The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017232	Salmonella enterica strain FORC_051 chromosome, complete genome	4679637	1414831	1420884	4679637		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|1414831_1414999_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|1415014_1415158_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|1416147_1418070_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|1418087_1418342_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|1418310_1418700_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|1419942_1420884_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 2
NZ_CP017232	Salmonella enterica strain FORC_051 chromosome, complete genome	4679637	1657297	1666468	4679637	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1657297_1658245_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1658228_1658960_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1658940_1659048_-	protein YohO	NA	NA	NA	NA	NA
WP_001240420.1|1659107_1659839_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_000272845.1|1660061_1661747_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1661743_1662463_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1662509_1662977_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1663033_1663564_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1663735_1664194_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1664434_1666468_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP017232	Salmonella enterica strain FORC_051 chromosome, complete genome	4679637	1733666	1744173	4679637		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1733666_1735070_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1735247_1736141_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1736517_1737603_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1737602_1738502_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1738549_1739428_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1739428_1739980_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1739985_1740960_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1740975_1741749_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1741753_1742833_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1742859_1744173_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP017232	Salmonella enterica strain FORC_051 chromosome, complete genome	4679637	1851168	1904592	4679637	transposase,integrase,portal,terminase,tail,capsid,protease,plate,head,holin	Salmonella_phage(76.36%)	65	1859997:1860011	1908187:1908201
WP_001127942.1|1851168_1853007_+|tail	tail fiber protein	tail	I1TR70	Cronobacter_phage	49.0	1.0e-32
WP_000028416.1|1853580_1854462_-	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	42.0	3.3e-29
WP_000072670.1|1854872_1855436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001084817.1|1855797_1856295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042271.1|1856773_1857025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001680077.1|1857096_1858371_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
WP_000598920.1|1859696_1860494_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1859997:1860011	attL	AGGGATGCCGCTGGC	NA	NA	NA	NA
WP_000532847.1|1860785_1861775_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|1861776_1862004_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061370.1|1862043_1862613_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_000208076.1|1862609_1863473_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_000267991.1|1863469_1863763_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000065085.1|1864034_1864394_-	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000071068.1|1864390_1864906_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000764235.1|1864902_1865133_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1865203_1865743_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000551790.1|1865837_1866755_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_000078504.1|1867324_1867576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067433.1|1867651_1867837_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001020644.1|1868042_1868738_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001191666.1|1868835_1869060_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509728.1|1869088_1869643_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001087406.1|1869639_1870797_+	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000620702.1|1870793_1871018_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000096529.1|1871014_1871989_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000054227.1|1871985_1872459_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000200166.1|1872455_1873337_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000779149.1|1873345_1873735_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_001061459.1|1873751_1874612_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_012543375.1|1874619_1875609_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001047141.1|1875622_1876375_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_000357930.1|1876424_1877498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765639.1|1877510_1878083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294874.1|1878171_1878561_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000226304.1|1878547_1878829_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001075993.1|1878828_1879446_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000127618.1|1879442_1879982_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001135228.1|1880005_1880356_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000501481.1|1880502_1880940_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_000257219.1|1880939_1882670_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_000838395.1|1882666_1882825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905357.1|1882941_1884036_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000003793.1|1884028_1884631_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_000766103.1|1884640_1885870_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000927251.1|1885949_1886273_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000776844.1|1886269_1886674_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_001135695.1|1886645_1887158_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000779215.1|1887154_1887715_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_000497739.1|1887718_1887883_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007993.1|1887872_1889369_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000515952.1|1889368_1889725_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1889721_1890048_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785387.1|1890132_1892061_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000863817.1|1892094_1893435_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_001066630.1|1893431_1894490_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273650.1|1894489_1895023_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_000605050.1|1895027_1895441_+	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001699732.1|1895433_1896513_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	5.5e-204
