The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022168	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 chromosome, complete genome	4991167	663234	701177	4991167	tail,capsid,integrase,holin,head,terminase,portal	Cronobacter_phage(72.22%)	44	663385:663400	696235:696250
WP_000478472.1|663234_664800_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
663385:663400	attL	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000983441.1|664796_665444_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|665675_666443_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|666700_668482_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|668471_669509_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568372.1|669512_670079_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_000514631.1|670095_670677_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|670820_671042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|671072_671576_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|671585_671813_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|671802_672228_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|672227_672629_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|672696_672930_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|672920_673781_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|673777_675799_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|675918_676125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|676098_676422_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|676418_677480_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|677476_679252_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|679412_680216_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|680277_681300_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|681303_682005_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000447487.1|682065_682554_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084218.1|682550_683057_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|683053_683761_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|683757_684885_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|684881_685337_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|685346_685640_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|685636_685978_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|685977_686310_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_001670161.1|686281_686470_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000411339.1|686456_686714_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|686901_688872_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|688868_689198_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|689194_690379_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|690371_690959_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|690968_693203_+|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|693215_693770_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|693759_694485_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|694456_695002_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_001680744.1|695004_696705_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
696235:696250	attR	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_115200405.1|697611_698376_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_000237776.1|698699_699206_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|699329_701177_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 2
NZ_CP022168	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 chromosome, complete genome	4991167	1160816	1187926	4991167	integrase,transposase	Escherichia_phage(33.33%)	29	1160754:1160813	1186162:1186981
1160754:1160813	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|1160816_1161521_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|1161581_1162418_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|1162417_1163221_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|1163281_1164097_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|1164404_1165256_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|1166011_1166716_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|1166762_1168067_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|1168105_1168813_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|1168809_1169046_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|1169042_1169405_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|1169422_1171117_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|1171168_1171591_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732293.1|1171626_1171902_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|1171915_1172266_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|1172337_1172772_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001089068.1|1174055_1175261_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_001322387.1|1175339_1175966_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001447544.1|1175943_1176630_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|1176637_1177024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|1177016_1177337_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|1177780_1178986_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001352368.1|1179351_1180560_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_011011079.1|1180692_1181301_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000429174.1|1181550_1181850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000250919.1|1182197_1182977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011011078.1|1183032_1183965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000173534.1|1183961_1184477_-	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
WP_001067855.1|1185453_1186158_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_085983317.1|1186763_1187926_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
1186162:1186981	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTATTGTCGTCTGGTGATGATTACTCTTCATTCATGCTTGCCGAACGAGTTGAAGCGATGTAAGAGGCCGTAGCTATCGATCCCAATAATCCCAAAATTTACCAGGCCTTTTATGAAGGCTCAAATTTGGCTCAATGGGTACGCCAACGCCTTCTGTGATACTGTAGGGGTTCCAAGTTTTACATAGTGTCTAATTTAATGCTATTTGTGGGTTGATAACCCAACTCACTTCGAACTGGTTTGTCGATTTGCTGAAGTTCTCAATTTGCCTGAAGGTTAATTCTACGCGCTGGATGACAGCTTTGCTGATGCAATGCTGAAGCTATATGGGGGAAAACGGGTGCAGTGGAAAAGGTGCATAATAAGTTAATTGGTCGTGTTAGTACCCCCCTTTAATGTTATGGTTTCTATCTTTATGAAATCTAAAAATAAAAGAACTTGAGCATTACTAAATATTACCGTGAAATCCCTATAAGGTGCACGGTATGATCCCCAAAAGACTGAAGGAAGCTTGATCCTACCCGCGTAATATGGGCACAACCCTAAGCGAGGTTCTGGTTTTCAAATTGTTCCGGACTGAGACCGCCACAGGCACTGTGACGACGCCACCGATTGTAATCACACTCACTATAATTAAACACTGCTGTCCGCATTATTTCCCGGCTGACAAAGTCCTCTCCGTGGATACATTCCACCCTCAGCGTATGGAAGAAGCTTTCCGCACAGGCATTGTCGTAACAACAACCTCTGGCGCTCATAC	NA	NA	NA	NA
>prophage 3
NZ_CP022168	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 chromosome, complete genome	4991167	1276382	1351774	4991167	tRNA,protease,tail,capsid,integrase,holin,head,lysis,transposase,terminase,portal	Salmonella_phage(43.1%)	88	1268463:1268479	1357621:1357637
1268463:1268479	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1276382_1277420_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1277535_1278225_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1278543_1278927_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1278988_1279576_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1279678_1280578_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1280595_1281930_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1282060_1282798_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1282782_1284405_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1284668_1284833_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1284829_1285405_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1285436_1286087_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1286086_1287043_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1287039_1287519_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1288016_1289246_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1289223_1289508_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1289548_1289788_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1289830_1290988_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1290950_1293878_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