP_096295117.1|1048686_1049115_+	hypothetical protein	NA	A0A1L7N100	Ralstonia_phage	46.9	9.3e-30
WP_157742713.1|1049108_1049438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096295119.1|1049437_1052581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089036638.1|1052762_1052960_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_096296105.1|1053087_1053825_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	53.3	3.3e-75
WP_096295120.1|1053943_1057123_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.9	1.1e-42
WP_157742797.1|1057193_1058921_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_096295122.1|1059299_1059746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096295123.1|1059859_1060321_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1060829:1060845	attR	TGTTTTCAGACGGCCTG	NA	NA	NA	NA
>prophage 2
NZ_CP023429	Neisseria sp. 10022 chromosome, complete genome	2511904	1610466	1659136	2511904	protease,integrase,transposase	Bacillus_phage(14.29%)	42	1624170:1624187	1669853:1669870
WP_096295489.1|1610466_1612764_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.7	2.9e-170
WP_096295490.1|1612767_1613079_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_016687461.1|1613384_1613588_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	80.3	1.2e-22
WP_096295491.1|1613854_1614076_+	DUF1653 domain-containing protein	NA	M5ABZ3	Bacillus_phage	48.4	3.0e-08
WP_096295492.1|1614181_1614628_+	SsrA-binding protein SmpB	NA	NA	NA	NA	NA
WP_096295493.1|1614836_1615184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157742753.1|1615230_1615434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096295494.1|1615705_1617271_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	3.4e-21
WP_096295495.1|1617601_1618342_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_096296144.1|1618462_1619497_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.7	5.9e-30
WP_096295496.1|1619968_1621450_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_095502622.1|1621600_1621936_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_096296145.1|1622119_1624129_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.0	5.7e-45
1624170:1624187	attL	CATATTCTTTCAGACGGC	NA	NA	NA	NA
WP_096295497.1|1624304_1625390_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_096295498.1|1625701_1626154_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_054599043.1|1626168_1626399_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_095502627.1|1626703_1627075_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_096295499.1|1629544_1630414_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_096295500.1|1632032_1632725_+	phosphate regulon transcriptional regulatory protein PhoB	NA	NA	NA	NA	NA
WP_096296146.1|1632717_1633272_+	DUF3329 domain-containing protein	NA	NA	NA	NA	NA
WP_096295502.1|1633912_1634347_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_096295503.1|1635198_1636731_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_096295504.1|1636730_1638104_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.9	1.0e-21
WP_157742754.1|1638405_1638582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157742755.1|1638606_1638774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096295505.1|1639445_1640834_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_096295506.1|1640918_1642700_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A060AN10	Cronobacter_phage	58.9	1.8e-204
WP_096295507.1|1642739_1643270_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	NA	NA	NA	NA
WP_096295508.1|1643471_1644863_-	purine permease	NA	H9YQ34	environmental_Halophage	47.1	1.9e-23
WP_096295509.1|1646253_1647396_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_096295510.1|1647657_1647903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096295511.1|1647895_1648492_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	E9KZD1	Cassava_brown_streak_virus	39.7	2.6e-06
WP_157742801.1|1648677_1649025_+	DUF1705 domain-containing protein	NA	NA	NA	NA	NA
WP_096295512.1|1651948_1652338_+	RidA family protein	NA	NA	NA	NA	NA
WP_096295514.1|1652790_1653624_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	V9QL63	Rhizobium_phage	30.1	2.7e-09
WP_096295515.1|1653952_1655122_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_096295516.1|1655298_1656483_+	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_096295517.1|1656631_1657411_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_096296147.1|1657930_1658311_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157742756.1|1658325_1658721_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.1	1.9e-13
WP_096295519.1|1658618_1658894_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	58.8	4.3e-20
WP_096295520.1|1658869_1659136_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	60.5	4.4e-22
1669853:1669870	attR	GCCGTCTGAAAGAATATG	NA	NA	NA	NA
>prophage 3
NZ_CP023429	Neisseria sp. 10022 chromosome, complete genome	2511904	1697040	1716992	2511904	head,tail,plate,transposase	Burkholderia_phage(33.33%)	21	NA	NA
WP_096295543.1|1697040_1697493_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_089036639.1|1698382_1699228_-	DNA cytosine methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	53.1	2.2e-43
WP_089036638.1|1699196_1699394_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_157742759.1|1699568_1700555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157742713.1|1701144_1701474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096295117.1|1701467_1701896_-	hypothetical protein	NA	A0A1L7N100	Ralstonia_phage	46.9	9.3e-30
WP_096295115.1|1702747_1703557_-|tail	tail fiber protein	tail	A0A1W6JT73	Escherichia_phage	45.1	2.6e-33
