The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017082	Proteus mirabilis strain T21, complete genome	4090879	680	25955	4090879	lysis,integrase	Proteus_phage(29.63%)	36	18209:18224	28300:28315
WP_004245970.1|680_1634_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.4e-126
WP_036907977.1|1647_2409_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	1.5e-67
WP_012367629.1|2520_3642_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.0	6.7e-104
WP_012367628.1|3638_5009_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.8	9.0e-119
WP_049195184.1|5008_6496_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.8	1.0e-264
WP_004245977.1|6498_7107_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.4e-65
WP_004245979.1|7289_7496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247494.1|7492_8077_-	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_049195183.1|8424_8886_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	4.4e-25
WP_017827434.1|9028_9499_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_026164644.1|9498_9768_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
WP_004247488.1|9821_10244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247148.1|10402_10924_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004245982.1|11235_11868_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
WP_004245983.1|11867_12224_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245984.1|12220_12511_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_049195179.1|12589_13039_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_049195176.1|14450_15218_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.0e-23
WP_049195174.1|15483_15831_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.0	3.2e-36
WP_004245989.1|15976_16186_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_004245990.1|16268_16952_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	98.2	1.5e-130
WP_004245991.1|16960_17302_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	62.8	2.1e-37
WP_004245992.1|17539_18061_+	hypothetical protein	NA	I6R9C4	Salmonella_phage	78.5	5.6e-61
18209:18224	attL	TAAAAATGGAATTAAA	NA	NA	NA	NA
WP_049195172.1|18808_19126_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	51.4	2.1e-18
WP_004245995.1|19140_19377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245996.1|19348_19630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245997.1|19973_20156_+	host cell division inhibitory peptide Kil	NA	A0A1P8DTH8	Proteus_phage	85.0	4.4e-21
WP_004245998.1|20283_20538_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	7.2e-38
WP_004246000.1|20534_21353_+	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	97.1	3.5e-158
WP_036907946.1|21345_22152_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	94.3	3.9e-138
WP_153274246.1|22657_22819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628829.1|23325_23778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628830.1|23829_24090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247455.1|24416_24755_+	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	5.6e-14
WP_012367595.1|24751_24997_+	excisionase	NA	NA	NA	NA	NA
WP_049195171.1|24953_25955_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	2.8e-69
28300:28315	attR	TTTAATTCCATTTTTA	NA	NA	NA	NA
>prophage 2
NZ_CP017082	Proteus mirabilis strain T21, complete genome	4090879	61860	73821	4090879		Mycobacterium_phage(25.0%)	12	NA	NA
WP_004246054.1|61860_63072_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
WP_026090527.1|63270_63534_+	YbeD family protein	NA	NA	NA	NA	NA
WP_004246056.1|63891_64536_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004246057.1|64637_65603_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246058.1|65618_65993_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246068.1|67061_67271_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246069.1|67468_67942_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246071.1|68223_68448_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246072.1|68459_68864_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004252248.1|68892_71019_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_012367584.1|71044_72013_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	5.9e-133
WP_096043046.1|72621_73821_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
>prophage 3
NZ_CP017082	Proteus mirabilis strain T21, complete genome	4090879	174069	227952	4090879	transposase,protease,tRNA	Bacillus_phage(33.33%)	34	NA	NA
WP_063073852.1|174069_174789_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017628334.1|175004_176045_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004244837.1|176075_176348_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_004244838.1|176410_177481_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A1P8CWQ1	Bacillus_phage	38.1	4.9e-11
WP_004247373.1|178151_178400_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.5	2.9e-07
WP_017628332.1|178619_178892_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004244841.1|179118_179388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244842.1|179391_179970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244844.1|180282_180987_-	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_017628331.1|180983_181538_-	type IV B pilus protein	NA	NA	NA	NA	NA
WP_012367549.1|183755_184616_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_004244852.1|186447_187218_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_107034653.1|188393_188501_+	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_017628327.1|188874_191037_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_026090469.1|191100_192429_+	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_017628325.1|192558_193236_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036894348.1|193503_194763_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017628323.1|194782_196945_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	6.2e-29