1294004_1294355_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1294376_1294535_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1294933_1295338_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1295467_1295704_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1295669_1296044_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1296128_1297112_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1297114_1297864_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1297874_1298222_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1298218_1298743_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1298742_1299216_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|1300080_1300320_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_001574100.1|1300309_1300615_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_000929803.1|1300654_1301257_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1301465_1302077_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1302073_1302214_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1302210_1302888_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1303160_1303724_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_096071034.1|1304230_1304419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1304633_1305320_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1305595_1305925_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|1305908_1306361_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|1306378_1306831_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1307066_1307468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1307754_1308300_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1308271_1310203_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1310186_1310390_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1310386_1311967_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1311956_1313453_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1313465_1313813_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1313867_1314896_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1314953_1315313_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1315323_1315707_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1315734_1316313_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1316361_1317492_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1317600_1318002_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|1318009_1318756_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|1318806_1319202_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1319198_1319537_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1319508_1322604_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1322606_1322936_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1322945_1323644_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1323650_1324388_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1324285_1324933_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1324994_1328357_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1328395_1328638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1328691_1331064_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1331060_1331885_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1331874_1332453_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1332549_1332777_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1332883_1333096_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1333158_1333224_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001526383.1|1333848_1333968_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1334680_1334818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1335296_1336790_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1337194_1338994_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1339010_1339985_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1340258_1340939_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1340935_1341841_+	GTPase Era	NA	NA	NA	NA	NA
WP_033567169.1|1341852_1342581_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1342592_1343324_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1343323_1343704_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1343815_1344076_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1344113_1345040_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1345155_1346352_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684027.1|1346373_1347291_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1347329_1348178_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1348293_1349187_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1349197_1350559_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1350562_1351198_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1351222_1351774_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1357621:1357637	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 4
NZ_CP022168	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 chromosome, complete genome	4991167	1705952	1735538	4991167	tail,holin,protease	Salmonella_phage(33.33%)	31	NA	NA
WP_000781589.1|1705952_1706447_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1706860_1707352_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1707341_1707605_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1707601_1710088_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1710094_1710790_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1710776_1711646_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1711761_1712211_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1712220_1712823_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1712843_1713461_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1713457_1714117_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1714168_1714906_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1714902_1715115_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_096071030.1|1715111_1715591_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1715587_1717519_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1717515_1718073_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_033572444.1|1718069_1719113_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1719156_1719804_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1720533_1721097_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1721288_1721492_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1721794_1722586_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1722882_1723086_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1723254_1725621_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1725949_1726939_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1726953_1727322_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1727350_1728682_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1728978_1729308_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1729900_1731142_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1731144_1731672_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1732049_1732493_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000884778.1|1734716_1735007_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1735034_1735538_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 5
NZ_CP022168	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 chromosome, complete genome	4991167	1807590	1816761	4991167	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1807590_1808538_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1808521_1809253_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1809233_1809341_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1809400_1810132_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1810354_1812040_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1812036_1812756_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1812802_1813270_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1813326_1813857_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1814028_1814487_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1814727_1816761_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP022168	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 chromosome, complete genome	4991167	1885069	1895575	4991167		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1885069_1886473_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1886650_1887544_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1887920_1889006_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1889005_1889905_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1889952_1890831_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1890831_1891383_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1891388_1892381_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1892377_1893151_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1893155_1894235_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1894261_1895575_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
