The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	2366	73417	4783004	protease,tRNA,transposase,holin,tail,plate	Salmonella_phage(15.0%)	55	NA	NA
WP_085044592.1|2366_3005_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	40.0	9.3e-10
WP_043143990.1|3653_4013_+|plate	baseplate assembly protein	plate	E5E3R0	Burkholderia_phage	50.4	4.1e-23
WP_096071815.1|4909_5512_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	36.4	1.4e-28
WP_085044596.1|5508_6264_+	hypothetical protein	NA	A0A0A7RTP0	Clostridium_phage	32.0	2.3e-15
WP_157738319.1|6550_6727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096071817.1|7148_8327_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	60.6	8.0e-132
WP_085044599.1|8336_8852_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	62.0	6.3e-57
WP_085044600.1|8918_9203_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	57.3	2.0e-20
WP_085044601.1|9211_9343_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_085044602.1|9339_12300_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	53.3	1.8e-111
WP_085044603.1|12739_13318_+	Rha family transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	53.7	9.6e-30
WP_085044604.1|13322_13814_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	50.7	4.2e-34
WP_085044605.1|13813_14974_+	phage late control D family protein	NA	A0A1S5NV58	Burkholderia_phage	56.0	2.2e-97
WP_005317863.1|15184_15490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317866.1|16080_17532_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_096071818.1|17930_18050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317874.1|18253_19261_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	1.9e-17
WP_042468552.1|19257_20316_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	1.5e-07
WP_017412678.1|20341_22159_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017412677.1|22309_23353_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_088814299.1|24029_24947_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157738362.1|26408_27479_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088822010.1|27463_30088_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.4	4.0e-38
WP_017411857.1|30196_30952_+	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_005317892.1|30948_32313_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005317894.1|32323_32851_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005317897.1|32918_33326_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005317900.1|33342_33978_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_042468813.1|33989_35225_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_088814300.1|35520_38520_-	chitinase	NA	A0A1X9VNM7	Mimivirus	29.1	2.6e-25
WP_034283532.1|39050_41195_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_042469031.1|42155_43571_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017411852.1|46046_46700_+	opacity-associated protein OapA	NA	NA	NA	NA	NA
WP_005317918.1|46971_47181_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	58.7	4.8e-16
WP_005317921.1|48655_49201_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	36.4	2.7e-26
WP_017411851.1|49247_50327_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_005317927.1|50366_51239_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_005317929.1|51235_51505_+	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_005317932.1|51494_51758_+	DUF2960 domain-containing protein	NA	NA	NA	NA	NA
WP_005317936.1|51760_52159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317941.1|52391_52886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317944.1|53057_55031_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	25.9	1.7e-09
WP_011898395.1|55105_55453_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_088814301.1|55873_58150_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_085941570.1|58545_58680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317957.1|58932_60150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468084.1|60392_62072_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	27.6	8.7e-47
WP_042468083.1|62081_63545_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011898392.1|64475_65753_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_042468082.1|65852_69413_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	23.5	1.5e-11
WP_005317982.1|69466_69676_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_005317984.1|69964_71260_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_085941421.1|71289_72222_-	glutaminase B	NA	NA	NA	NA	NA
WP_042468081.1|72339_72672_-	YggL family protein	NA	NA	NA	NA	NA
WP_017412397.1|72703_73417_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	112716	163752	4783004	tRNA,transposase,integrase	Klosneuvirus(28.57%)	39	103604:103620	156359:156375
103604:103620	attL	GCCTGGCCTCCCTGATG	NA	NA	NA	NA
WP_005318109.1|112716_113682_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005309538.1|113707_114004_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005318113.1|114079_114712_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017412815.1|121830_122109_-	Pathogenicity locus	NA	NA	NA	NA	NA
WP_088814398.1|122181_122802_-	ribonuclease	NA	NA	NA	NA	NA
WP_005320532.1|123068_123629_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011899092.1|123733_124066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412813.1|124067_124508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005320527.1|124561_125470_-	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_005320525.1|125650_126109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468897.1|126128_127361_-	MFS transporter	NA	NA	NA	NA	NA
WP_005320516.1|127585_128455_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042468898.1|128651_129914_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.7	2.2e-47
WP_042468899.1|130002_131274_-	membrane protein	NA	NA	NA	NA	NA
WP_076611341.1|131747_132665_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|132847_133765_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_034283822.1|134323_135715_+	T3SS effector protein-tyrosine-phosphatase AopH	NA	NA	NA	NA	NA
WP_076611341.1|136256_137174_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157738321.1|137177_137825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814343.1|137867_139004_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_096071822.1|139077_139983_-	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	58.8	4.1e-75
WP_088814309.1|140122_140374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814310.1|140357_140996_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	27.5	2.8e-06
WP_088814162.1|141253_142171_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_080697447.1|142660_142843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469229.1|143007_143160_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_076611341.1|143762_144680_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814312.1|144759_145626_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042467552.1|145795_147010_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	45.0	5.6e-88
WP_085941523.1|147378_148023_+	RDD family protein	NA	NA	NA	NA	NA
WP_005315733.1|148095_149166_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_088814399.1|149191_150298_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_005315744.1|152160_152616_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_042467555.1|152681_155546_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.0	1.2e-136
WP_005315753.1|157030_157696_+	DedA family protein	NA	NA	NA	NA	NA
156359:156375	attR	GCCTGGCCTCCCTGATG	NA	NA	NA	NA
WP_011899145.1|157832_158660_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_005315760.1|159581_159770_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	5.0e-12
WP_005315763.1|159863_161111_-	aspartate kinase	NA	NA	NA	NA	NA
WP_017412245.1|161127_163752_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.1	3.3e-77
>prophage 3
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	229190	292262	4783004	transposase	Bacillus_thuringiensis_phage(37.5%)	53	NA	NA
WP_076611341.1|229190_230108_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315988.1|230422_231802_+	ATP-dependent RNA helicase DbpA	NA	E3T5E1	Cafeteria_roenbergensis_virus	33.1	1.7e-48
WP_005315990.1|231916_232207_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005315995.1|232516_232915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315998.1|233187_234615_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_042468800.1|234698_234917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941516.1|235027_235951_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_017412591.1|236141_237497_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_042468798.1|237533_239252_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_005316004.1|239241_240000_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_096071823.1|240162_241023_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_005316010.1|241022_241940_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_042468793.1|241950_243357_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	29.5	5.1e-08
WP_088814343.1|244519_245656_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|246586_247504_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|248224_249142_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157738322.1|249976_250231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814343.1|250488_251625_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005316030.1|251835_252168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814317.1|255595_256540_+	hypothetical protein	NA	Q56AS0	Bacillus_thuringiensis_phage	66.0	7.3e-11
WP_005316045.1|256605_257220_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	85.1	1.8e-98
WP_005316047.1|257241_257667_-	hypothetical protein	NA	Q56AR5	Bacillus_thuringiensis_phage	64.9	5.4e-22
WP_088814318.1|257876_258878_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_005316050.1|258874_259627_+	lipase chaperone	NA	NA	NA	NA	NA
WP_042468855.1|259885_260587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005316053.1|260633_261029_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_042468856.1|261227_263405_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_005316058.1|265378_265555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468341.1|265719_266988_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	26.4	1.0e-15
WP_088814320.1|267086_267725_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_088814321.1|268033_269209_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_005316069.1|269404_269986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005316072.1|270209_270662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005316077.1|271136_272609_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_034282173.1|272671_273418_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005316084.1|273474_273720_-	DUF3624 family protein	NA	NA	NA	NA	NA
WP_011899119.1|273716_274262_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005316090.1|274450_275893_+	RimK family alpha-L-glutamate ligase	NA	NA	NA	NA	NA
WP_011899118.1|275920_276454_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	31.3	1.6e-07
WP_042468339.1|276509_278126_-	glycosidase	NA	NA	NA	NA	NA
WP_042468338.1|278275_280243_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_005316103.1|280487_280745_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_005316107.1|281003_282968_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_005316110.1|283032_283503_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085941511.1|283619_284180_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_005316116.1|284195_285140_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_085941657.1|285225_286524_+	DUF3391 domain-containing protein	NA	NA	NA	NA	NA
WP_005316122.1|286582_287746_+	CinA family nicotinamide mononucleotide deamidase-related protein	NA	NA	NA	NA	NA
WP_005316125.1|287789_288884_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005316129.1|288880_289810_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.9	3.2e-19
WP_085941510.1|289802_290777_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_157669189.1|291065_291296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|291344_292262_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	324380	354231	4783004	integrase,transposase	Shigella_phage(50.0%)	26	346328:346387	350884:351947
WP_088814343.1|324380_325517_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005316246.1|326201_326519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|326905_327823_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_080697428.1|327847_328048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814324.1|328951_330082_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_005316273.1|330171_330939_-	thiazole synthase	NA	NA	NA	NA	NA