WP_157742760.1|1703637_1704201_-	hypothetical protein	NA	I6YY04	Aeromonas_phage	38.2	1.6e-05
WP_096295113.1|1705415_1706558_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	41.1	1.2e-60
WP_096295112.1|1706548_1706926_-|plate	phage baseplate protein	plate	Q6QIA0	Burkholderia_phage	43.6	5.1e-16
WP_096296104.1|1707004_1707553_-|plate	phage baseplate assembly protein V	plate	R9U0U6	Rhizobium_phage	34.5	6.6e-12
WP_096295111.1|1707566_1708670_-	hypothetical protein	NA	A4JWL3	Burkholderia_virus	43.2	7.4e-71
WP_096295110.1|1708669_1708897_-	hypothetical protein	NA	R9U1D8	Rhizobium_phage	36.1	1.9e-05
WP_096295109.1|1708893_1709790_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	38.0	4.4e-21
WP_096295545.1|1709789_1710314_-	hypothetical protein	NA	E5FFG5	Burkholderia_phage	38.7	1.0e-09
WP_096295546.1|1712409_1712682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096296149.1|1712678_1712852_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_096295547.1|1712844_1713150_-|tail	phage tail assembly protein	tail	A4JWK7	Burkholderia_virus	47.1	1.5e-10
WP_096295548.1|1713259_1713778_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	49.7	1.2e-42
WP_096295550.1|1714584_1716090_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	43.5	4.6e-108
WP_096295070.1|1716086_1716992_+|head	phage head morphogenesis protein	head	A0A0M4UTA3	Ralstonia_phage	46.9	1.8e-62
>prophage 4
NZ_CP023429	Neisseria sp. 10022 chromosome, complete genome	2511904	1933292	1994999	2511904	bacteriocin,integrase,transposase	uncultured_Mediterranean_phage(22.22%)	48	1921135:1921154	2000697:2000716
1921135:1921154	attL	ATCAAGGCCGTCTGAACCGC	NA	NA	NA	NA
WP_157742768.1|1933292_1933913_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_096295680.1|1934156_1935449_-	MFS transporter	NA	NA	NA	NA	NA
WP_096295681.1|1935901_1936837_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.8	2.5e-43
WP_096295682.1|1936840_1938703_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_096295683.1|1938774_1939038_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	48.2	1.6e-11
WP_096295685.1|1941260_1941785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096295686.1|1942107_1942887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157742769.1|1944449_1944605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157742770.1|1944963_1945179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157742803.1|1946992_1947910_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_096295688.1|1949276_1949690_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_096295689.1|1949927_1951469_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_096295690.1|1951480_1952866_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_096295691.1|1953008_1953800_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_096295692.1|1953891_1954566_-	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_096295693.1|1958900_1959428_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_096295694.1|1959629_1960769_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_096295695.1|1960938_1961364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096295696.1|1961366_1962173_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_096295697.1|1962292_1962670_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_096295698.1|1962729_1963461_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_096296169.1|1963544_1964333_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_096295699.1|1964458_1965838_-	TolC family protein	NA	NA	NA	NA	NA
WP_096295700.1|1967930_1969109_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_096295701.1|1969445_1969919_+	type IV pilin protein	NA	NA	NA	NA	NA
WP_096295702.1|1970001_1970457_+	type IV pilin protein	NA	NA	NA	NA	NA
WP_096295703.1|1971694_1972777_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_096295704.1|1972937_1974173_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	24.7	5.4e-22
WP_096295705.1|1974977_1975232_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_096295706.1|1975589_1977119_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	2.9e-81
WP_096295707.1|1978069_1980049_-	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	35.0	2.0e-95
WP_096295708.1|1980284_1980473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096296171.1|1980628_1981153_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_096295709.1|1981489_1982638_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096295710.1|1982888_1984550_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_096295711.1|1984688_1985594_-	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_096295712.1|1985676_1986552_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_096295713.1|1986765_1987491_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.0	1.2e-08
WP_096295714.1|1987759_1988062_+	DUF2288 domain-containing protein	NA	NA	NA	NA	NA
WP_096295715.1|1988260_1989448_+	putative hydroxymethylpyrimidine transporter CytX	NA	NA	NA	NA	NA
WP_096295716.1|1989761_1991144_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_096295717.1|1991412_1991781_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_096296172.1|1991889_1992378_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_096295718.1|1992370_1993336_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_096296147.1|1993793_1994174_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157742756.1|1994188_1994584_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.1	1.9e-13
WP_096295519.1|1994481_1994757_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	58.8	4.3e-20
WP_096295520.1|1994732_1994999_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	60.5	4.4e-22
2000697:2000716	attR	ATCAAGGCCGTCTGAACCGC	NA	NA	NA	NA