NZ_CP022168	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 chromosome, complete genome	4991167	1981569	2032256	4991167	protease,tail,capsid,integrase,holin,head,plate,terminase,portal	Salmonella_phage(80.3%)	71	1976147:1976161	1992277:1992291
1976147:1976161	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1981569_1982043_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1982690_1982981_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1983352_1984150_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1984441_1985431_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1985432_1985675_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1985699_1986269_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|1986272_1986854_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|1986864_1987122_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|1987123_1987657_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|1987727_1988267_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|1988403_1989231_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|1989288_1989660_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|1990199_1990424_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|1990386_1990725_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|1990930_1991626_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1991723_1991948_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1991976_1992531_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1992277:1992291	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087404.1|1992527_1993670_+	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|1993666_1993891_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|1993887_1994862_+	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|1994858_1995332_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|1995328_1996204_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|1996212_1996602_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|1996618_1997479_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_070793644.1|1997486_1998476_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_020899401.1|1998489_1999242_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|1999392_1999650_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|1999795_2000182_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|2000168_2000450_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|2000449_2001064_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|2001060_2001453_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|2001915_2002248_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|2002298_2002649_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|2002774_2003269_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|2003265_2004999_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|2005010_2005193_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|2005192_2006434_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|2006411_2007062_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|2007076_2008282_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|2008331_2008532_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|2008534_2008858_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|2008854_2009259_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|2009230_2009743_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|2009739_2010297_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|2010318_2010483_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|2010472_2011969_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|2011968_2012325_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|2012321_2012648_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|2012732_2014658_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|2014674_2015124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|2015183_2016524_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|2016520_2017579_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|2017578_2018112_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|2018116_2018530_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|2018522_2019602_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|2019604_2020192_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|2020178_2021741_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|2021710_2022316_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|2022429_2022663_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|2022737_2022851_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|2022898_2023312_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|2023308_2023521_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|2024714_2024876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2025002_2025422_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2025424_2026693_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2027147_2027360_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2027370_2027559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2027819_2029016_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2029665_2029965_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2030056_2030752_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2030825_2032256_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP022168	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 chromosome, complete genome	4991167	2136300	2143109	4991167	tail,integrase	Salmonella_phage(33.33%)	11	2138510:2138532	2148225:2148247
WP_000856224.1|2136300_2136531_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2136668_2137043_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2137043_2137919_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2137935_2138289_+	YebY family protein	NA	NA	NA	NA	NA
2138510:2138532	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2138662_2139517_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2139576_2140071_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2140260_2140491_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2140544_2141078_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2141334_2141502_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2141566_2141755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2142227_2143109_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2148225:2148247	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 9
NZ_CP022168	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 chromosome, complete genome	4991167	2930189	3021106	4991167	tRNA,protease,tail,integrase,holin,lysis,terminase	Salmonella_phage(58.7%)	91	2954283:2954302	3018179:3018198