WP_001985440.1|196969_198223_-	TolC family protein	NA	NA	NA	NA	NA
WP_063073853.1|198327_205251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244870.1|205333_205639_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004244871.1|206280_207072_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004247357.1|207045_207903_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004244888.1|209159_210128_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_004247346.1|210246_211668_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_017628318.1|211693_214411_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_004244891.1|214403_215048_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_017628317.1|215104_216490_+	glycoporin	NA	NA	NA	NA	NA
WP_017628316.1|216858_218115_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_004244894.1|218108_218993_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_026090468.1|219457_221422_+|protease	metalloprotease	protease	NA	NA	NA	NA
WP_063073854.1|221728_223693_+|protease	metalloprotease	protease	NA	NA	NA	NA
WP_017628313.1|223923_225987_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_004244908.1|226476_227952_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP017082	Proteus mirabilis strain T21, complete genome	4090879	1309878	1371340	4090879	transposase	Escherichia_phage(22.22%)	51	NA	NA
WP_096043061.1|1309878_1310847_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	99.7	4.6e-186
WP_001339197.1|1310950_1312159_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_028697649.1|1312220_1312697_-	TnpR	NA	NA	NA	NA	NA
WP_000480968.1|1312803_1313640_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_096043062.1|1313639_1314443_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	28.7	1.6e-14
WP_001043265.1|1314503_1315319_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|1315626_1316478_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|1317233_1317938_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|1318088_1318904_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|1319093_1319798_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|1319844_1320246_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|1320395_1321256_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|1321840_1322545_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000656305.1|1325332_1325710_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096043063.1|1327688_1328705_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	7.0e-185
WP_000624711.1|1329068_1329419_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_000080195.1|1329449_1331063_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_032181455.1|1331542_1331968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271020.1|1331964_1332348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148641.1|1332513_1333083_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_072153745.1|1334673_1334952_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387788.1|1335046_1335649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043064.1|1336921_1338135_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_000241617.1|1339549_1340422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001069760.1|1340520_1341393_+	GTPase family protein	NA	NA	NA	NA	NA
WP_000820574.1|1341765_1344612_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001323397.1|1344682_1344841_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001535681.1|1344995_1345814_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.6e-46
WP_023145813.1|1346086_1346629_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	2.9e-12
WP_001535682.1|1346644_1347121_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|1347183_1347405_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001390338.1|1347567_1347945_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001094437.1|1347991_1348369_+	toxin	NA	NA	NA	NA	NA
WP_000761716.1|1348365_1348854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060589331.1|1348783_1349071_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001274561.1|1349155_1350001_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_017628609.1|1350543_1351578_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	7.4e-65
WP_004246668.1|1352625_1352946_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004246669.1|1353085_1353709_+	fimbrillin MatB	NA	NA	NA	NA	NA
WP_004246670.1|1353798_1354482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628610.1|1354504_1357000_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004249837.1|1357013_1358621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368584.1|1358713_1359391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628611.1|1359480_1360404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249835.1|1360595_1360865_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_017628612.1|1360857_1361796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628613.1|1361795_1364840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628614.1|1366109_1368281_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004249011.1|1368353_1368872_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_053828396.1|1369692_1370109_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.1e-43
WP_063693206.1|1370131_1371340_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.3	3.4e-186
>prophage 6
NZ_CP017082	Proteus mirabilis strain T21, complete genome	4090879	1967041	1975885	4090879		Caulobacter_phage(50.0%)	9	NA	NA
WP_017628546.1|1967041_1968187_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	4.5e-31