WP_005316276.1|330940_331153_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_042468928.1|331149_331923_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_005316282.1|331912_333487_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_042468927.1|333483_335490_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_088814325.1|336533_337451_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668971.1|337591_337927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085941409.1|337978_339140_+|transposase	IS3-like element ISAs6 family transposase	transposase	Q716C2	Shigella_phage	51.6	2.8e-84
WP_076611341.1|340081_340999_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668969.1|341361_343131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|343309_344227_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_034283822.1|344482_345874_+	T3SS effector protein-tyrosine-phosphatase AopH	NA	NA	NA	NA	NA
346328:346387	attL	GGCGTTGTTTCCTAAATCGATGCAGCTTGAATGGAACTAATTGAAAACCCAGTGATCTGA	NA	NA	NA	NA
WP_076611341.1|346415_347333_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_139403308.1|347749_348139_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017413139.1|348051_348438_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005320985.1|348506_348737_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005320982.1|348733_349147_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_017413138.1|349224_349578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|349937_350855_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814123.1|351089_352007_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
350884:351947	attR	TCAGATCACTGGGTTTTCAATTAGTTCCATTCAAGCTGCATCGATTTAGGAAACAACGCCCATTGAGGATCAACTCAAGTGTCGAACCATCCGGCTGCGTAACCGTGTGATGATAGTTGACGTAAGGTACTGCGGCTTCCGTTTGAACAGGGCGTTGTTGCCCAAATCAGCCAGCAAATCATGATTTCCCCAGCCCCAAGTGACCGTTACACTCGGGGCTTTCTGACAGGCAGACCAAGGGTGTTCAGTTTGTTTATCGCGCTCACATACGCCATCACTTCTCCCACTTGACCATTGTATTTTCGCAGGGTGATTTGGCCTGCCATTAACTGTTTGAACCGGAACATCGCTGTCTCTGCCAGCGAACGACGGTGATACCCCGATATCTTCTTCCAGTGCGCCAGCCCTTCCTTGCTCATCACCTGCACCGCCTCATTTCTCGGATGGCCCTTTTTCCATAGCCCTGCGTTCTTGCGAGGCGGGATACACGCCGTCGCCCCTTTACGCGCAATCAACCGATGGCTGGCTTTGCTGTCATAGGCGCCATCCGCGTAAACACGCCCCAGCTTGCGACGCAGAGGATTGAGCAAGGTCGGCAACACCTCAGCGTCATGCACATTCTCCAGCGACACTTCTGCCGCCACGATATCGTGAGTCACCGGATCTACCGCCAGATGCAACTTGCGCCAGACTCGACGTTTCTCAGCGCCGTGTTTTCTGACTTTCCACTCGCCTTCACCAAACACTTTCAGACCCGTCGAGTCGATAACCAGGTCGGTAATGCGCCCCTTAGGGGGCTGTCGATAGGCCACCTTCACTGTGCGTGCACGCTTGCTGACACAGCTGTAGTCCGGGGCACACAGCGGCACATTCATCAGCTCGAACAGGGAGTCGAGTAGCCCCTGAGTGGCTCGCAGCGTGAGGCTGAAAATCCCTTTGAGCATCAGAAAGGTACAGATGCTCTGGTCGGTGTAGAGCTGACTGCGTCCCCGTTTTCCGTGATGGTCTTGGTGAAACCAGTTATCCATGGCCTCGGCATCAACCCAGAAAGTGAGAGAGCCACG	NA	NA	NA	NA
WP_011898961.1|353016_354231_-|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
>prophage 5
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	648383	685527	4783004	protease,tRNA,transposase	Sodalis_phage(11.11%)	29	NA	NA
WP_011899080.1|648383_649415_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005318424.1|650167_650344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042467792.1|650443_651091_+	AAA family ATPase	NA	Q2A085	Sodalis_phage	47.0	9.1e-45
WP_005318419.1|651092_651461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011898961.1|652010_653225_-|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_042468289.1|653399_655127_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.2	4.2e-12
WP_017412477.1|655178_656189_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_005318415.1|656205_657726_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.2	1.4e-11
WP_042468288.1|657779_658766_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_042468286.1|659000_662078_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	53.1	0.0e+00
WP_011898254.1|662296_663301_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005318411.1|663505_664519_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	47.1	1.1e-84
WP_042468290.1|664602_665661_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_005318407.1|665657_666806_+	galactokinase	NA	NA	NA	NA	NA
WP_005318405.1|666897_667878_+	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_017412482.1|668029_669025_+	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_005318402.1|669283_670099_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_005318399.1|670162_670840_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011898253.1|670832_671453_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	26.7	2.3e-05
WP_085941393.1|671534_672194_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_017413000.1|672414_674160_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	35.7	5.4e-84
WP_005318391.1|674163_674991_+	cell division protein	NA	NA	NA	NA	NA
WP_005318389.1|675182_675716_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_042468283.1|675780_677109_+	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	29.9	3.4e-46
WP_005318384.1|677182_678577_-	MFS transporter	NA	NA	NA	NA	NA
WP_042468281.1|678767_679688_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088814113.1|679945_682531_+	nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_076611341.1|682575_683493_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|684390_685527_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	940424	961742	4783004	protease,transposase	Planktothrix_phage(25.0%)	19	NA	NA
WP_017411790.1|940424_941258_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_005320656.1|941254_941578_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_017411789.1|941747_942341_+	LysE family translocator	NA	NA	NA	NA	NA
WP_005320652.1|942319_943168_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_042468106.1|943171_943873_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.7	1.6e-15
WP_042468107.1|943889_944666_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.8	1.6e-11
WP_005320647.1|944662_945931_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_005320646.1|945927_946854_-	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_088814406.1|946917_948021_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005320642.1|948474_949479_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	33.1	9.5e-33
WP_005320640.1|949559_950879_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_088814136.1|951877_952795_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668974.1|953540_953921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|953943_954861_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011898961.1|955235_956450_-|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_096072027.1|956515_957778_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005321603.1|957977_958403_-	chaperonin	NA	NA	NA	NA	NA
WP_034283822.1|958599_959991_+	T3SS effector protein-tyrosine-phosphatase AopH	NA	NA	NA	NA	NA
WP_088814129.1|960824_961742_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	1253742	1286261	4783004	transposase	Bacillus_phage(40.0%)	22	NA	NA
WP_088814123.1|1253742_1254660_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814123.1|1256536_1257454_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005316589.1|1257593_1257992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005316586.1|1258040_1259054_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088814343.1|1259271_1260408_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_096071864.1|1260615_1261248_-	porin family protein	NA	NA	NA	NA	NA
WP_076611341.1|1261344_1262262_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005316576.1|1264114_1264453_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_005316573.1|1264951_1265953_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.4	5.2e-15
WP_005316571.1|1266127_1266556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005316549.1|1269768_1271184_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_005316548.1|1273583_1273796_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	1.1e-23
WP_088814346.1|1274348_1275896_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	1.0e-17
WP_005316537.1|1276178_1279007_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	5.2e-312
WP_017412640.1|1279102_1279735_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005316531.1|1280254_1280845_+	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	59.5	1.0e-55
WP_005316528.1|1281013_1281772_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005316524.1|1281847_1281970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|1282603_1283521_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_085941665.1|1284410_1284680_+	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_155268759.1|1284740_1284902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|1285343_1286261_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	1347176	1394202	4783004	protease,transposase	uncultured_Caudovirales_phage(28.57%)	37	NA	NA
WP_088814129.1|1347176_1348094_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814130.1|1348138_1348522_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|1348578_1349496_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314155.1|1349927_1350785_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_088814131.1|1350789_1351317_-|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_096071866.1|1351437_1351983_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A076YN96	Rhizobium_phage	30.4	3.0e-09
WP_005314150.1|1352260_1353025_+	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_005314149.1|1353104_1355765_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_042468130.1|1355850_1357722_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_005314147.1|1357882_1359310_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.7e-41
WP_042468131.1|1359439_1360396_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.9	5.0e-15
WP_005314145.1|1360392_1360575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096071867.1|1360710_1362357_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.3	1.1e-17
WP_017411941.1|1362520_1364431_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	1.0e-19
WP_005314141.1|1364689_1366948_+	patatin-like phospholipase domain-containing protein	NA	A0A1V0SFX9	Hokovirus	27.4	2.0e-06
WP_042468133.1|1367176_1369774_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_042468134.1|1370106_1371690_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_042468135.1|1371944_1372694_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_042468136.1|1372870_1373794_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042468137.1|1373865_1374777_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.0	2.4e-14
WP_088814132.1|1374854_1375472_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005314125.1|1375589_1376984_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_088814347.1|1377064_1378183_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_005314122.1|1379636_1380125_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_005314121.1|1380249_1380759_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_005314120.1|1380811_1381183_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011898298.1|1381352_1382015_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_005314116.1|1382609_1382942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005314114.1|1383072_1383588_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_005314112.1|1384049_1384268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314110.1|1384280_1384805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314108.1|1384824_1385319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005314106.1|1385385_1385832_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|1386296_1387214_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|1389356_1390274_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314088.1|1390554_1390986_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_076611341.1|1393284_1394202_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	1767298	1836238	4783004	transposase	Shigella_phage(20.0%)	56	NA	NA
WP_085941409.1|1767298_1768460_+|transposase	IS3-like element ISAs6 family transposase	transposase	Q716C2	Shigella_phage	51.6	2.8e-84
WP_005318620.1|1768666_1770814_+	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	32.1	1.8e-65
WP_042468997.1|1771029_1773183_+	AsmA family protein	NA	NA	NA	NA	NA
WP_005318627.1|1773357_1773897_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042468996.1|1773969_1774704_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.9	4.7e-05
WP_076611341.1|1775688_1776606_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|1777768_1778686_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005318643.1|1778959_1779316_+	glucitol operon activator	NA	NA	NA	NA	NA
WP_011899087.1|1779405_1780170_+	DNA-binding transcriptional repressor	NA	NA	NA	NA	NA
