The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017085	Proteus mirabilis strain T18 chromosome, complete genome	4131426	141738	230362	4131426	integrase,transposase	Escherichia_phage(24.0%)	79	187548:187561	234160:234173
WP_063693206.1|141738_142947_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.3	3.4e-186
WP_053828396.1|142969_143386_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.1e-43
WP_004249011.1|144206_144725_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_017628614.1|144797_146969_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_142836749.1|148331_151283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628612.1|151282_152221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249835.1|152213_152483_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_017628611.1|152674_153598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368584.1|153687_154365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249837.1|154457_156065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628610.1|156078_158574_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004246670.1|158596_159280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246669.1|159369_159993_-	fimbrillin MatB	NA	NA	NA	NA	NA
WP_004246668.1|160132_160453_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017628609.1|161500_162535_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	7.4e-65
WP_001274561.1|163077_163923_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_060589331.1|164007_164295_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761716.1|164224_164713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094437.1|164709_165087_-	toxin	NA	NA	NA	NA	NA
WP_001390338.1|165133_165511_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|165673_165895_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001535682.1|165957_166434_-	RadC family protein	NA	NA	NA	NA	NA
WP_023145813.1|166449_166992_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	2.9e-12
WP_001535681.1|167264_168083_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.6e-46
WP_001323397.1|168237_168396_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000820574.1|168466_171313_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|171685_172558_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000241617.1|172656_173529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043064.1|174943_176156_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_001387788.1|177429_178032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072153745.1|178126_178405_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000148641.1|179995_180565_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271020.1|180730_181114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181455.1|181110_181536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|182015_183629_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624711.1|183659_184010_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_096043063.1|184373_185390_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	7.0e-185
WP_000412211.1|186509_187169_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|187369_187747_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
187548:187561	attL	ATTATCGCTTTACC	NA	NA	NA	NA
WP_001067855.1|190534_191239_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|191823_192684_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|192833_193235_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|193280_193985_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|194174_194990_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|195140_195845_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|196600_197452_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|197759_198575_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_096043062.1|198635_199439_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	28.7	1.6e-14
WP_000480968.1|199438_200275_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_028697649.1|200381_200858_+	TnpR	NA	NA	NA	NA	NA
WP_001339197.1|200919_202128_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_096043061.1|202231_203200_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	99.7	4.6e-186
WP_000557454.1|203342_204203_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|204215_204758_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|205239_205431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|205436_205682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|205732_206869_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|209377_210682_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|210728_211433_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000454193.1|211863_212214_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|212416_213430_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|213587_214061_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_000503573.1|214191_214980_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|215185_215533_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|215526_216366_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|216493_216994_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|216962_217955_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|217957_219673_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|219711_220419_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|220415_220652_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|220648_221011_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|221028_222723_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|222774_223197_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|223232_223508_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|223521_223872_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|223943_224378_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_086937185.1|226346_227150_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.4	1.9e-31
WP_119563495.1|227379_228333_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001218908.1|229177_230362_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
234160:234173	attR	GGTAAAGCGATAAT	NA	NA	NA	NA
>prophage 2
NZ_CP017085	Proteus mirabilis strain T18 chromosome, complete genome	4131426	261409	318232	4131426	integrase,tRNA,transposase	Helicobacter_phage(15.38%)	46	284725:284739	322558:322572
WP_004246627.1|261409_262438_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_036895833.1|263707_264124_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	7.6e-45