WP_000938191.1|2930189_2930870_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2931490_2932150_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2932236_2932566_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2932562_2932844_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2932892_2933672_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2933697_2934246_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2934460_2935672_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2935729_2936047_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2936091_2936508_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2936678_2937341_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2937435_2937894_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2937929_2939984_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2940107_2940554_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2940572_2942726_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2942712_2943318_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2943534_2944044_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2944400_2945453_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2945524_2945977_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2946162_2947923_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2947991_2948510_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2948609_2948777_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|2949032_2949596_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2949592_2951233_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2951237_2952491_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2952505_2954413_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2954283:2954302	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2954425_2956534_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2956632_2957742_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2957738_2958281_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2958446_2959457_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2959664_2962277_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2962703_2962895_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2963165_2963852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|2963836_2964136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2964204_2964831_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2965478_2966447_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|2966922_2967504_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|2967503_2969942_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|2969995_2970238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2970276_2973627_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_001576012.1|2973698_2974403_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2974300_2975038_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2975047_2975743_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2975832_2976366_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2976482_2976980_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|2977079_2977412_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|2978532_2979078_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|2979546_2979993_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|2980010_2980463_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|2980446_2980776_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|2981051_2981738_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2982098_2982548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2982683_2982809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|2983003_2983693_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|2983689_2983830_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|2983826_2984438_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|2984646_2985249_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|2985333_2985555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|2985664_2985898_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|2986489_2987086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|2987097_2988075_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|2988129_2988387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|2988386_2989031_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|2989034_2989343_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|2989346_2989805_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_020899441.1|2989801_2990149_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|2990159_2990909_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062943.1|2990911_2991895_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|2991979_2992300_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|2992334_2992562_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2992667_2993102_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|2993398_2993530_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|2993578_2993929_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_020899444.1|2994055_2997256_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_014344386.1|2997218_2998376_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2998418_2998658_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2998698_2998947_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|2998991_3000284_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|3000478_3001681_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|3001758_3003195_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|3003439_3004654_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3004970_3005432_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3005632_3007033_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|3007639_3008731_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|3008915_3010106_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109471.1|3010167_3010815_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3010842_3011391_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|3011650_3013492_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|3013836_3018303_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
3018179:3018198	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|3018302_3019007_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3018987_3020310_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|3020302_3021106_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP022168	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 chromosome, complete genome	4991167	3071169	3079901	4991167	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3071169_3072424_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3072887_3073346_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3073537_3075814_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3075844_3076165_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3076488_3076710_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3076839_3078786_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3078782_3079901_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 11
NZ_CP022168	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 chromosome, complete genome	4991167	3688512	3734087	4991167	protease,coat,integrase,lysis,terminase,portal	Salmonella_phage(56.45%)	63	3679918:3679934	3743301:3743317
3679918:3679934	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_000915528.1|3688512_3688875_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3688871_3689804_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3689793_3691251_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129928.1|3691309_3693313_-	endorhamnosidase	NA	E7C9U9	Salmonella_phage	100.0	0.0e+00
WP_000532175.1|3693448_3693700_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_001085430.1|3693799_3693979_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000757527.1|3693992_3694358_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_000889769.1|3694388_3694718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262317.1|3694735_3696649_-	hypothetical protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
WP_033572424.1|3696648_3697932_-	DNA injection protein	NA	E7C9U5	Salmonella_phage	94.7	4.5e-221
WP_000964900.1|3697942_3698632_-	hypothetical protein	NA	E7C9U4	Salmonella_phage	100.0	4.3e-109
WP_000627695.1|3698634_3699090_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
WP_022631116.1|3699089_3699791_-	hypothetical protein	NA	B8K1I3	Salmonella_phage	98.7	1.8e-70
WP_033572423.1|3699794_3701213_-	Packaged DNA stabilization protein gp10	NA	A0A220NQZ5	Salmonella_phage	99.6	5.4e-276
WP_001166093.1|3701172_3701673_-	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	100.0	2.5e-90
WP_000538674.1|3701656_3702217_-	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_022630931.1|3702257_3703550_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.5	1.2e-242
WP_006831698.1|3703549_3704461_-	scaffolding protein	NA	Q5C834	Enterobacteria_phage	100.0	1.7e-161
WP_000774652.1|3704474_3706652_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000417860.1|3706651_3708151_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000729923.1|3708128_3708617_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3708620_3709025_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3709024_3709414_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3709417_3709660_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_015995148.1|3709882_3710413_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	100.0	1.3e-94