WP_088814148.1|1780404_1783287_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_005318651.1|1783529_1783976_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042468127.1|1784047_1785202_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_017411818.1|1785300_1785744_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_042468126.1|1785945_1786950_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_088814149.1|1786946_1787423_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_005318661.1|1787536_1787962_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005318662.1|1787996_1788224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005318663.1|1788370_1788688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005318665.1|1788855_1789332_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005318667.1|1789640_1790264_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_005318669.1|1790447_1791686_+	MFS transporter	NA	NA	NA	NA	NA
WP_017411815.1|1791826_1792648_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005318675.1|1792788_1793352_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_005318677.1|1793557_1794397_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011899085.1|1795886_1796654_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005318684.1|1797021_1798335_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_011899084.1|1800117_1800843_-	DUF3142 domain-containing protein	NA	NA	NA	NA	NA
WP_042468123.1|1800812_1802873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005318694.1|1802984_1803449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096071881.1|1803516_1804893_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005318697.1|1805009_1805606_+	LysE family translocator	NA	NA	NA	NA	NA
WP_042468121.1|1805721_1806312_+	LysE family translocator	NA	NA	NA	NA	NA
WP_042468120.1|1806466_1807165_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_005318702.1|1807287_1808394_+	acyltransferase	NA	NA	NA	NA	NA
WP_005318704.1|1808697_1809168_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_005318706.1|1809385_1810585_+	acetate kinase	NA	NA	NA	NA	NA
WP_005318708.1|1810718_1811969_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_042468119.1|1812146_1813073_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_005318714.1|1813361_1814882_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_076611341.1|1815881_1816799_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468750.1|1817172_1817442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139403094.1|1818008_1818824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005318756.1|1819622_1820477_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_085941653.1|1820470_1820914_-	DUF2390 domain-containing protein	NA	NA	NA	NA	NA
WP_005318760.1|1820924_1822835_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	3.6e-73
WP_005318762.1|1822989_1823400_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005318764.1|1823478_1823934_-	NfeD family protein	NA	NA	NA	NA	NA
WP_005318765.1|1823930_1824854_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_096071882.1|1825117_1826494_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_005318769.1|1826625_1827579_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_005318771.1|1827590_1829006_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	28.5	4.6e-33
WP_005318772.1|1829010_1830735_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_005318774.1|1830906_1831497_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_088814343.1|1831884_1833021_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088814152.1|1833376_1834915_-	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_088814153.1|1835320_1836238_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	1885464	1895388	4783004	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_005318886.1|1885464_1886211_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	9.7e-67
WP_005318888.1|1886215_1886833_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	9.0e-34
WP_085941649.1|1886835_1887399_+	DedA family protein	NA	NA	NA	NA	NA
WP_005318892.1|1887408_1888455_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	41.3	7.9e-14
WP_042467924.1|1888502_1889486_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	7.6e-35
WP_005318896.1|1889571_1890585_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	1.5e-107
WP_005309452.1|1890764_1890980_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005318899.1|1890995_1891439_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	1.3e-26
WP_005318901.1|1891527_1893315_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	3.4e-73
WP_080697382.1|1893528_1895388_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 11
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	2157150	2195252	4783004	integrase,transposase	Phage_21(25.0%)	29	2168719:2168734	2200951:2200966
WP_076611341.1|2157150_2158068_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005312712.1|2159740_2161102_-	MFS transporter	NA	NA	NA	NA	NA
WP_005312708.1|2161292_2162186_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_021138023.1|2163149_2165126_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011898946.1|2165129_2166155_-	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_096071895.1|2166763_2168689_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_088814167.1|2168685_2169885_+	cytochrome c	NA	NA	NA	NA	NA
2168719:2168734	attL	CTGCTGGCAGCCATGG	NA	NA	NA	NA
WP_076611341.1|2170145_2171063_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005312718.1|2171809_2172913_-	YdcF family protein	NA	NA	NA	NA	NA
WP_034283370.1|2173193_2174414_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_005312724.1|2174765_2175803_-	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_005312727.1|2176119_2177691_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_076611341.1|2178351_2179269_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|2180170_2181307_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005312736.1|2182088_2182379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468934.1|2182646_2184554_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_005312738.1|2185262_2185418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412946.1|2185646_2186846_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_088822015.1|2186963_2187854_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005312750.1|2188055_2189309_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	70.4	2.1e-13
WP_005312753.1|2189384_2189561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|2189856_2190774_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005312795.1|2190897_2191164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312798.1|2191308_2191728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312801.1|2191724_2192336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026141826.1|2192346_2192697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005312807.1|2192706_2192925_-	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	50.0	1.6e-09
WP_042468226.1|2193036_2193888_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	24.9	2.0e-07
WP_088814169.1|2194001_2195252_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	46.3	2.8e-111
2200951:2200966	attR	CCATGGCTGCCAGCAG	NA	NA	NA	NA
>prophage 12
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	2249449	2396623	4783004	tRNA,transposase	Acinetobacter_phage(10.53%)	116	NA	NA
WP_076611341.1|2249449_2250367_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468543.1|2250476_2252123_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_042468541.1|2252119_2255695_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_005313020.1|2255875_2256091_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_005313022.1|2256376_2256967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468540.1|2256978_2258325_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017411715.1|2258460_2260284_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.4	9.2e-18
WP_005313033.1|2260354_2260948_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_005313036.1|2260937_2261195_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_017411716.1|2261329_2262244_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	39.5	2.3e-49
WP_096071898.1|2262729_2263914_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_005313047.1|2263931_2264450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005313049.1|2264430_2265033_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005313052.1|2265053_2266487_-	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005313055.1|2266700_2266994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468535.1|2267063_2267510_-	peptidase P60	NA	NA	NA	NA	NA
WP_042468534.1|2268394_2270260_+	hemolysin Ahh1	NA	NA	NA	NA	NA
WP_005313062.1|2270329_2271238_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_011899080.1|2271353_2272385_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005319290.1|2272518_2274687_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_005319287.1|2274719_2275835_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_088814283.1|2275843_2276575_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_005319281.1|2276577_2277495_+	OmpA family protein	NA	NA	NA	NA	NA
WP_042468425.1|2277499_2278294_+	ParA family protein	NA	Q8JL10	Natrialba_phage	34.0	3.7e-16
WP_011898512.1|2278290_2279163_+	chemotaxis protein W	NA	NA	NA	NA	NA
WP_042468424.1|2279232_2279721_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_043134707.1|2279739_2280126_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_155268749.1|2280120_2280276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005319269.1|2280290_2280926_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	29.4	8.7e-16
WP_005319265.1|2280930_2281599_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_005319261.1|2281762_2282503_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_005319258.1|2282505_2282712_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_157738364.1|2282739_2283201_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_005319252.1|2283283_2285239_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_005319248.1|2285235_2285766_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_005319244.1|2285777_2286257_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_005319239.1|2286253_2287522_+	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_088814393.1|2287623_2288412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005319233.1|2288528_2289113_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	42.6	1.6e-40
WP_005319230.1|2289399_2289744_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_005319227.1|2289809_2291021_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_096071899.1|2291183_2293208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005319219.1|2293204_2293528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468418.1|2293689_2294328_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017412878.1|2294375_2294990_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_076611341.1|2296873_2297791_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|2298637_2299555_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468764.1|2299717_2300848_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_096071900.1|2301024_2302395_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.1	2.4e-111
WP_042468762.1|2302570_2303182_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_005319178.1|2303379_2304486_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_011898520.1|2304804_2305266_-	NUDIX hydrolase	NA	A0A023W5N2	Serratia_phage	62.2	8.5e-05
WP_088814280.1|2305280_2306255_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_042468761.1|2306325_2307093_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_005319168.1|2307093_2307399_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_042468759.1|2309486_2311394_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_096072033.1|2312636_2313152_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_073531805.1|2313290_2313800_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_076611341.1|2314557_2315475_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|2316432_2317350_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814278.1|2317523_2318686_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	51.0	3.0e-83
WP_017412279.1|2318901_2319708_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_042467948.1|2319704_2320898_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011898522.1|2320983_2322369_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	NA	NA	NA	NA
WP_005319138.1|2322479_2323493_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	37.8	1.9e-49
WP_005319135.1|2323503_2324103_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	36.3	3.0e-26
WP_011898523.1|2324095_2325733_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_005319129.1|2326169_2327051_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_005319127.1|2327187_2327808_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_085941581.1|2327713_2328685_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_005319123.1|2328783_2329353_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.3	6.8e-20