WP_012368600.1|264211_264886_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004249861.1|265003_265627_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_004249862.1|265994_267953_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	3.7e-89
WP_004246621.1|268117_268429_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_004246620.1|268425_270081_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_017628600.1|270403_272035_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_063693479.1|272074_273283_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	6.2e-188
WP_017628598.1|273354_273723_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	4.2e-39
WP_012368603.1|273809_274502_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_017628597.1|274505_275924_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_017628596.1|275914_276652_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004249867.1|282551_283238_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012368605.1|283318_284716_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
284725:284739	attL	GATATAAAAATAAAA	NA	NA	NA	NA
WP_004246607.1|284797_285724_-	ribokinase	NA	NA	NA	NA	NA
WP_017628746.1|286004_287504_+	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	38.0	3.0e-22
WP_004246605.1|287511_288969_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_004246604.1|288969_289962_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246603.1|290122_290584_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_004249871.1|290683_291124_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_017628745.1|291503_293402_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_004246599.1|293398_294025_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004246598.1|294640_295018_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246597.1|295049_295874_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|295919_296159_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246595.1|296220_296691_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246594.1|296703_297237_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004246592.1|297251_298793_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246591.1|298850_299714_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246589.1|299748_301131_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246588.1|301152_301569_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004246587.1|301719_303093_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_004246586.1|303250_305077_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	1.2e-131
WP_001029679.1|305236_306058_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000267723.1|306044_308153_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|308149_309817_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001243518.1|309819_311346_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000251879.1|311346_312963_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001271300.1|313193_313571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|313980_314352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|314984_315773_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|315830_316355_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|316449_316923_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_096058085.1|317254_317791_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	5.3e-14
WP_000497519.1|317905_318232_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
322558:322572	attR	GATATAAAAATAAAA	NA	NA	NA	NA
>prophage 3
NZ_CP017085	Proteus mirabilis strain T18 chromosome, complete genome	4131426	1285130	1334932	4131426	transposase,protease	Organic_Lake_phycodnavirus(50.0%)	30	NA	NA
WP_004244908.1|1285130_1286606_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_017628313.1|1287095_1289159_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_063073854.1|1289389_1291354_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_026090468.1|1291660_1293625_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_004244894.1|1294089_1294974_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017628316.1|1294967_1296224_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_017628317.1|1296592_1297978_-	glycoporin	NA	NA	NA	NA	NA
WP_004244891.1|1298034_1298679_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_017628318.1|1298671_1301389_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_004247346.1|1301414_1302836_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_004244888.1|1302954_1303923_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_004247357.1|1305180_1306038_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004244871.1|1306011_1306803_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004244870.1|1307444_1307750_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063073853.1|1307832_1314756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001985440.1|1314860_1316114_+	TolC family protein	NA	NA	NA	NA	NA
WP_017628323.1|1316138_1318301_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	6.2e-29
WP_036894348.1|1318320_1319580_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017628325.1|1319847_1320525_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026090469.1|1320654_1321983_-	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_017628327.1|1322046_1324209_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_107034653.1|1324582_1324690_-	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_004244852.1|1325865_1326636_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012367549.1|1328467_1329328_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_017628331.1|1331545_1332100_+	type IV B pilus protein	NA	NA	NA	NA	NA
WP_004244844.1|1332096_1332801_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004244842.1|1333113_1333692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244841.1|1333695_1333965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628332.1|1334191_1334464_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004247373.1|1334683_1334932_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.5	2.9e-07
>prophage 4
NZ_CP017085	Proteus mirabilis strain T18 chromosome, complete genome	4131426	1439259	1451220	4131426		Mycobacterium_phage(25.0%)	12	NA	NA
WP_096043046.1|1439259_1440459_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_012367584.1|1441067_1442036_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	5.9e-133