WP_004250201.1|1968579_1969164_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017628547.1|1969164_1970301_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004245607.1|1970325_1970781_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_004245605.1|1970815_1971841_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004249446.1|1971908_1972487_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245603.1|1972563_1973139_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_012368337.1|1973235_1973916_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245601.1|1974316_1975885_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
>prophage 7
NZ_CP017082	Proteus mirabilis strain T21, complete genome	4090879	2243761	2314298	4090879	lysis,head,terminase,integrase,holin,tRNA,tail	Salmonella_phage(18.06%)	95	2269205:2269240	2318782:2318817
WP_004244247.1|2243761_2245153_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
WP_004244246.1|2245218_2246160_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004244244.1|2246796_2247009_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_017627899.1|2247012_2247885_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	36.8	9.7e-34
WP_096043068.1|2248173_2249331_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	74.3	4.4e-175
WP_096043070.1|2249766_2250369_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	57.6	7.9e-59
WP_096043071.1|2250355_2250712_-	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	33.9	2.3e-10
WP_156868475.1|2250704_2250872_-	hypothetical protein	NA	A0A1P8DTF6	Proteus_phage	96.2	1.5e-23
WP_063073714.1|2251019_2251388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073715.1|2251397_2251751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558090.1|2251750_2252038_-	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	41.9	5.3e-13
WP_096043072.1|2252614_2253316_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	58.1	8.0e-71
WP_049206325.1|2253308_2253929_-	hypothetical protein	NA	A0A068CBG2	Acinetobacter_phage	45.9	1.2e-25
WP_096043073.1|2253968_2254895_-	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.6	1.2e-109
WP_049199148.1|2254891_2255113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073719.1|2255109_2255364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156868288.1|2255582_2256479_-	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	45.8	3.2e-16
WP_063073721.1|2256606_2256840_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	54.5	8.9e-11
WP_063073722.1|2256911_2257100_-	hypothetical protein	NA	A0A068C8G2	Acinetobacter_phage	50.9	3.7e-07
WP_147383756.1|2257292_2257781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043074.1|2257796_2258387_-	Fis family transcriptional regulator	NA	C4ML07	Xanthomonas_virus	37.5	8.3e-21
WP_063073724.1|2258695_2259520_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	41.0	9.5e-39
WP_063693278.1|2259849_2260548_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	48.6	5.4e-43
WP_063693416.1|2260656_2260884_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	68.0	4.9e-22
WP_063073726.1|2261086_2261419_+	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	99.1	3.5e-53
WP_096043075.1|2261440_2262124_+	phage regulatory protein/antirepressor Ant	NA	A0A1P8DTE1	Proteus_phage	94.7	2.0e-114
WP_096043076.1|2262120_2263059_+	replication protein 15	NA	A0A1P8DTG2	Proteus_phage	52.6	1.8e-81
WP_060556820.1|2263055_2263742_+	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	87.7	4.7e-108
WP_060556819.1|2263752_2264664_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.9	2.2e-97
WP_081213868.1|2264683_2265019_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.9	3.2e-25
WP_063073731.1|2265032_2265326_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.9	1.5e-18
WP_096043077.1|2265442_2265661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043078.1|2265674_2266118_+	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	90.4	7.9e-32
WP_096043079.1|2266114_2266474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073734.1|2266470_2266695_+	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	1.4e-24
WP_063073735.1|2266816_2267266_+	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	95.3	4.5e-75
WP_156868289.1|2267358_2267511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073736.1|2267503_2267794_+	DUF1364 domain-containing protein	NA	K7P6U2	Enterobacteria_phage	78.9	1.6e-38
WP_063073737.1|2267790_2268156_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	64.1	1.3e-37
WP_063073738.1|2268145_2268337_+	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	95.2	6.6e-28
WP_036969493.1|2268333_2268837_+	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	88.0	4.0e-80
2269205:2269240	attL	TTGATATTTATCCAGAGTGCTTATTTGCATTGTGGT	NA	NA	NA	NA
WP_096043080.1|2269378_2270146_+	KilA-N domain-containing protein	NA	G9BW66	Planktothrix_phage	35.0	1.3e-18
WP_004916901.1|2270281_2270671_+	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_004918415.1|2270667_2270961_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_036976899.1|2270947_2271280_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_096043081.1|2271281_2271734_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	81.2	2.8e-53
WP_063073741.1|2272174_2272861_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	76.8	1.3e-97
WP_096043082.1|2272958_2273171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073743.1|2273173_2273359_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	73.8	3.4e-21
WP_063073744.1|2273506_2273947_+	hypothetical protein	NA	Q716H4	Shigella_phage	65.5	1.7e-42
WP_063073745.1|2273927_2275172_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	74.2	3.2e-187
WP_063073746.1|2275171_2276527_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	64.4	2.7e-163
WP_096043083.1|2276477_2277407_+|head	phage head morphogenesis protein	head	A0A1V0E5Q2	Salmonella_phage	55.0	1.7e-89
WP_063073748.1|2277410_2278685_+	hypothetical protein	NA	G0ZND7	Cronobacter_phage	63.9	4.7e-154
WP_096043084.1|2278684_2279134_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	67.3	5.7e-46