WP_042467947.1|2329495_2330419_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_005319118.1|2330622_2331486_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_005319114.1|2331549_2332728_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_080697387.1|2332845_2333532_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017412282.1|2333734_2334376_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096071901.1|2334519_2335689_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042467946.1|2338848_2340255_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005319091.1|2341004_2342105_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	51.7	7.8e-97
WP_005319088.1|2342104_2342992_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.0	4.0e-27
WP_005319086.1|2343104_2343983_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	4.8e-105
WP_080697385.1|2344597_2345383_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011898526.1|2345396_2347055_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_005319078.1|2347051_2348239_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005319076.1|2348222_2348654_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_157668963.1|2348674_2349049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080697384.1|2349032_2349431_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011898528.1|2349420_2350128_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_129712397.1|2350154_2350991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005319069.1|2352101_2352731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157738332.1|2353211_2355251_+	secretin	NA	NA	NA	NA	NA
WP_096071902.1|2355702_2357211_+	S-layer protein	NA	NA	NA	NA	NA
WP_011898533.1|2357413_2358730_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.6e-14
WP_005319053.1|2361621_2362941_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	35.5	6.7e-10
WP_005319049.1|2364062_2365130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096071903.1|2365629_2366493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005319045.1|2366476_2367523_+	acyltransferase	NA	NA	NA	NA	NA
WP_088814343.1|2367589_2368726_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_080697441.1|2369391_2371122_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_073531788.1|2371237_2371441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814343.1|2371564_2372701_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011898536.1|2372980_2373775_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_005319037.1|2373774_2374731_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_005319035.1|2374730_2375756_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_096071904.1|2375752_2377738_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	27.1	1.8e-19
WP_139403327.1|2377761_2378124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2378526_2379444_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|2380444_2381581_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_005319007.1|2384749_2385403_+	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_011898541.1|2385628_2389471_+	DEAD/DEAH box helicase	NA	G8DDA1	Micromonas_pusilla_virus	30.3	6.4e-45
WP_017412739.1|2389644_2390538_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_017412738.1|2391059_2391269_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_005320264.1|2391548_2392574_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_005320262.1|2392848_2393943_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_005320258.1|2394045_2395032_+	alpha-ketoacid dehydrogenase subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	28.8	1.8e-07
WP_076611341.1|2395705_2396623_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	2501522	2557574	4783004	protease,tRNA,transposase,integrase	Moumouvirus(12.5%)	46	2552222:2552281	2566785:2567857
WP_042467323.1|2501522_2502899_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.5	8.7e-45
WP_011899080.1|2503136_2504168_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088814123.1|2504866_2505784_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314572.1|2506668_2506977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042467985.1|2507673_2508687_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.8	3.8e-13
WP_034282846.1|2508905_2509652_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017412979.1|2509767_2510514_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005314576.1|2510587_2511091_-	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_005314577.1|2511087_2512095_-	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_005314578.1|2512131_2513070_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_005314579.1|2513322_2513880_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_085941442.1|2514124_2514499_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_005314583.1|2514573_2514801_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_096071910.1|2514797_2517068_+	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_017412111.1|2517064_2517307_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088814387.1|2517402_2517894_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_088814267.1|2518027_2519299_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_042467989.1|2519572_2520712_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_005314602.1|2520771_2521128_-	DMT family protein	NA	NA	NA	NA	NA
WP_005314604.1|2521239_2521971_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005314605.1|2522074_2523082_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_034282866.1|2523180_2523951_+	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	30.3	6.0e-11
WP_017412107.1|2524067_2525129_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4VUY9	Pandoravirus	50.0	9.2e-87
WP_005314618.1|2525283_2525664_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_005314621.1|2525848_2527081_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	6.9e-110
WP_005314623.1|2527309_2527963_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_005314624.1|2528218_2528827_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005314627.1|2528981_2530316_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_017412106.1|2530726_2531695_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005314633.1|2531942_2532755_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_005314635.1|2533432_2534584_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.9	1.4e-48
WP_017412104.1|2534600_2537825_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_005314639.1|2538357_2540016_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_096071911.1|2540232_2541399_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_005314653.1|2543194_2544049_-	DNA-binding protein	NA	A0A2R2ZH57	Clostridioides_phage	28.8	3.2e-21
WP_017413053.1|2544425_2545388_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_042467992.1|2545710_2546376_+	DedA family protein	NA	NA	NA	NA	NA
WP_017413054.1|2546490_2547024_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_088814386.1|2547367_2548594_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.2	9.1e-46
WP_005314666.1|2548731_2549376_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_087757302.1|2550836_2551268_+|protease	protease	protease	NA	NA	NA	NA
2552222:2552281	attL	GGGCGTTGTTTCCTAAATCGATGCAGCTTGAATGGAACTAATTGAAAACCCAGTGATCTG	NA	NA	NA	NA
WP_076611341.1|2552310_2553228_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668962.1|2553250_2553649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139403285.1|2553781_2555545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139742367.1|2555564_2556317_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088814343.1|2556437_2557574_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
2566785:2567857	attR	CAGATCACTGGGTTTTCAATTAGTTCCATTCAAGCTGCATCGATTTAGGAAACAACGCCCTTGTGTTCTCTACTGCCACAGGCTAATCGCAGCTTGAACAGCCGGTGATGGAGATTCATCCCTCGGGCCTGTTATTTTTGGCCTTCCCCGTTTGCGTTTTATCACTGTCTACGTAGCTTCTTTGGCAATATTGGCAAGTTCTGGTCTATCTAATTGTGCCTCCATCCCTTCACCACTAACATCCAACAGCGCCTTGTAATACGGCTCTTCCTCCAGTCGATTAGGCTTTACCTTGTCGGGATGTGGCCCACGGCGTCGGTTGGCTGTCGGGGTGTTCGGCAAACTACGTGAACGCACATCATCCCGCATCGTCTGTACTTCCTGAGCCATCTGCAAAATGTGGCCAAGCCGCTTGTTGTCGACAATCGCCCCCTGATTGACCGGTGCAAGCTGGTCATTAATGCAGTAATCCAGCAGGTTGCCATCATGGCCACGTAACTCAACCCGATCATCGCAATAGTGATAAACCACGATTTCTCGTCCAATCAGTCGCGTTGGATGAGAGCCCACACTCACAACAACCATTATATTCGTGTGCAATAATACCTACTGTTTGTAAAAGGTGAGAATTATAGCTAGATGATTCTCACCTTTTTTCATGAAATTTATCAATAAGTCGAGAATCCCCTGTAAGCCTTGCGCCACATGGATTTTCATTTCTTTCTCAATAATATTAGTGCATTAGTGATGGCCCACGCCTGGCACAACTGGCTCATTCGCGATCTGCCCATGAGTCAACGCAGCTACCCCATGACGCTGGCGGAGACCGCCTCCATCTTTGCCGAAACCCTGGTGCGCAGCGCCCTGTTCGAGCAGGCGCAGACGCCGGAGCAGCAGCAGGCCATCGCCTGGGCCGAAGCCGACGGTGCCGCCACCTTCCTGGTCAACATTCCGGCCCGATTCGACTTCGAGCAGGCGCTGGTGGCGGAGCGGGCGCAGGGCTATGTGTCGGCACAGCGGCTAAAGACGATGACGGATGAAGCCTGGGGTCGCTGGTATGAGGGGAGTCTGGT	NA	NA	NA	NA
>prophage 14
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	2565837	2639400	4783004	tRNA,transposase	Bacillus_virus(20.0%)	53	NA	NA
WP_076611341.1|2565837_2566755_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_052521856.1|2566952_2567315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814108.1|2568821_2569739_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310451.1|2570244_2571537_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005310453.1|2571744_2572062_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005310455.1|2572230_2572989_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005310456.1|2573180_2574194_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_017411374.1|2574264_2576538_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_058406197.1|2576790_2577879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468726.1|2577970_2579323_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_017411372.1|2579745_2581074_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_017411371.1|2581344_2581977_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_085941476.1|2582333_2582690_-	DUF3802 family protein	NA	NA	NA	NA	NA
WP_005310474.1|2583208_2583565_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_042468725.1|2583671_2584463_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_080697423.1|2584726_2585227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2586159_2587077_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814112.1|2587350_2588268_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468582.1|2589683_2590172_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.8	7.4e-15
WP_011898849.1|2590691_2591645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085941475.1|2591844_2592954_-	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_042468584.1|2592908_2595350_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_042468585.1|2595377_2596058_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	8.7e-30
WP_005310491.1|2596255_2596723_+	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_017412350.1|2598362_2599565_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.8e-22
WP_005310495.1|2599690_2601337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468587.1|2601433_2602747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005310500.1|2602767_2603328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005310502.1|2603363_2604788_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042468588.1|2604890_2605730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814385.1|2605729_2608621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005310508.1|2608724_2609174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2609737_2610655_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668961.1|2610699_2610852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469165.1|2611083_2611551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469111.1|2613096_2614473_-	amino acid permease	NA	NA	NA	NA	NA
WP_096071912.1|2614501_2614756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005310536.1|2614838_2615126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096071913.1|2615927_2616845_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_096072034.1|2617459_2619832_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.9	1.1e-175
WP_017412773.1|2620186_2621164_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088814263.1|2621266_2623648_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_005310548.1|2624103_2624565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011898844.1|2624583_2626461_-	S8 family serine peptidase	NA	A0A1V0S9L2	Catovirus	20.8	5.2e-16
WP_005310553.1|2626893_2627433_-	hydrolase	NA	NA	NA	NA	NA
WP_096071914.1|2627452_2627821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814343.1|2628165_2629302_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_088814108.1|2629751_2630669_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468699.1|2631682_2632513_+	membrane protein	NA	NA	NA	NA	NA
WP_042468696.1|2632597_2633320_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005310564.1|2634990_2636007_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011898842.1|2636285_2638424_+	pilus assembly protein TapV	NA	NA	NA	NA	NA
WP_042468693.1|2638590_2639400_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	2649427	2730544	4783004	protease,transposase,plate	uncultured_Caudovirales_phage(16.67%)	58	NA	NA