WP_001207832.1|1896515_1897103_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554738.1|1897089_1898652_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_015701331.1|1898621_1899221_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000492926.1|1899505_1900513_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1900725_1900947_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_001176778.1|1902289_1903108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028172.1|1903569_1904592_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
1908187:1908201	attR	AGGGATGCCGCTGGC	NA	NA	NA	NA
>prophage 5
NZ_CP017232	Salmonella enterica strain FORC_051 chromosome, complete genome	4679637	2436447	2452391	4679637	tRNA,holin	Escherichia_phage(64.71%)	23	NA	NA
WP_001082296.1|2436447_2436882_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2436931_2437270_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000729249.1|2437909_2438083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000802786.1|2438115_2438661_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2438657_2438939_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2438928_2439117_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2439038_2439434_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2441604_2442141_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2442137_2442428_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2442427_2443027_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000734094.1|2443089_2443260_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000882662.1|2443550_2443763_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556390.1|2444132_2445065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2445061_2445616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2445777_2446107_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2446379_2446847_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2447231_2447387_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2447494_2448016_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_000560208.1|2448453_2448675_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2448759_2449077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2449104_2449722_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2450038_2450974_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2451017_2452391_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP017232	Salmonella enterica strain FORC_051 chromosome, complete genome	4679637	2643681	2692931	4679637	integrase,lysis,tail,protease,holin	Salmonella_phage(27.27%)	48	2673446:2673475	2693067:2693096
WP_000984498.1|2643681_2644563_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|2644756_2646805_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2646824_2647511_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2647608_2648106_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2648234_2649518_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001529852.1|2649486_2652120_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001531515.1|2652197_2653637_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2653754_2653991_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|2654101_2654293_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986173.1|2654311_2654962_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_001134856.1|2655185_2655350_-	membrane protein	NA	NA	NA	NA	NA
WP_000182071.1|2655634_2656357_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2657040_2657436_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2657765_2658242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025515.1|2658614_2659034_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001576019.1|2659406_2659676_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001576018.1|2659841_2659982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2663120_2664035_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2664167_2664326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|2664335_2664950_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000951652.1|2665437_2665584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2666084_2666210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012543349.1|2666779_2666980_+	phage encoded PagK	NA	NA	NA	NA	NA
WP_001687735.1|2667076_2667577_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_000348541.1|2669681_2670173_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001576014.1|2670227_2670416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2670480_2670648_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|2670904_2671438_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_001013467.1|2671491_2671722_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_077681935.1|2671911_2672406_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
WP_000622159.1|2673049_2673319_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.8	2.7e-11
2673446:2673475	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_001536069.1|2674263_2675064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2675543_2676266_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001152416.1|2680320_2681016_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2681105_2681639_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2682533_2683013_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2683030_2683483_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2683466_2683796_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2684071_2684758_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2685118_2685568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2685941_2686466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2686562_2687252_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2687381_2687609_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2687605_2688205_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000911593.1|2688268_2688517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2689205_2691185_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2691598_2691877_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2691851_2692931_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2693067:2693096	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP017232	Salmonella enterica strain FORC_051 chromosome, complete genome	4679637	2865323	2905590	4679637	protease,tail	Salmonella_phage(23.08%)	39	NA	NA
WP_000938186.1|2865323_2866004_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2866622_2867282_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2867368_2867698_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2867694_2867976_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2868024_2868804_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2868829_2869378_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2869592_2870804_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2870861_2871179_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001676378.1|2871223_2871637_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2871810_2872473_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2872567_2873026_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2873061_2875116_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2875239_2875686_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2875704_2877858_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2877844_2878450_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2878666_2879176_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2879532_2880585_