WP_004252248.1|1442061_1444188_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|1444216_1444621_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1444632_1444857_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1445138_1445612_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1445809_1446019_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246058.1|1447087_1447462_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1447477_1448443_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|1448544_1449189_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1449546_1449810_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1450008_1451220_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 5
NZ_CP017085	Proteus mirabilis strain T18 chromosome, complete genome	4131426	1487125	1527095	4131426	integrase,lysis,tail	Proteus_phage(19.51%)	60	1484766:1484781	1494857:1494872
1484766:1484781	attL	TAAAAATGGAATTAAA	NA	NA	NA	NA
WP_049195171.1|1487125_1488127_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	2.8e-69
WP_012367595.1|1488083_1488329_-	excisionase	NA	NA	NA	NA	NA
WP_004247455.1|1488325_1488664_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	5.6e-14
WP_017628830.1|1488990_1489251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628829.1|1489302_1489755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153274246.1|1490261_1490423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907946.1|1490928_1491735_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	94.3	3.9e-138
WP_004246000.1|1491727_1492546_-	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	97.1	3.5e-158
WP_004245998.1|1492542_1492797_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	7.2e-38
WP_004245997.1|1492924_1493107_-	host cell division inhibitory peptide Kil	NA	A0A1P8DTH8	Proteus_phage	85.0	4.4e-21
WP_004245996.1|1493450_1493732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245995.1|1493703_1493940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195172.1|1493954_1494272_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	51.4	2.1e-18
WP_004245992.1|1495019_1495541_-	hypothetical protein	NA	I6R9C4	Salmonella_phage	78.5	5.6e-61
1494857:1494872	attR	TTTAATTCCATTTTTA	NA	NA	NA	NA
WP_004245991.1|1495778_1496120_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	62.8	2.1e-37
WP_004245990.1|1496128_1496812_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	98.2	1.5e-130
WP_004245989.1|1496894_1497104_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_049195174.1|1497249_1497597_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.0	3.2e-36
WP_049195176.1|1497862_1498630_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.0e-23
WP_046335275.1|1498629_1500015_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_049195179.1|1500040_1500490_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|1500568_1500859_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|1500855_1501212_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245982.1|1501211_1501844_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
WP_004247148.1|1502155_1502677_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004247488.1|1502835_1503258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026164644.1|1503311_1503581_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
WP_017827434.1|1503580_1504051_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_049195183.1|1504193_1504655_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	4.4e-25
WP_004247494.1|1505002_1505587_+	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_004245979.1|1505583_1505790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245977.1|1505972_1506581_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.4e-65
WP_049195184.1|1506583_1508071_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.8	1.0e-264
WP_012367628.1|1508070_1509441_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.8	9.0e-119
WP_012367629.1|1509437_1510559_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.0	6.7e-104
WP_036907977.1|1510670_1511432_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	1.5e-67
WP_004245970.1|1511445_1512399_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.4e-126
WP_107033975.1|1512401_1512686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367632.1|1512725_1513205_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	3.8e-32
WP_004247502.1|1513207_1513558_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	4.9e-21
WP_049195193.1|1513559_1514141_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.5e-48
WP_049195195.1|1514137_1514539_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004247505.1|1514584_1515241_+	hypothetical protein	NA	G8C7Q3	Escherichia_phage	57.7	8.6e-59
WP_049195198.1|1515292_1515598_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	8.7e-22
WP_049195199.1|1515612_1515900_+	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	6.9e-13
WP_049195202.1|1516456_1516945_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_049195354.1|1517216_1518053_-	antirepressor	NA	I6S627	Salmonella_phage	59.6	1.3e-72
WP_049195353.1|1518217_1518607_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049195351.1|1518759_1519161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064971710.1|1519273_1519546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195350.1|1519613_1519847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053089294.1|1519972_1520794_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	50.9	2.3e-21
WP_049195348.1|1520854_1523794_+|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	34.0	1.3e-133
WP_004247512.1|1523816_1524029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195346.1|1524068_1524359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245944.1|1524378_1524579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195345.1|1524722_1525064_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_049195343.1|1525060_1525804_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.8	2.6e-88
WP_049195341.1|1525800_1526511_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	66.4	1.8e-86
WP_036976694.1|1526507_1527095_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	58.9	7.2e-57
>prophage 6
NZ_CP017085	Proteus mirabilis strain T18 chromosome, complete genome	4131426	1708928	1787998	4131426	plate,tRNA,protease	Bacillus_phage(17.65%)	59	NA	NA
WP_004244558.1|1708928_1709243_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1709273_1711568_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1711687_1711906_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012367702.1|1712225_1712918_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_063073899.1|1712919_1714671_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_017628444.1|1714673_1716443_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004244564.1|1716581_1717541_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	9.0e-65