WP_088814108.1|2649427_2650345_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011898835.1|2650954_2651614_+	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
WP_005310586.1|2651631_2652264_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_088814260.1|2652522_2653635_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_096071915.1|2654792_2655791_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_096071916.1|2655831_2656503_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_005310593.1|2656586_2657210_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005310595.1|2657271_2657772_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_076611341.1|2658004_2658922_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310605.1|2660034_2661531_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_005310607.1|2661653_2663318_-	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	40.8	1.3e-90
WP_005310609.1|2663511_2663880_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_005310611.1|2663969_2665589_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_017412358.1|2665609_2666359_-	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
WP_005310617.1|2667697_2668819_-	alkene reductase	NA	NA	NA	NA	NA
WP_042468148.1|2668995_2670531_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	41.7	2.0e-37
WP_088814257.1|2671785_2674977_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_005310623.1|2674976_2675465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468145.1|2675569_2676031_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_017412353.1|2676212_2678090_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.4	2.6e-60
WP_011898829.1|2678424_2678907_+	molybdopterin-binding oxidoreductase	NA	NA	NA	NA	NA
WP_042468144.1|2678908_2680834_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	26.6	1.9e-05
WP_042468143.1|2680953_2682276_-	Na+/H+ antiporter family protein	NA	NA	NA	NA	NA
WP_085941471.1|2682527_2683262_-	ribonuclease T	NA	NA	NA	NA	NA
WP_042468142.1|2683347_2685321_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	1.9e-32
WP_085941625.1|2685401_2686265_+	OmpA family protein	NA	NA	NA	NA	NA
WP_005310643.1|2686337_2686751_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_005310645.1|2686853_2687495_-	endonuclease III	NA	NA	NA	NA	NA
WP_017412575.1|2687513_2688272_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_005310649.1|2688345_2688978_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_005310650.1|2689101_2690154_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_017412577.1|2692452_2693016_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_005310657.1|2693020_2693602_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_017412578.1|2693714_2694611_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005310661.1|2694706_2694904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|2696385_2697303_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310683.1|2700557_2702294_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.7	3.4e-30
WP_076611341.1|2703650_2704568_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310689.1|2704741_2705173_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_042468902.1|2705176_2706943_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_042468909.1|2706906_2707905_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_042468903.1|2707945_2709112_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_005310697.1|2709111_2709627_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_042468905.1|2709629_2710964_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_085941624.1|2711056_2711767_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_088814108.1|2714321_2715239_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_155268744.1|2715361_2715502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096071917.1|2715504_2717043_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005310708.1|2717042_2717648_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_005310710.1|2722571_2724008_+	membrane protein	NA	NA	NA	NA	NA
WP_005310712.1|2724081_2724267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005310714.1|2724299_2724587_+	type VI secretion system PAAR protein	NA	G4KK81	Yersinia_phage	39.4	4.6e-09
WP_085941623.1|2724898_2725633_+|transposase	IS1-like element ISAs8 family transposase	transposase	A0A0U2RK18	Escherichia_phage	65.2	5.8e-80
WP_005310720.1|2725684_2725936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096071918.1|2726492_2727356_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	30.9	6.7e-27
WP_005300025.1|2727466_2727685_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_005310725.1|2727914_2728232_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.1	5.3e-14
WP_005310727.1|2728291_2730544_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.1	1.2e-168
>prophage 16
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	2741967	2810402	4783004	tRNA,bacteriocin,transposase	Planktothrix_phage(30.0%)	60	NA	NA
WP_005310745.1|2741967_2743263_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.0	7.5e-91
WP_005310746.1|2743450_2743939_+|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
WP_005310748.1|2743960_2745481_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	1.2e-87
WP_042467876.1|2745704_2746463_+|tRNA	tRNA hydroxylase	tRNA	NA	NA	NA	NA
WP_005310752.1|2746619_2747405_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.4e-17
WP_042467877.1|2747439_2748438_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.3	1.5e-09
WP_005310755.1|2748437_2749331_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042467879.1|2749314_2750274_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_096072035.1|2750276_2751842_-	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_005310760.1|2752054_2753089_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_042467881.1|2753284_2753965_+	phage shock protein PspA	NA	NA	NA	NA	NA
WP_005310764.1|2753968_2754205_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_085941469.1|2754186_2754606_+	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_096071921.1|2754737_2756144_+	YcjX family protein	NA	NA	NA	NA	NA
WP_096071922.1|2756212_2757256_+	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_005310772.1|2757425_2758220_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_005310774.1|2758273_2758627_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_005310776.1|2758761_2760309_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_005310778.1|2760506_2761058_+	YfiR family protein	NA	NA	NA	NA	NA
WP_005310780.1|2761054_2762251_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_017411676.1|2762325_2762814_+	OmpA family protein	NA	NA	NA	NA	NA
WP_005310785.1|2762873_2763605_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	52.5	1.1e-46
WP_005310787.1|2763715_2764831_+	ATP-NAD kinase family protein	NA	NA	NA	NA	NA
WP_005310789.1|2764955_2765234_+	YfcL family protein	NA	NA	NA	NA	NA
WP_005310791.1|2765331_2766996_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	28.4	9.5e-46
WP_005310793.1|2767074_2767956_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_005310796.1|2768144_2768831_-	membrane protein	NA	NA	NA	NA	NA
WP_005310798.1|2768827_2769184_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_076611341.1|2769480_2770398_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_017411675.1|2770455_2772165_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_005310800.1|2772248_2772755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005310802.1|2772907_2774335_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_096071923.1|2774490_2775393_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_005310806.1|2775680_2776451_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042468205.1|2776496_2777330_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_042468204.1|2777338_2778490_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_005310814.1|2778603_2779494_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005310816.1|2779605_2781105_-	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_005310818.1|2781125_2781824_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_042468203.1|2781820_2783512_-	ribulokinase	NA	NA	NA	NA	NA
WP_096071924.1|2783873_2784866_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017412388.1|2786492_2787494_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_005310828.1|2787646_2788558_+	arabinose operon transcriptional regulator AraC	NA	NA	NA	NA	NA
WP_011898809.1|2788835_2789993_-	galactokinase	NA	NA	NA	NA	NA
WP_076611341.1|2790328_2791246_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_080697401.1|2792140_2793163_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.3	1.6e-80
WP_005310836.1|2793472_2794474_+	HTH-type transcriptional regulator GalR	NA	C6ZCU4	Enterobacteria_phage	28.5	1.8e-23
WP_088814255.1|2794958_2796251_+	maltoporin	NA	NA	NA	NA	NA
WP_005310842.1|2796319_2797465_+	arabinogalactan endo-1,4-beta-galactosidase	NA	NA	NA	NA	NA
WP_088814254.1|2797527_2798532_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_005310846.1|2798693_2799116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096071925.1|2799172_2800690_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.1	5.5e-24
WP_157738334.1|2800649_2801102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005310852.1|2801184_2801493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412380.1|2801595_2802678_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.3	3.0e-24
WP_076611341.1|2803730_2804648_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|2805267_2806185_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005310858.1|2806765_2807617_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_042469099.1|2807635_2808835_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_076611341.1|2809484_2810402_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	2979256	3020202	4783004	tRNA,transposase	Synechococcus_phage(66.67%)	32	NA	NA
WP_088814237.1|2979256_2980174_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005311129.1|2981716_2981956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005311133.1|2983672_2984428_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_034281583.1|2984564_2985335_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_076611341.1|2985481_2986399_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005311137.1|2986534_2987311_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_005311139.1|2987404_2988739_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_005311141.1|2988719_2989457_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_005311144.1|2989484_2993912_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_085941615.1|2994164_2994542_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.5	1.1e-15
WP_076611341.1|2994713_2995631_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005311149.1|2995825_2996338_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_076611341.1|2996687_2997605_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011898763.1|2997730_2998042_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_017413050.1|2998468_2998972_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.2	1.1e-13
WP_017413049.1|2999025_2999865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017413048.1|2999943_3000147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005311168.1|3000423_3001329_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_042468618.1|3001390_3002698_-	permease	NA	NA	NA	NA	NA
WP_005311174.1|3004022_3004130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005301193.1|3004577_3004718_+	TIGR02808 family protein	NA	NA	NA	NA	NA
WP_085941462.1|3004896_3005565_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_021139313.1|3005577_3006462_+	AEC family transporter	NA	NA	NA	NA	NA
WP_042468619.1|3006503_3007733_-	MFS transporter	NA	NA	NA	NA	NA
WP_005311187.1|3007806_3008574_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.5	4.6e-11
WP_005311189.1|3008566_3009619_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_042468620.1|3009737_3010844_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005311193.1|3010905_3011085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005311197.1|3015086_3015629_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_042468622.1|3016120_3016309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088814222.1|3017898_3018816_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011899080.1|3019170_3020202_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	3346472	3501400	4783004	protease,transposase	Tupanvirus(18.18%)	106	NA	NA
WP_011899080.1|3346472_3347504_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005315438.1|3350098_3350887_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_017412302.1|3350978_3352415_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_042468868.1|3352803_3353565_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.2	7.5e-06