WP_096043085.1|2279146_2280241_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.6	1.7e-144
WP_004247764.1|2280250_2280424_+	hypothetical protein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
WP_096043086.1|2280481_2280880_+	hypothetical protein	NA	I6S619	Salmonella_phage	78.6	2.3e-54
WP_094960237.1|2280879_2281221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043087.1|2281222_2281594_+	hypothetical protein	NA	G0ZNE3	Cronobacter_phage	65.0	1.1e-39
WP_096043088.1|2281590_2281959_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	30.3	1.1e-10
WP_096043089.1|2282023_2282779_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	78.9	2.8e-106
WP_096043090.1|2282828_2283518_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	72.4	1.1e-91
WP_049199087.1|2283768_2284551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049199086.1|2284541_2284949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043091.1|2285065_2285884_-	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	62.3	8.8e-37
WP_096043114.1|2285880_2286636_-	DNA-binding protein	NA	A0A2H4JDP7	uncultured_Caudovirales_phage	43.7	2.0e-35
WP_096043092.1|2286709_2286877_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	46.3	4.0e-05
WP_096043093.1|2286996_2287329_+	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	80.9	8.5e-15
WP_096043094.1|2287384_2287795_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	45.3	1.1e-19
WP_096043095.1|2287821_2288367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043096.1|2288435_2291828_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	41.0	1.9e-162
WP_096043097.1|2291831_2292308_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	71.6	7.3e-60
WP_096043098.1|2292307_2292778_+	DUF1833 domain-containing protein	NA	F1C5F1	Cronobacter_phage	51.3	2.0e-41
WP_096043099.1|2292774_2293167_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	57.9	3.6e-44
WP_096043100.1|2293153_2295622_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	51.6	9.5e-252
WP_096043101.1|2295680_2297969_+	SGNH/GDSL hydrolase family protein	NA	A0A291AXF7	Shigella_phage	56.1	1.0e-45
WP_096043102.1|2298033_2298264_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	93.4	5.3e-32
WP_046334704.1|2298648_2299860_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
WP_036918892.1|2301040_2301238_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	46.3	2.3e-07
WP_036918890.1|2301237_2301633_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	2.1e-28
WP_046334703.1|2301645_2302479_+	antA/AntB antirepressor family protein	NA	A0A088CBR4	Shigella_phage	46.1	1.4e-21
WP_072052191.1|2303408_2303582_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_046334702.1|2303584_2303842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036918882.1|2303838_2304018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907509.1|2304014_2304224_+	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_046334701.1|2304220_2304832_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	46.3	3.3e-20
WP_036900272.1|2305001_2305196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052715532.1|2305195_2305792_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.2	6.4e-29
WP_046334700.1|2305806_2306151_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.1	1.4e-44
WP_096043103.1|2306147_2308868_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.1	0.0e+00
WP_036918875.1|2309852_2310365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072271821.1|2310536_2310710_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036918873.1|2310709_2311051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052715531.1|2311067_2314298_+	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	42.0	1.8e-101
2318782:2318817	attR	ACCACAATGCAAATAAGCACTCTGGATAAATATCAA	NA	NA	NA	NA
>prophage 8
NZ_CP017082	Proteus mirabilis strain T21, complete genome	4090879	2790908	2809711	4090879	holin,lysis	Burkholderia_phage(21.43%)	21	NA	NA
WP_004243640.1|2790908_2791724_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
WP_004248367.1|2792104_2792404_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_017628006.1|2792406_2792811_+	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_017628007.1|2792807_2793257_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_004248364.1|2793293_2793806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628008.1|2793814_2795302_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_012368088.1|2795312_2795765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243627.1|2795824_2796283_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_017628009.1|2796365_2798669_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	1.6e-14
WP_004250719.1|2798671_2799160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243623.1|2799172_2799493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243622.1|2799461_2800274_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243621.1|2800276_2800969_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243617.1|2800965_2801310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628010.1|2801302_2802490_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_017628011.1|2802486_2803143_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_017628013.1|2804457_2804637_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004243612.1|2805205_2805748_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_004243611.1|2805863_2806640_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243609.1|2806643_2807261_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_012368081.1|2807272_2809711_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
>prophage 9
NZ_CP017082	Proteus mirabilis strain T21, complete genome	4090879	2998168	3031890	4090879	holin,tail,terminase	Escherichia_phage(22.22%)	39	NA	NA
WP_063073778.1|2998168_2998423_-	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	35.2	4.7e-05
WP_063073779.1|2998467_2999550_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	55.7	2.8e-107