WP_004244566.1|1718083_1718578_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_053828337.1|1718705_1722569_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1722681_1723287_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|1723297_1724647_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_049195444.1|1724780_1726070_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	1.4e-97
WP_004244572.1|1726249_1726582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367707.1|1726982_1728032_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|1728104_1729010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1729367_1730108_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1730215_1732498_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|1732552_1733407_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_017628443.1|1734077_1735835_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_004244579.1|1736062_1737100_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_012367709.1|1737174_1738443_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017628442.1|1738579_1740010_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.1	4.4e-07
WP_004244582.1|1740146_1741235_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_017628441.1|1741431_1742718_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|1743006_1743684_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|1743865_1745539_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1745603_1745891_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_096043116.1|1745959_1746157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628440.1|1746361_1748731_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	3.6e-22
WP_004244589.1|1748767_1750513_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_012367713.1|1750509_1751511_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1752006_1752222_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1752636_1752816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1752820_1753582_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017628439.1|1753704_1754535_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|1754914_1755688_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1755697_1757020_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1757000_1757732_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_012367715.1|1757728_1762186_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247636.1|1762468_1763122_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
WP_004247637.1|1763527_1764241_+	class B acid phosphatase	NA	NA	NA	NA	NA
WP_049194798.1|1764590_1766306_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|1766637_1767186_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|1767235_1767886_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1767978_1768452_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004244608.1|1768542_1770279_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_017628437.1|1770271_1771627_-	membrane protein	NA	NA	NA	NA	NA
WP_017628436.1|1771664_1775213_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012367720.1|1775215_1776679_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|1776684_1777335_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1777336_1778125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194443.1|1778128_1780840_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|1780848_1781604_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004244618.1|1781596_1782964_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_063073901.1|1782956_1783508_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1783509_1784778_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_049194444.1|1784782_1785820_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_049194445.1|1785783_1787559_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244624.1|1787566_1787998_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 7
NZ_CP017085	Proteus mirabilis strain T18 chromosome, complete genome	4131426	1948072	2026316	4131426	capsid,tRNA,lysis,terminase,portal,integrase,tail,head,protease	Enterobacteria_phage(20.63%)	98	1969986:1970002	2014076:2014092
WP_004247117.1|1948072_1949176_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|1949281_1949734_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|1949726_1950356_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|1950494_1951748_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_004251675.1|1951868_1952996_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.6	3.7e-126
WP_004251672.1|1952976_1953219_-	excisionase	NA	NA	NA	NA	NA
WP_004247124.1|1953280_1953811_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
WP_004247125.1|1953867_1954695_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_004247126.1|1954760_1955135_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_004247127.1|1955158_1955341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247128.1|1955783_1956266_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
WP_004247129.1|1956369_1956609_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
WP_004247130.1|1956693_1957152_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	3.9e-26
WP_096058090.1|1957241_1957451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063108983.1|1957440_1957620_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	53.4	6.8e-11
WP_004247133.1|1957632_1958724_+	hypothetical protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
WP_004247134.1|1958895_1959603_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_004247135.1|1959602_1960628_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
WP_004247136.1|1960655_1961054_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
WP_004247137.1|1961396_1961609_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247148.1|1962010_1962532_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004251632.1|1962855_1963191_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_017827436.1|1963294_1964221_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_036905792.1|1964637_1965066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905789.1|1965913_1966183_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
WP_036900946.1|1966182_1966653_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_036905787.1|1966795_1967257_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