WP_042468866.1|3353634_3354555_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_096071975.1|3354632_3355745_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_017412304.1|3355737_3356535_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_088814229.1|3356683_3357883_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042468863.1|3357938_3359450_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_076611341.1|3360020_3360938_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315410.1|3361918_3363538_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	53.4	1.5e-19
WP_042467890.1|3363548_3364388_+	crotonase	NA	NA	NA	NA	NA
WP_088814227.1|3364491_3366477_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_005315404.1|3366491_3367430_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	35.7	4.2e-43
WP_005315403.1|3367444_3367855_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_058406839.1|3367892_3368654_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_042467892.1|3368702_3371594_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_005315399.1|3372272_3372869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005315396.1|3373783_3374221_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088814225.1|3376101_3376908_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_088814224.1|3377090_3378878_+	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005315390.1|3378880_3379507_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_005315383.1|3379615_3379927_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_042467894.1|3379923_3381579_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_096071976.1|3381815_3383408_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.4	1.5e-56
WP_088814373.1|3383685_3385596_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005315375.1|3385750_3386023_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	5.0e-21
WP_021140372.1|3386263_3388618_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.0	3.6e-224
WP_017411865.1|3388759_3390034_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.5	9.6e-131
WP_085941601.1|3390162_3390765_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.5	5.4e-60
WP_005315366.1|3390872_3392183_-	trigger factor	NA	NA	NA	NA	NA
WP_011898663.1|3392611_3393046_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_005315363.1|3393142_3393733_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_005315361.1|3393820_3395062_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_087755599.1|3395061_3395823_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	42.1	2.0e-35
WP_088814223.1|3395815_3397051_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005315356.1|3397127_3397703_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_005315354.1|3397712_3401177_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_005315352.1|3401266_3402301_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	46.5	4.2e-76
WP_042467895.1|3402684_3404301_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096071977.1|3404348_3405269_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005315346.1|3405469_3405676_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_017411860.1|3405809_3406277_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_005315340.1|3410388_3411762_-	protein kinase	NA	NA	NA	NA	NA
WP_157669188.1|3412066_3413647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085044777.1|3413705_3414644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088814222.1|3414744_3415662_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814123.1|3417286_3418204_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3419130_3420048_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814221.1|3420092_3420332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315336.1|3420725_3422306_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_017412971.1|3422389_3423853_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.6	5.3e-93
WP_088814108.1|3424397_3425315_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315328.1|3425808_3426558_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_017412973.1|3426560_3427313_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_042469137.1|3427312_3427735_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_088814343.1|3428032_3429169_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3429615_3430533_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315309.1|3431232_3432603_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	36.7	5.3e-34
WP_005315308.1|3432667_3434035_-	heme anaerobic degradation radical SAM methyltransferase ChuW/HutW	NA	NA	NA	NA	NA
WP_088814220.1|3434282_3435893_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.8	1.6e-26
WP_005315306.1|3435986_3437042_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.9	5.2e-82
WP_005315305.1|3437270_3438554_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_042468068.1|3438724_3439813_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.9	5.0e-88
WP_042468069.1|3440037_3440967_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_085941450.1|3441061_3441823_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_005315298.1|3441940_3443590_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_100766231.1|3443602_3443695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005315297.1|3444045_3444993_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_017412312.1|3445144_3445606_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_042468070.1|3445621_3446374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468071.1|3446630_3447869_+	siderophore amonabactin export MFS transporter	NA	NA	NA	NA	NA
WP_042468072.1|3447926_3449900_+	siderophore amonabactin TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	34.9	2.4e-16
WP_005315288.1|3449970_3450987_+	amonabactin ABC transporter permease subunit 2	NA	NA	NA	NA	NA
WP_011898657.1|3451001_3452069_+	amonabactin ABC transporter permease subunit 1	NA	NA	NA	NA	NA
WP_017412316.1|3452068_3452884_+	amonabactin ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.3	2.3e-13
WP_005315278.1|3452944_3453670_-	amonabactin biosynthesis phosphopantetheinyl transferase AmoD	NA	NA	NA	NA	NA
WP_005315275.1|3453828_3454773_+	amonabactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005315273.1|3454855_3456466_-	amonabactin biosynthesis glycine adenylation protein AmoH	NA	A0A2K9L3I8	Tupanvirus	27.9	1.3e-39
WP_042468073.1|3456462_3462699_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.4	2.0e-72
WP_005315268.1|3462707_3463457_-	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_042468074.1|3463486_3466576_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	25.2	9.1e-42
WP_005315266.1|3466572_3467481_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_042468075.1|3467505_3469176_-	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_034282536.1|3469172_3470366_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_005315260.1|3470690_3471242_+	lipoprotein	NA	NA	NA	NA	NA
WP_005315258.1|3471388_3473389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096071978.1|3473559_3474477_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3477043_3477961_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315253.1|3478709_3479204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315249.1|3479384_3479747_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_100224073.1|3479860_3481654_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.0	2.5e-23
WP_042468808.1|3481650_3482955_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_021139169.1|3483141_3483534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080697425.1|3483605_3484634_-	ferrochelatase	NA	NA	NA	NA	NA
WP_017412939.1|3484685_3485330_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005315220.1|3485376_3485571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315218.1|3485587_3487501_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.5	4.5e-116
WP_005315214.1|3487718_3488321_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_005315205.1|3488516_3489341_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_042468803.1|3489353_3491468_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_076611341.1|3491960_3492878_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_080697431.1|3493050_3495195_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005315180.1|3496525_3496837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139403270.1|3496970_3499808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|3500482_3501400_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	3511954	3565117	4783004	tRNA,transposase	Tupanvirus(10.0%)	51	NA	NA
WP_005315148.1|3511954_3513424_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_096071979.1|3513428_3515348_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.7e-14
WP_096071980.1|3515344_3517771_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_005315143.1|3517776_3518028_+	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_011898647.1|3519226_3520231_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_005315136.1|3520240_3520582_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_042468242.1|3520583_3521639_+	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_005315125.1|3521855_3522497_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_042468243.1|3522496_3523285_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	32.6	1.5e-09
WP_005315119.1|3523278_3524094_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011898645.1|3524083_3525094_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_088814218.1|3525078_3526686_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005315112.1|3526801_3527329_-	hydrogenase-2 assembly chaperone	NA	NA	NA	NA	NA
WP_042468245.1|3527310_3527811_-	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
WP_042468246.1|3527810_3529514_-	hydrogenase 2 large subunit	NA	NA	NA	NA	NA
WP_096071981.1|3529510_3530698_-	Ni/Fe-hydrogenase cytochrome b subunit	NA	NA	NA	NA	NA
WP_042468247.1|3530690_3531731_-	hydrogenase 2 operon protein HybA	NA	A0A077SL61	Escherichia_phage	29.4	7.3e-20
WP_157738370.1|3532840_3533911_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_157668958.1|3533806_3534028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|3535111_3536029_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814217.1|3536053_3537001_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315097.1|3537306_3538410_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.1	7.5e-31
WP_088814216.1|3538548_3538761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011898640.1|3539176_3539638_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_005315095.1|3539790_3541128_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_005315094.1|3541187_3541769_-	thymidine kinase	NA	A0A0F6TIQ8	Escherichia_coli_O157_typing_phage	52.7	1.6e-48
WP_005315093.1|3541874_3543455_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_088814214.1|3543977_3545009_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3545186_3546104_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005315078.1|3546264_3546672_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_042468675.1|3546738_3547302_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_005315061.1|3547298_3547529_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_085941448.1|3547530_3548244_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	39.4	1.4e-17
WP_034282960.1|3548263_3548971_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.1	2.9e-84
WP_085941447.1|3548994_3549684_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005315050.1|3549634_3550192_+	rhombosortase	NA	NA	NA	NA	NA
WP_005315048.1|3550265_3550967_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_005315046.1|3551077_3552244_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_005315045.1|3552253_3552538_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_042468678.1|3552694_3552979_-	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.4e-12
WP_005315043.1|3553071_3554742_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_005315040.1|3554836_3555529_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_096071982.1|3555777_3556371_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.0	3.0e-42
WP_005315034.1|3556516_3557491_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_042468679.1|3557564_3558440_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005315028.1|3558533_3559742_+	MFS transporter	NA	NA	NA	NA	NA
WP_085941598.1|3559786_3560332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315024.1|3560334_3561099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005315023.1|3561288_3562014_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_042468681.1|3562104_3564042_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.1	6.3e-17
WP_088814214.1|3564085_3565117_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	3596881	3673396	4783004	transposase	uncultured_Caudovirales_phage(18.18%)	56	NA	NA
WP_076611341.1|3596881_3597799_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|3599567_3600704_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|3601037_3601955_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011898624.1|3602771_3604391_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.1	2.5e-14