WP_063073780.1|2999595_3001320_-	DNA breaking-rejoining protein	NA	A0A0U2I1R6	Escherichia_phage	47.2	2.1e-112
WP_004243373.1|3001716_3002325_-	hypothetical protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
WP_064505757.1|3002402_3002681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073781.1|3002822_3003044_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	48.3	1.1e-10
WP_049211516.1|3003045_3003981_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	57.6	2.4e-70
WP_049211513.1|3003949_3004432_+	replication protein	NA	NA	NA	NA	NA
WP_063073782.1|3004654_3005068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073783.1|3005064_3005460_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	6.8e-35
WP_063073784.1|3005507_3005783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073785.1|3005804_3006230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073786.1|3006222_3006564_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	58.3	1.3e-29
WP_063073787.1|3006592_3007243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073788.1|3007289_3007859_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	50.3	2.6e-43
WP_063073789.1|3007858_3009343_+	hypothetical protein	NA	G9L6B8	Escherichia_phage	77.6	4.7e-230
WP_004243356.1|3009528_3009741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073790.1|3009750_3011415_+|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	65.6	2.4e-198
WP_004243354.1|3011411_3011726_+	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
WP_063073791.1|3011743_3012421_+	peptidase	NA	T1SAP9	Salmonella_phage	64.3	6.8e-43
WP_063073792.1|3012436_3013417_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	60.3	1.7e-111
WP_060555916.1|3013475_3013907_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	1.4e-30
WP_063073793.1|3013915_3014257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073794.1|3014309_3014915_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.2	2.5e-65
WP_063073795.1|3014914_3017377_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.0	0.0e+00
WP_063073796.1|3017360_3017849_+	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	59.2	3.0e-48
WP_063073797.1|3017848_3018397_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	2.0e-45
WP_063073798.1|3018399_3021483_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	50.6	7.1e-164
WP_063073799.1|3021482_3024866_+	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	36.0	1.2e-183
WP_063073800.1|3024876_3025179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036976793.1|3025175_3025490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036976792.1|3025518_3025770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073801.1|3025943_3028130_+	hypothetical protein	NA	A0A193GYU1	Enterobacter_phage	58.3	7.7e-88
WP_020945795.1|3028215_3028587_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	3.9e-16
WP_004243326.1|3028583_3028856_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	38.9	1.9e-12
WP_063073802.1|3028858_3029203_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	83.3	2.9e-42
WP_063073803.1|3029202_3029697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628042.1|3030074_3030854_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.3	1.4e-31
WP_004243319.1|3030837_3031890_+	nucleotidyltransferase	NA	A0A067XQU1	Caulobacter_phage	23.1	1.6e-06
>prophage 10
NZ_CP017082	Proteus mirabilis strain T21, complete genome	4090879	3622313	3638960	4090879	lysis,head,terminase,protease,capsid,portal,tail	Salmonella_phage(12.5%)	23	NA	NA
WP_004251558.1|3622313_3622712_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
WP_004251562.1|3622743_3623049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251564.1|3623060_3623642_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	2.4e-52
WP_004251569.1|3623641_3624238_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	4.6e-51
WP_036905771.1|3624238_3627514_-|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	45.6	6.4e-54
WP_004242485.1|3627640_3627832_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_036894769.1|3627856_3628135_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004251577.1|3628131_3628548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251580.1|3628612_3629278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251583.1|3629287_3629629_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_004251585.1|3629634_3630108_-	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
WP_004251588.1|3630097_3630427_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_004251590.1|3630426_3630726_-	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	64.3	2.8e-33
WP_004251594.1|3630764_3631931_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	5.6e-170
WP_004251596.1|3631934_3632603_-|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.1e-82
WP_012367784.1|3632620_3633889_-|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	5.1e-201
WP_036969710.1|3633888_3635622_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.5	6.9e-148
WP_036905779.1|3635575_3636043_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
WP_036905782.1|3636166_3636379_-	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.1e-07
WP_001967215.1|3636381_3636720_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_036905787.1|3637616_3638078_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
WP_036900946.1|3638220_3638691_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_036905789.1|3638690_3638960_-	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
>prophage 11
NZ_CP017082	Proteus mirabilis strain T21, complete genome	4090879	3643264	3654379	4090879	integrase	Morganella_phage(28.57%)	16	3638487:3638500	3653972:3653985
3638487:3638500	attL	TTTGTAATAACGCA	NA	NA	NA	NA
WP_004247137.1|3643264_3643477_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247136.1|3643819_3644218_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