WP_155115349.1|1967914_1968070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001967215.1|1968153_1968492_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_036905782.1|1968494_1968707_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.1e-07
WP_036905779.1|1968830_1969298_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
WP_036969710.1|1969251_1970985_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.5	6.9e-148
1969986:1970002	attL	GATCACCAACAGTGGCC	NA	NA	NA	NA
WP_012367784.1|1970984_1972253_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	5.1e-201
WP_004251596.1|1972270_1972939_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.1e-82
WP_004251594.1|1972942_1974109_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	5.6e-170
WP_004251590.1|1974147_1974447_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	64.3	2.8e-33
WP_004251588.1|1974446_1974776_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_004251585.1|1974765_1975239_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
WP_004251583.1|1975244_1975586_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_004251580.1|1975595_1976261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251577.1|1976325_1976742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894769.1|1976738_1977017_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1977041_1977233_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_036905771.1|1977359_1980635_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	45.6	6.4e-54
WP_004251569.1|1980635_1981232_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	4.6e-51
WP_004251564.1|1981231_1981813_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	2.4e-52
WP_004251562.1|1981824_1982130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251558.1|1982161_1982560_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
WP_017627865.1|1986274_1986607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017627864.1|1986606_1987293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905768.1|1987289_1987556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|1987572_1987833_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
WP_036905765.1|1988536_1988842_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157673314.1|1989930_1991211_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_096058091.1|1992727_1992892_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	87.0	6.3e-19
WP_063073916.1|1993188_1994316_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	59.0	4.1e-117
WP_012367804.1|1994296_1994539_-	excisionase	NA	NA	NA	NA	NA
WP_063073917.1|1994795_1995455_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	44.4	1.7e-46
WP_063073918.1|1995773_1996847_+	hypothetical protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	36.3	6.4e-27
WP_063073919.1|1996859_1997258_+	antitermination protein Q	NA	B6SCZ7	Bacteriophage	54.5	2.3e-30
WP_012367807.1|1997479_1997740_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247849.1|1997894_1998152_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247850.1|1998157_1998430_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	67.2	1.3e-16
WP_049202017.1|1998735_1998942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073920.1|1999243_2000266_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	68.3	1.2e-128
WP_063073921.1|2000539_2001427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073922.1|2001439_2001679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073923.1|2001671_2002061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073924.1|2002211_2002481_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	46.7	7.4e-17
WP_063073925.1|2002480_2002951_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.9	4.0e-50
WP_063073926.1|2003093_2003555_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.7	5.5e-12
WP_063073927.1|2003794_2004370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073928.1|2004436_2004715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247866.1|2005185_2005698_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	64.0	1.1e-58
WP_049209882.1|2005710_2006205_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	65.6	2.3e-48
WP_063073929.1|2006201_2008304_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	68.9	7.7e-295
WP_004247869.1|2008300_2008516_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	64.3	1.2e-17
WP_063073930.1|2008512_2010003_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	67.0	1.6e-190
WP_096058092.1|2009968_2011957_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	63.9	1.0e-248
WP_049209887.1|2012045_2012387_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	47.7	3.9e-15
WP_063073894.1|2012398_2012671_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	46.1	1.1e-15
WP_063073895.1|2012680_2013244_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.1	6.2e-50
WP_036973524.1|2013243_2013639_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	59.5	2.2e-41
WP_074153257.1|2013650_2014172_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	74.7	2.2e-65
2014076:2014092	attR	GATCACCAACAGTGGCC	NA	NA	NA	NA
WP_049202041.1|2014183_2014573_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	39.4	3.1e-16
WP_080591809.1|2014593_2014914_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	42.0	9.7e-16
WP_063073893.1|2014882_2017876_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	33.8	1.3e-109
WP_063073892.1|2017876_2018206_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	54.6	6.7e-28
WP_004247884.1|2018300_2018876_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	34.1	4.9e-18
WP_063073891.1|2018928_2019633_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	51.1	1.7e-65
WP_063073890.1|2019654_2020383_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	61.5	1.4e-89
WP_080978935.1|2020352_2020937_+|tail	tail assembly protein	tail	K7PH50	Enterobacteria_phage	47.5	2.0e-43
WP_063073889.1|2020951_2024155_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	55.5	2.9e-277
WP_049219065.1|2024144_2024477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073888.1|2024476_2025163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827679.1|2025159_2025426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073887.1|2025442_2025682_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	68.4	2.0e-21
WP_063073886.1|2025794_2026316_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	83.6	2.1e-76
>prophage 8
NZ_CP017085	Proteus mirabilis strain T18 chromosome, complete genome	4131426	2610026	2643748	4131426	holin,terminase,tail	Escherichia_phage(22.22%)	39	NA	NA