WP_005314878.1|3604766_3605672_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.0e-34
WP_042468194.1|3605785_3607588_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_085941445.1|3607746_3608259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005314875.1|3608330_3609188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468193.1|3609191_3610025_-	phosphotransferase	NA	NA	NA	NA	NA
WP_005314873.1|3610014_3610611_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_005314863.1|3610610_3611009_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_088814369.1|3611083_3612436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005314859.1|3612513_3612864_-	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_088814211.1|3612961_3615127_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.1	7.3e-30
WP_085941594.1|3615198_3616008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005314854.1|3616153_3617497_+	dihydroorotase	NA	NA	NA	NA	NA
WP_042468190.1|3617916_3618483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011898617.1|3618689_3619949_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005314849.1|3620030_3620471_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_005314845.1|3620662_3621889_+	alanine racemase	NA	NA	NA	NA	NA
WP_034282953.1|3621967_3622912_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	36.3	9.2e-38
WP_042468189.1|3623214_3624210_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.2e-19
WP_005314835.1|3624210_3624324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005314832.1|3624320_3625307_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-15
WP_005314829.1|3625339_3626251_-	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_021139963.1|3626265_3627186_-	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_042468196.1|3627284_3628904_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005314822.1|3629186_3629822_-	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_085941443.1|3629994_3630723_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_005314815.1|3631018_3633694_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_076611341.1|3634613_3635531_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005314809.1|3636464_3638141_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	55.9	8.4e-159
WP_005314806.1|3638216_3638921_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_042468645.1|3639063_3640485_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_005314799.1|3640773_3641112_+	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_005314797.1|3641115_3642153_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_042468644.1|3642254_3644015_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	40.9	1.9e-92
WP_042468643.1|3644120_3645566_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_005314790.1|3645763_3646027_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	62.8	6.1e-24
WP_005314787.1|3646088_3646301_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_005314784.1|3646693_3647908_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_042468642.1|3647972_3649448_-	YfcC family protein	NA	NA	NA	NA	NA
WP_042468640.1|3649611_3650805_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_005314771.1|3651158_3651338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042468638.1|3653747_3654755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814210.1|3654864_3656026_+|transposase	IS3-like element ISAs33 family transposase	transposase	Q716C2	Shigella_phage	50.8	2.8e-84
WP_096071984.1|3656137_3656839_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_042468729.1|3656880_3657438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042468733.1|3657524_3660998_-	type I secretion C-terminal target domain-containing protein	NA	NA	NA	NA	NA
WP_005314739.1|3662716_3664642_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005314730.1|3664645_3665407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005314727.1|3665528_3666854_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017412894.1|3666889_3668308_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005314720.1|3668300_3670445_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.9	6.3e-26
WP_005314700.1|3670862_3671798_-	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_096071985.1|3672478_3673396_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	3932039	3965141	4783004	protease,tRNA,transposase	Tupanvirus(50.0%)	23	NA	NA
WP_005309688.1|3932039_3933701_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	79.5	7.8e-266
WP_042467528.1|3934048_3936712_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_076611341.1|3936885_3937803_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814201.1|3939649_3940450_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_005309677.1|3940459_3941605_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_085941483.1|3941546_3942824_+	ROK family protein	NA	NA	NA	NA	NA
WP_088814200.1|3943571_3944721_+|transposase	IS3-like element ISAs32 family transposase	transposase	U5P429	Shigella_phage	63.1	9.0e-96
WP_088814108.1|3945406_3946324_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_157668955.1|3947283_3947409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157738346.1|3947356_3948478_-	hypothetical protein	NA	A0A2K9L3I8	Tupanvirus	22.9	1.8e-11
WP_096071997.1|3948521_3950033_-	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	28.6	1.3e-38
WP_157668954.1|3950062_3950197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080697436.1|3950172_3950991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088814197.1|3950987_3951566_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_076611341.1|3951590_3952508_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468948.1|3952654_3955087_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_042468945.1|3955317_3956943_-	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_005313105.1|3957347_3958088_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042468944.1|3958180_3959947_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_088814108.1|3960704_3961622_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005313097.1|3962575_3963319_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_005313094.1|3963322_3964300_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_085941630.1|3964424_3965141_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
>prophage 22
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	3968561	4033557	4783004	transposase	Bacillus_thuringiensis_phage(20.0%)	54	NA	NA
WP_011899080.1|3968561_3969593_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088814193.1|3969608_3970340_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_005319295.1|3970352_3970736_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	4.4e-07
WP_005319297.1|3970847_3971567_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_088814192.1|3971595_3972429_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_096071998.1|3972436_3973825_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_088814191.1|3973872_3975975_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_042468835.1|3977015_3977813_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_005319310.1|3977892_3978162_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_042468832.1|3978189_3978969_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_005319315.1|3978955_3979339_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_017412373.1|3979400_3979793_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_005319319.1|3979842_3980913_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017412372.1|3980922_3981441_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_088814222.1|3983349_3984267_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005319344.1|3984365_3985151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005319346.1|3985349_3985718_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005319348.1|3985969_3986278_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_042468560.1|3986274_3986799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005319352.1|3986783_3986966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096071999.1|3987005_3988202_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005319357.1|3988434_3989763_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_005319359.1|3989925_3990393_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005319365.1|3993272_3994241_-	glucokinase	NA	NA	NA	NA	NA
WP_087755253.1|3994581_3995445_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017412636.1|3995608_3997048_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_005319373.1|3997108_3998155_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042468563.1|3998170_4001236_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.2	3.3e-68
WP_096072000.1|4001411_4003736_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042468566.1|4003784_4004438_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157738349.1|4004583_4004796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|4004844_4005762_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|4006502_4007420_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_076611341.1|4009080_4009998_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005316739.1|4010489_4011407_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_096072001.1|4011437_4012424_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_005316745.1|4012560_4013268_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_034282620.1|4013510_4014467_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_087755208.1|4014617_4015118_-	peptidase P60	NA	A0A217EQL1	Bacillus_phage	43.8	1.4e-16
WP_005316754.1|4015380_4016103_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_005316757.1|4016099_4016948_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005334342.1|4017091_4017334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005316761.1|4017558_4018212_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.1	2.3e-40
WP_042468628.1|4018685_4019522_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.1	3.1e-13
WP_005316767.1|4019591_4020854_-	DUF945 family protein	NA	NA	NA	NA	NA
WP_088814188.1|4022444_4023053_+	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_042468632.1|4023057_4023498_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042468634.1|4023971_4025135_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_085941431.1|4025363_4026725_+	alpha-amylase	NA	NA	NA	NA	NA
WP_005316782.1|4027710_4028397_-	aquaporin Z	NA	NA	NA	NA	NA
WP_017412842.1|4028744_4029266_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_076611341.1|4029907_4030825_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_088814343.1|4031185_4032322_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011899080.1|4032525_4033557_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	4444648	4519028	4783004	protease,tRNA,transposase	Tupanvirus(14.29%)	58	NA	NA
WP_005316946.1|4444648_4445182_+|protease	SprT family zinc-dependent metalloprotease	protease	A0A060AI19	Cronobacter_phage	31.0	6.8e-06
WP_005316947.1|4445255_4445945_+	deoxyribonuclease	NA	NA	NA	NA	NA
WP_005316949.1|4446075_4446807_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005316951.1|4446858_4447812_+	glutathione synthase	NA	NA	NA	NA	NA
WP_076611341.1|4449588_4450506_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_011899080.1|4450700_4451732_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011898468.1|4451803_4452391_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_005316956.1|4452437_4452860_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_005316958.1|4453002_4453965_-	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_042468776.1|4453987_4455139_-	MFS transporter	NA	NA	NA	NA	NA
WP_080697424.1|4455452_4456601_-	FOX/MOX family class C beta-lactamase	NA	NA	NA	NA	NA
WP_005316965.1|4456825_4457746_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017412666.1|4457745_4458750_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_042468773.1|4458736_4460710_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_005316972.1|4460812_4462255_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_005316974.1|4462997_4463948_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.7	4.6e-13
WP_005316978.1|4464339_4464888_-	hemerythrin	NA	NA	NA	NA	NA
WP_005316980.1|4465134_4465803_-	uracil-DNA glycosylase	NA	A0A109ZQN1	Equid_alphaherpesvirus	48.4	1.8e-51
WP_005316983.1|4465834_4466092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011899080.1|4466269_4467301_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005316999.1|4467595_4467976_+	autonomous glycyl radical cofactor GrcA	NA	A0A219YAN3	Aeromonas_phage	60.3	4.4e-31
WP_076611341.1|4468581_4469499_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042468530.1|4470740_4471595_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.6	2.3e-48