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2880656_2881109_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2881294_2883055_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2883123_2883642_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2883741_2883909_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2884164_2884728_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2884724_2886365_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2886369_2887623_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2887637_2889545_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2889557_2891666_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2891764_2892874_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2892870_2893413_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2893578_2894589_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2894796_2897409_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2897835_2898027_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2898297_2898984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2899343_2899970_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2900617_2901586_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2901811_2902060_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2902063_2902645_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2902644_2904354_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2904350_2904977_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2904960_2905590_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
>prophage 8
NZ_CP017232	Salmonella enterica strain FORC_051 chromosome, complete genome	4679637	2977300	2984613	4679637	integrase,protease	Ralstonia_phage(16.67%)	7	2972097:2972111	2983349:2983363
2972097:2972111	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2977300_2977678_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2977839_2978037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2978249_2980526_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2980556_2980877_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2981200_2981422_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2981551_2983498_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2983349:2983363	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2983494_2984613_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP017233	Salmonella enterica strain FORC_051 plasmid pFORC51, complete sequence	96999	31238	70568	96999	transposase,integrase	Escherichia_phage(30.0%)	51	26341:26356	73846:73861
26341:26356	attL	TCGATAAGCTGGAAAT	NA	NA	NA	NA
WP_023327680.1|31238_31943_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
WP_000477657.1|33150_33603_+	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_001676658.1|33724_34009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077681954.1|33965_34205_+	phospholipase	NA	NA	NA	NA	NA
WP_016710725.1|34383_34650_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001541552.1|34899_34977_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001676666.1|34957_35839_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_071530245.1|36694_36916_+	YjiK family protein	NA	NA	NA	NA	NA
WP_000417897.1|37012_37759_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000725064.1|38024_38582_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	37.4	5.8e-24
WP_001701740.1|38671_39517_-	YjiK family protein	NA	NA	NA	NA	NA
WP_001141717.1|39567_39714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077907617.1|39703_40360_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000135399.1|40603_40954_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000004289.1|40938_41151_-	transcriptional regulator PefI	NA	NA	NA	NA	NA
WP_001680213.1|41410_42265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085742.1|42447_43026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038509.1|43022_43715_-	fimbrial chaperone PefD	NA	NA	NA	NA	NA
WP_000007891.1|43707_46116_-	outer membrane usher protein PefC	NA	NA	NA	NA	NA
WP_000748204.1|46342_46867_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000979451.1|47141_47444_-	transcriptional regulator PefB	NA	NA	NA	NA	NA
WP_015059605.1|47472_47784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000751876.1|48150_48537_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	46.9	3.0e-27
WP_015059604.1|48589_48751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000461382.1|49077_50067_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.9	5.0e-103
WP_001057493.1|50975_51206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077681952.1|51339_51861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813641.1|52536_52755_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159863.1|52756_53062_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001266176.1|53063_53354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000198608.1|53350_53872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000082169.1|53906_54689_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_000545756.1|54697_55411_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001541544.1|55414_55924_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000905606.1|55917_56403_+	membrane protein	NA	NA	NA	NA	NA
WP_071530243.1|56679_56967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000900095.1|57122_57683_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_001541541.1|57749_58100_-	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
WP_000064919.1|58156_58582_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
WP_001676646.1|58708_59359_-	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
WP_001122242.1|59620_60346_-	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
WP_001676648.1|60626_62402_-	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
WP_001526987.1|62453_62621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001676649.1|62583_63351_-	virulence protein SpvA	NA	NA	NA	NA	NA
WP_001576629.1|63524_63689_-	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
WP_000346690.1|63862_64756_-	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
WP_001121400.1|65363_66401_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_077907510.1|66589_67615_-	ExeA family protein	NA	NA	NA	NA	NA
WP_000098781.1|67547_69212_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_001240330.1|69195_69756_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
WP_001067855.1|69863_70568_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
73846:73861	attR	TCGATAAGCTGGAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP017233	Salmonella enterica strain FORC_051 plasmid pFORC51, complete sequence	96999	83360	91748	96999	transposase	Escherichia_phage(71.43%)	10	NA	NA
WP_023327680.1|83360_84065_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
WP_001011939.1|84208_84850_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|84999_85500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|85579_86284_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000064277.1|86619_87594_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	5.1e-84
WP_000427676.1|87593_88799_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|89213_90155_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_096059431.1|90102_90756_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|90812_91148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|91331_91748_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