WP_004243319.1|2610026_2611079_-	nucleotidyltransferase	NA	A0A067XQU1	Caulobacter_phage	23.1	1.6e-06
WP_017628042.1|2611062_2611842_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.3	1.4e-31
WP_063073803.1|2612219_2612714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073802.1|2612713_2613058_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	83.3	2.9e-42
WP_004243326.1|2613060_2613333_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	38.9	1.9e-12
WP_020945795.1|2613329_2613701_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	3.9e-16
WP_063073801.1|2613786_2615973_-	hypothetical protein	NA	A0A193GYU1	Enterobacter_phage	58.3	7.7e-88
WP_036976792.1|2616146_2616398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036976793.1|2616426_2616741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073800.1|2616737_2617040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073799.1|2617050_2620434_-	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	36.0	1.2e-183
WP_063073798.1|2620433_2623517_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	50.6	7.1e-164
WP_063073797.1|2623519_2624068_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	2.0e-45
WP_063073796.1|2624067_2624556_-	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	59.2	3.0e-48
WP_063073795.1|2624539_2627002_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.0	0.0e+00
WP_063073794.1|2627001_2627607_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.2	2.5e-65
WP_063073793.1|2627659_2628001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060555916.1|2628009_2628441_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	1.4e-30
WP_063073792.1|2628499_2629480_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	60.3	1.7e-111
WP_063073791.1|2629495_2630173_-	peptidase	NA	T1SAP9	Salmonella_phage	64.3	6.8e-43
WP_004243354.1|2630190_2630505_-	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
WP_063073790.1|2630501_2632166_-|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	65.6	2.4e-198
WP_004243356.1|2632175_2632388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073789.1|2632573_2634058_-	hypothetical protein	NA	G9L6B8	Escherichia_phage	77.6	4.7e-230
WP_063073788.1|2634057_2634627_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	50.3	2.6e-43
WP_147383762.1|2634673_2635318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073786.1|2635352_2635694_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	58.3	1.3e-29
WP_157742850.1|2635686_2636115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073784.1|2636133_2636409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073783.1|2636456_2636852_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	6.8e-35
WP_063073782.1|2636848_2637262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049211513.1|2637484_2637967_-	replication protein	NA	NA	NA	NA	NA
WP_049211516.1|2637935_2638871_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	57.6	2.4e-70
WP_063073781.1|2638872_2639094_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	48.3	1.1e-10
WP_064505757.1|2639235_2639514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243373.1|2639591_2640200_+	hypothetical protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
WP_063073780.1|2640596_2642321_+	DNA breaking-rejoining protein	NA	A0A0U2I1R6	Escherichia_phage	47.2	2.1e-112
WP_063073779.1|2642366_2643449_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	55.7	2.8e-107
WP_063073778.1|2643493_2643748_+	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	35.2	4.7e-05
>prophage 9
NZ_CP017085	Proteus mirabilis strain T18 chromosome, complete genome	4131426	2832207	2851010	4131426	holin,lysis	Escherichia_phage(21.43%)	21	NA	NA
WP_012368081.1|2832207_2834646_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|2834657_2835275_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|2835278_2836055_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|2836170_2836713_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|2837281_2837461_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_017628011.1|2838775_2839432_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_017628010.1|2839428_2840616_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|2840608_2840953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|2840949_2841642_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|2841644_2842457_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2842425_2842746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250719.1|2842758_2843247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628009.1|2843249_2845553_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	1.6e-14
WP_004243627.1|2845635_2846094_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_012368088.1|2846153_2846606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628008.1|2846616_2848104_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_004248364.1|2848112_2848625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628007.1|2848661_2849111_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017628006.1|2849107_2849512_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_004248367.1|2849514_2849814_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243640.1|2850194_2851010_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
>prophage 10
NZ_CP017085	Proteus mirabilis strain T18 chromosome, complete genome	4131426	3327809	3398346	4131426	tRNA,lysis,terminase,holin,integrase,tail,head	Salmonella_phage(17.81%)	95	3343623:3343669	3393954:3394000
WP_052715531.1|3327809_3331040_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	42.0	1.8e-101
WP_036918873.1|3331056_3331398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271821.1|3331397_3331571_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036918875.1|3331742_3332255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043103.1|3333238_3335959_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.1	0.0e+00
WP_046334700.1|3335955_3336300_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.1	1.4e-44
WP_052715532.1|3336314_3336911_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.2	6.4e-29
WP_036900272.1|3336910_3337105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334701.1|3337274_3337886_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	46.3	3.3e-20
WP_036907509.1|3337882_3338092_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_036918882.1|3338088_3338268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334702.1|3338264_3338522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072052191.1|3338524_3338698_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_080942627.1|3338690_3339632_-	ash family protein	NA	A0A1W6JPK3	Morganella_phage	50.0	3.3e-64