WP_042468528.1|4471846_4472647_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005317005.1|4472658_4473042_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_005317007.1|4473086_4473956_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005317010.1|4474005_4475094_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.5	2.2e-06
WP_042468526.1|4475147_4476404_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_005317016.1|4476524_4477109_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017412585.1|4477135_4478005_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005317019.1|4478369_4479317_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.1	9.2e-46
WP_042468524.1|4479418_4481407_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_042468523.1|4481615_4482257_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017412588.1|4482263_4483355_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_005317037.1|4484784_4486617_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_005317039.1|4486912_4487635_+	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	29.2	1.3e-20
WP_005317041.1|4487631_4488357_+	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_005317044.1|4488504_4489176_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_017412611.1|4489210_4489537_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005317048.1|4489624_4490545_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	31.9	8.1e-23
WP_157668966.1|4490619_4490757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|4490801_4491719_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_042469063.1|4492442_4495202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412609.1|4495198_4496869_-	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	32.7	4.5e-72
WP_005317065.1|4497105_4497447_+	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_088814162.1|4497512_4498430_-|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005317067.1|4498711_4500319_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_042468064.1|4500802_4502593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317078.1|4502973_4504533_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	26.9	2.8e-47
WP_005317081.1|4504543_4505698_+	MFS transporter	NA	NA	NA	NA	NA
WP_005317090.1|4511235_4511832_+	beta-phosphoglucomutase family hydrolase	NA	A0A1D8KPI1	Synechococcus_phage	28.7	1.9e-12
WP_005317093.1|4512009_4512807_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_005317097.1|4512937_4514407_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005317100.1|4514491_4515511_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_005317101.1|4515586_4516804_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.6e-24
WP_005317102.1|4517081_4517663_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.7	1.7e-71
WP_005317103.1|4517684_4517900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317104.1|4518023_4519028_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP017143	Aeromonas salmonicida subsp. masoucida strain RFAS1 chromosome, complete genome	4783004	4743802	4782922	4783004	capsid,transposase,terminase,integrase,head,tail,portal	Aeromonas_virus(25.0%)	53	4740568:4740582	4766660:4766674
4740568:4740582	attL	AGAAGATGACCAGCA	NA	NA	NA	NA
WP_076611341.1|4743802_4744720_+|transposase	IS5-like element ISAs4 family transposase	transposase	NA	NA	NA	NA
WP_005317818.1|4745562_4745778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005317820.1|4745815_4746571_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	29.1	5.1e-23
WP_088814298.1|4746820_4747756_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_088814343.1|4747782_4748919_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_042468556.1|4749531_4750257_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_005317829.1|4750331_4751240_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_042468555.1|4751233_4752325_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005317834.1|4752522_4753032_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_005317835.1|4753159_4753528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317837.1|4753612_4754359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005317842.1|4754567_4754996_+	universal stress protein	NA	NA	NA	NA	NA
WP_005317845.1|4755063_4755699_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_042468553.1|4755854_4757108_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.5	2.7e-93
WP_011898405.1|4757205_4758309_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.2	9.0e-61
WP_005317854.1|4758535_4758928_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_005317857.1|4758988_4760257_-	esterase FrsA	NA	NA	NA	NA	NA
WP_005317860.1|4760368_4760836_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_024943575.1|4760945_4761992_-|integrase	tyrosine-type recombinase/integrase	integrase	A5X9F3	Aeromonas_virus	54.6	1.9e-100
WP_157738360.1|4761988_4763200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085044606.1|4763229_4763559_-	S24 family peptidase	NA	A5X9F5	Aeromonas_virus	64.2	2.1e-34
WP_085044558.1|4764141_4764555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096072022.1|4764588_4765107_+	hypothetical protein	NA	A5X9F7	Aeromonas_virus	43.0	1.5e-26
WP_024943570.1|4765118_4765436_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_085044560.1|4765432_4765654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085044561.1|4765668_4766112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085044562.1|4766175_4766475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085044563.1|4766471_4766690_+	hypothetical protein	NA	NA	NA	NA	NA
4766660:4766674	attR	AGAAGATGACCAGCA	NA	NA	NA	NA
WP_085044564.1|4766859_4767150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085044565.1|4767146_4767464_+	hypothetical protein	NA	A5X9G2	Aeromonas_virus	76.5	1.5e-40
WP_085044566.1|4767460_4767682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085044567.1|4767678_4767954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085044607.1|4768193_4768529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085044568.1|4768525_4768762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085044569.1|4768758_4771146_+	replication endonuclease	NA	A5X9G4	Aeromonas_virus	34.9	1.5e-97
WP_085044570.1|4771156_4771759_+	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	59.9	3.2e-52
WP_085044571.1|4771755_4772097_+	hypothetical protein	NA	A0A1P8DTU9	Salmonella_phage	63.8	2.2e-34
WP_085044573.1|4772557_4772908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085044574.1|4772904_4773246_+	hypothetical protein	NA	G9L6B6	Escherichia_phage	32.0	2.6e-06
WP_085044575.1|4773255_4773549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085044576.1|4773640_4773832_+	DUF3283 family protein	NA	NA	NA	NA	NA
WP_139804921.1|4774410_4774776_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085044578.1|4774984_4775170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085044579.1|4775636_4776701_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	56.1	6.8e-114
WP_085044580.1|4776697_4778467_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	69.8	9.2e-241
WP_085044581.1|4778615_4779449_+|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	47.5	1.8e-53
WP_085044582.1|4779461_4780496_+|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	61.4	2.3e-114
WP_085044583.1|4780505_4781258_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	43.9	3.2e-41
WP_085044584.1|4781254_4781506_+	hypothetical protein	NA	A0A2H4P7H0	Pseudomonas_phage	42.2	4.8e-10
WP_085044585.1|4781616_4782093_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	51.9	1.2e-33
WP_043144013.1|4782092_4782296_+|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	59.1	3.6e-16
WP_080750970.1|4782286_4782544_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_085044586.1|4782559_4782922_+	hypothetical protein	NA	E5E3R9	Burkholderia_phage	38.8	1.8e-13
>prophage 1
NZ_CP017145	Aeromonas salmonicida subsp. masoucida strain RFAS1 plasmid unnamed2, complete sequence	63563	1461	59428	63563	transposase	Vibrio_phage(50.0%)	59	NA	NA
WP_076611341.1|1461_2379_-|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_042469128.1|2661_3420_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_042469126.1|4075_4474_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_043774562.1|5196_6030_-	hypothetical protein	NA	A0A219Y8Z3	Aeromonas_phage	30.9	1.0e-19
WP_005321586.1|6815_7388_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_096072051.1|7403_7736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011898961.1|7775_8990_-|transposase	IS256-like element ISAs3 family transposase	transposase	A0A218MNI5	uncultured_virus	47.9	4.3e-48
WP_155268746.1|9215_9353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320818.1|10984_11434_-	Ati1 family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_011899437.1|12207_13236_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_017411843.1|13869_14535_-	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_042468158.1|14513_15140_-	type III secretion system sorting platform protein AscK	NA	NA	NA	NA	NA
WP_005320809.1|15136_15865_-	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_005320806.1|15883_16222_-	EscI/YscI/HrpB family type III secretion system inner rod protein	NA	NA	NA	NA	NA
WP_005320804.1|16221_16776_-	YopR family type III secretion effector	NA	NA	NA	NA	NA
WP_096072052.1|16772_17126_-	YscG family type III secretion protein	NA	NA	NA	NA	NA
WP_088814099.1|17125_17383_-	EscF/YscF/HrpA family type III secretion system needle major subunit	NA	NA	NA	NA	NA
WP_042468160.1|17375_17588_-	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_042468161.1|17550_18855_-	EscD/YscD/HrpQ family type III secretion system inner membrane ring protein	NA	NA	NA	NA	NA
WP_005320794.1|18851_20690_-	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_017411838.1|20677_21103_-	YscB family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_017411837.1|21118_21934_-	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_096072053.1|22053_22797_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_076611341.1|22889_23807_+|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_042468163.1|24285_24687_-	type III secretion system chaperone YscW	NA	NA	NA	NA	NA
WP_005320785.1|24683_24917_-	T3SS regulon translocated regulator ExsE family protein	NA	NA	NA	NA	NA
WP_096072054.1|24919_25363_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_042468164.1|25498_26395_-	type III secretion system translocon subunit AopD	NA	NA	NA	NA	NA
WP_042468165.1|26407_27601_-	type III secretion system translocon subunit AopB	NA	NA	NA	NA	NA
WP_042468166.1|27548_28085_-	CesD/SycD/LcrH family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_096072055.1|28094_29180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320774.1|29189_29474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320772.1|29513_29969_-	type III secretion system regulator LcrR	NA	NA	NA	NA	NA
WP_096072056.1|29965_32083_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_020379598.1|32063_32414_-	type III secretion system chaperone AscY	NA	NA	NA	NA	NA
WP_005320766.1|32410_32776_-	type III secretion system protein AscX	NA	NA	NA	NA	NA
WP_005320764.1|32772_33144_-	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_088814098.1|33140_33422_-	TyeA family type III secretion system gatekeeper subunit	NA	NA	NA	NA	NA
WP_042468168.1|33402_34281_-	YopN family type III secretion system gatekeeper subunit	NA	NA	NA	NA	NA
WP_005320755.1|34470_35793_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_017411827.1|35789_36251_+	type III secretion system central stalk protein AscO	NA	NA	NA	NA	NA
WP_005320747.1|37801_38728_+	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_042468169.1|38724_39378_+	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_005320743.1|39379_39646_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_042468170.1|39642_40431_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_005320739.1|40427_41486_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_076611341.1|45489_46407_-|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_042469195.1|46813_47452_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	44.8	4.9e-43
WP_080697445.1|47451_47742_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_088814097.1|47957_48353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|48397_49315_+|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_042468959.1|49533_50253_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.1	1.6e-50
WP_042468955.1|54019_54580_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	83.1	9.9e-48
WP_042468961.1|54803_55073_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_042468953.1|55072_55348_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_042468951.1|56134_57049_+	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_088814096.1|57050_57236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611341.1|57284_58202_+|transposase	IS5-like element ISAs4 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	55.8	4.4e-93
WP_088814095.1|58396_59428_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