WP_001687043.1|3710625_3711093_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3711089_3711587_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3711564_3711768_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_033572422.1|3712304_3713078_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	96.5	1.2e-128
WP_023217800.1|3713235_3713478_-	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	92.5	1.3e-36
WP_033572421.1|3713474_3713657_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	3.6e-23
WP_023250726.1|3714095_3714332_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	97.4	3.9e-38
WP_033572420.1|3714324_3714501_-	protein ninF	NA	A0A192Y808	Salmonella_phage	91.4	6.9e-24
WP_033572419.1|3714493_3714895_-	hypothetical protein	NA	G9L690	Escherichia_phage	85.7	2.7e-63
WP_000113767.1|3714897_3715074_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	98.3	7.9e-28
WP_001573980.1|3715210_3716083_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
WP_000736920.1|3716079_3716520_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	2.9e-79
WP_001248409.1|3716593_3717970_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
WP_000067076.1|3717966_3718800_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	99.6	2.4e-151
WP_001125981.1|3718792_3718939_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3718973_3719255_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000067726.1|3719365_3719581_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_023135942.1|3719699_3720362_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
WP_033572418.1|3720713_3721016_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	6.3e-49
WP_033572417.1|3721028_3721616_-	superinfection exclusion protein B	NA	A0A0M4R594	Salmonella_phage	99.0	6.2e-85
WP_033572416.1|3721808_3722309_+	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.5	1.2e-31
WP_033572415.1|3722342_3722630_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	97.9	1.1e-47
WP_001539176.1|3722949_3723123_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
WP_000156731.1|3723103_3723292_+	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_033572414.1|3723421_3724129_+	recombinase	NA	A0A1R3Y600	Salmonella_virus	98.7	2.9e-137
WP_001253476.1|3724128_3724413_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111312.1|3724459_3724753_+	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001214769.1|3724763_3724934_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	94.6	5.7e-23
WP_050517928.1|3724930_3725455_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	96.9	4.2e-48
WP_033572413.1|3725451_3726357_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	95.4	5.3e-51
WP_033572412.1|3726358_3726577_+	DUF4014 domain-containing protein	NA	C6ZR28	Salmonella_phage	98.6	3.7e-35
WP_033572411.1|3726580_3727252_+	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	64.6	5.6e-90
WP_001277764.1|3727878_3728058_+	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	100.0	1.9e-29
WP_033572425.1|3728158_3728788_+	hypothetical protein	NA	A0A220NQT7	Salmonella_phage	96.7	7.3e-116
WP_033572410.1|3729017_3730181_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	99.5	5.3e-229
WP_000893231.1|3730386_3731637_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3731648_3732752_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3733034_3734087_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3743301:3743317	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 12
NZ_CP022168	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 chromosome, complete genome	4991167	4572128	4619172	4991167	tRNA,tail,plate	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4572128_4573127_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4573214_4574525_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4574771_4575287_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4575385_4575595_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4575616_4575730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4575726_4577052_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4577230_4577839_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4577947_4578316_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4578486_4580907_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4581005_4581878_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4581891_4582389_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4582569_4583487_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4583650_4585009_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4585097_4586207_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4586568_4587759_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4587890_4589435_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4589449_4590340_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4590505_4590916_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4591058_4593155_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4593154_4593892_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_125572646.1|4593888_4594557_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4594590_4594833_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4595276_4596926_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4597270_4598620_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4598752_4599100_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4599675_4599963_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4599965_4600571_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4600583_4600898_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4601057_4601513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4601509_4601707_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4601696_4603124_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4603123_4603648_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4603699_4604017_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4603976_4604105_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4604201_4606556_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4606555_4607509_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4607508_4607718_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4607705_4608749_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4608758_4609481_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4609808_4610171_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4610167_4611097_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4611096_4612644_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4612807_4613167_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4613157_4614273_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4614265_4614898_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4614900_4616646_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4616650_4617256_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4617252_4617708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4617956_4618247_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4618443_4619172_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP022169	Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 plasmid pWW012, complete sequence	151609	128215	136102	151609	transposase,integrase	Escherichia_phage(33.33%)	10	119923:119938	138690:138705
119923:119938	attL	TTCAAGGCATCTGATA	NA	NA	NA	NA
WP_001572415.1|128215_128827_-	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	71.1	1.2e-09
WP_000149861.1|128847_129111_-	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
WP_001067858.1|129414_130119_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_096071053.1|130009_130327_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	54.0	6.3e-07
WP_000454193.1|130452_130803_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|131005_132019_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|132185_133028_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000050382.1|133123_133732_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|133789_134581_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|134842_136102_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
138690:138705	attR	TTCAAGGCATCTGATA	NA	NA	NA	NA