WP_046334703.1|3339628_3340462_-	antA/AntB antirepressor family protein	NA	A0A088CBR4	Shigella_phage	46.1	1.4e-21
WP_036918890.1|3340474_3340870_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	2.1e-28
WP_036918892.1|3340869_3341067_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	46.3	2.3e-07
WP_046334704.1|3342247_3343459_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
3343623:3343669	attL	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_096043102.1|3343843_3344074_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	93.4	5.3e-32
WP_096043101.1|3344138_3346427_-	SGNH/GDSL hydrolase family protein	NA	A0A291AXF7	Shigella_phage	56.1	1.0e-45
WP_096043100.1|3346485_3348954_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	51.6	9.5e-252
WP_096043099.1|3348940_3349333_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	57.9	3.6e-44
WP_096043098.1|3349329_3349800_-	DUF1833 domain-containing protein	NA	F1C5F1	Cronobacter_phage	51.3	2.0e-41
WP_096043097.1|3349799_3350276_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	71.6	7.3e-60
WP_096043096.1|3350279_3353672_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	41.0	1.9e-162
WP_096043095.1|3353740_3354286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096058096.1|3354312_3354723_-	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	45.3	1.4e-19
WP_096043093.1|3354778_3355111_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	80.9	8.5e-15
WP_096043092.1|3355230_3355398_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	46.3	4.0e-05
WP_096043114.1|3355471_3356227_+	DNA-binding protein	NA	A0A2H4JDP7	uncultured_Caudovirales_phage	43.7	2.0e-35
WP_096043091.1|3356223_3357042_+	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	62.3	8.8e-37
WP_049199086.1|3357158_3357566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049199087.1|3357556_3358339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043090.1|3358589_3359279_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	72.4	1.1e-91
WP_096043089.1|3359328_3360084_-	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	78.9	2.8e-106
WP_096043088.1|3360148_3360517_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	30.3	1.1e-10
WP_096043087.1|3360513_3360885_-	hypothetical protein	NA	G0ZNE3	Cronobacter_phage	65.0	1.1e-39
WP_094960237.1|3360886_3361228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043086.1|3361227_3361626_-	hypothetical protein	NA	I6S619	Salmonella_phage	78.6	2.3e-54
WP_004247764.1|3361683_3361857_-	hypothetical protein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
WP_096043085.1|3361866_3362961_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.6	1.7e-144
WP_096043084.1|3362973_3363423_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	67.3	5.7e-46
WP_063073748.1|3363422_3364697_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	63.9	4.7e-154
WP_096043083.1|3364700_3365630_-|head	phage head morphogenesis protein	head	A0A1V0E5Q2	Salmonella_phage	55.0	1.7e-89
WP_063073746.1|3365580_3366936_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	64.4	2.7e-163
WP_063073745.1|3366935_3368180_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	74.2	3.2e-187
WP_063073744.1|3368160_3368601_-	hypothetical protein	NA	Q716H4	Shigella_phage	65.5	1.7e-42
WP_063073743.1|3368748_3368934_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	73.8	3.4e-21
WP_096043082.1|3368936_3369149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073741.1|3369246_3369933_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	76.8	1.3e-97
WP_096043081.1|3370373_3370826_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	81.2	2.8e-53
WP_036976899.1|3370827_3371160_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_004918415.1|3371146_3371440_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|3371436_3371826_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_096043080.1|3371961_3372729_-	KilA-N domain-containing protein	NA	G9BW66	Planktothrix_phage	35.0	1.3e-18
WP_036969493.1|3373270_3373774_-	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	88.0	4.0e-80
WP_063073738.1|3373770_3373962_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	95.2	6.6e-28
WP_063073737.1|3373951_3374317_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	64.1	1.3e-37
WP_063073736.1|3374313_3374604_-	DUF1364 domain-containing protein	NA	K7P6U2	Enterobacteria_phage	78.9	1.6e-38
WP_156868289.1|3374596_3374749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073735.1|3374841_3375291_-	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	95.3	4.5e-75
WP_063073734.1|3375412_3375637_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	1.4e-24
WP_096043079.1|3375633_3375993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043078.1|3375989_3376433_-	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	90.4	7.9e-32
WP_063073731.1|3376781_3377075_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.9	1.5e-18
WP_081213868.1|3377088_3377424_-	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.9	3.2e-25
WP_060556819.1|3377443_3378355_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.9	2.2e-97
WP_060556820.1|3378365_3379052_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	87.7	4.7e-108
WP_096043076.1|3379048_3379987_-	replication protein 15	NA	A0A1P8DTG2	Proteus_phage	52.6	1.8e-81
WP_096043075.1|3379983_3380667_-	phage regulatory protein/antirepressor Ant	NA	A0A1P8DTE1	Proteus_phage	94.7	2.0e-114
WP_063073726.1|3380688_3381021_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	99.1	3.5e-53
WP_063693416.1|3381223_3381451_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	68.0	4.9e-22
WP_063693278.1|3381559_3382258_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	48.6	5.4e-43
WP_063073724.1|3382587_3383412_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	41.0	9.5e-39
WP_096043074.1|3383720_3384311_+	Fis family transcriptional regulator	NA	C4ML07	Xanthomonas_virus	37.5	8.3e-21
WP_147383756.1|3384326_3384815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073722.1|3385007_3385196_+	hypothetical protein	NA	A0A068C8G2	Acinetobacter_phage	50.9	3.7e-07
WP_063073721.1|3385267_3385501_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	54.5	8.9e-11
WP_156868507.1|3385553_3386525_+	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	47.3	1.4e-20
WP_063073719.1|3386743_3386998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049199148.1|3386994_3387216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043073.1|3387212_3388139_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.6	1.2e-109
WP_049206325.1|3388178_3388799_+	hypothetical protein	NA	A0A068CBG2	Acinetobacter_phage	45.9	1.2e-25
WP_096043072.1|3388791_3389493_+	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	58.1	8.0e-71
WP_060558090.1|3390069_3390357_+	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	41.9	5.3e-13
WP_063073715.1|3390356_3390710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073714.1|3390719_3391088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156868475.1|3391235_3391403_+	hypothetical protein	NA	A0A1P8DTF6	Proteus_phage	96.2	1.5e-23
WP_096043071.1|3391395_3391752_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	33.9	2.3e-10
WP_096043070.1|3391738_3392341_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	57.6	7.9e-59
WP_096043068.1|3392776_3393934_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	74.3	4.4e-175
WP_017627899.1|3394222_3395095_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	36.8	9.7e-34
3393954:3394000	attR	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004244244.1|3395098_3395311_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004244246.1|3395947_3396889_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004244247.1|3396954_3398346_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
>prophage 11
NZ_CP017085	Proteus mirabilis strain T18 chromosome, complete genome	4131426	3666217	3675061	4131426		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3666217_3667786_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3668186_3668867_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3668963_3669539_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3669615_3670194_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3670261_3671287_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3671321_3671777_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_017628547.1|3671801_3672938_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004250201.1|3672938_3673523_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017628546.1|3673915_3675061_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	4.5e-31
>prophage 1
NZ_CP017086	Proteus mirabilis strain T18 plasmid pT18, complete sequence	59035	319	56086	59035	transposase,protease	Escherichia_phage(30.77%)	58	NA	NA
WP_001067855.1|319_1024_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014343468.1|1063_1537_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_013213985.1|1659_2640_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_004199234.1|2915_3797_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213989.1|5656_6082_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213990.1|6192_6471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161490.1|8013_8574_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|8577_11544_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_020319858.1|12617_12755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749973.1|12763_13480_+	StdB	NA	NA	NA	NA	NA
WP_000414913.1|13481_13850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048968061.1|14142_14376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749971.1|14486_14807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214483.1|14861_15041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129958.1|15767_16277_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_000932975.1|17163_17403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|17412_17817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447669.1|17874_18300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861760.1|18714_19155_+	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_001749980.1|19142_20408_+	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
WP_001452808.1|20558_21350_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_000057569.1|21364_21706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749982.1|22265_22985_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_001749988.1|23714_24284_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_001067855.1|24612_25317_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|25322_25463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|25948_26686_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|26682_26907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954592.1|27028_27205_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|27386_28391_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_042863651.1|28469_31436_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_001067855.1|31556_32261_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000205770.1|32505_33252_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	4.2e-09
WP_000139328.1|33306_33867_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_015059022.1|33998_34199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032083981.1|34584_35184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001736714.1|35347_35578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312851.1|35882_36032_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083837.1|36315_36564_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001375168.1|36808_36883_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_032495102.1|36875_37733_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|38671_39325_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|39417_39675_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|39607_40009_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|41319_42024_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013188475.1|42534_43410_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|43444_44413_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|46163_46868_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071557810.1|48539_48680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|48670_49375_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_012372818.1|49824_50580_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|50749_51610_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_064441864.1|51792_52329_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000957857.1|52420_52609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|53286_53991_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|54376_54793_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|54797_55316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|55381_56086_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