WP_004247135.1|3644245_3645271_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
WP_004247134.1|3645270_3645978_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_004247133.1|3646149_3647241_-	hypothetical protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
WP_063108983.1|3647253_3647433_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	53.4	6.8e-11
WP_004247130.1|3647721_3648180_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	3.9e-26
WP_004247129.1|3648264_3648504_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
WP_004247128.1|3648607_3649090_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
WP_004247127.1|3649532_3649715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247126.1|3649738_3650113_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_004247125.1|3650178_3651006_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_004247124.1|3651062_3651593_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
WP_004251672.1|3651654_3651897_+	excisionase	NA	NA	NA	NA	NA
WP_004251675.1|3651877_3653005_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.6	3.7e-126
WP_004247120.1|3653125_3654379_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
3653972:3653985	attR	TTTGTAATAACGCA	NA	NA	NA	NA
>prophage 12
NZ_CP017082	Proteus mirabilis strain T21, complete genome	4090879	3765021	3823279	4090879	transposase,protease,integrase,plate,tRNA	uncultured_Caudovirales_phage(33.33%)	50	3771695:3771711	3814320:3814336
WP_017628411.1|3765021_3766764_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_004244680.1|3766847_3767366_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_004244679.1|3767681_3767852_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_004244678.1|3768340_3768745_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_017628412.1|3768832_3769405_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_004244676.1|3769404_3771057_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_012367738.1|3771049_3772339_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
3771695:3771711	attL	TTCAATTTTAGGATAAG	NA	NA	NA	NA
WP_004244674.1|3772431_3774363_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	4.3e-50
WP_004247681.1|3774369_3776484_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_049194712.1|3776593_3777736_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_012367736.1|3778002_3778554_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_004251935.1|3778768_3779779_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_004247678.1|3780135_3781167_+	DUF1016 domain-containing protein	NA	NA	NA	NA	NA
WP_017628415.1|3781328_3783944_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.6	5.7e-21
WP_004244666.1|3784285_3785500_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.7	1.6e-42
WP_017827340.1|3785514_3785706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244664.1|3785779_3787180_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.4	1.5e-81
WP_121909311.1|3787524_3788637_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.3	1.3e-96
WP_004244662.1|3788989_3790180_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_156868377.1|3790311_3790467_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_049194410.1|3790604_3791567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244657.1|3792460_3793075_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_049195263.1|3793842_3794160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194413.1|3794409_3795327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155289805.1|3795399_3795549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247666.1|3795728_3796292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157677991.1|3796499_3796892_+	helix-turn-helix domain-containing protein	NA	A0A2L1IVA1	Escherichia_phage	46.5	2.2e-09
WP_155722981.1|3796816_3797335_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_046335376.1|3797400_3797805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000326.1|3797801_3798311_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	55.0	1.7e-14
WP_049195076.1|3799181_3799592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101495335.1|3799591_3800341_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	59.4	1.2e-29
WP_152964539.1|3800551_3800692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195253.1|3800853_3801321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335381.1|3801320_3801584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194460.1|3802390_3802846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894566.1|3803651_3804119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195080.1|3804345_3804957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063693455.1|3804984_3809685_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	42.9	3.0e-28
WP_004251951.1|3809749_3810169_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_053828341.1|3810180_3812373_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004246976.1|3812456_3812975_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004247653.1|3814872_3815373_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
3814320:3814336	attR	CTTATCCTAAAATTGAA	NA	NA	NA	NA
WP_063073902.1|3815393_3816872_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004244624.1|3816877_3817309_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_049194445.1|3817316_3819092_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_049194444.1|3819055_3820093_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004247648.1|3820097_3821366_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_063073901.1|3821367_3821919_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004244618.1|3821911_3823279_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 13
NZ_CP017082	Proteus mirabilis strain T21, complete genome	4090879	4077794	4090305	4090879	tail	Cronobacter_phage(50.0%)	18	NA	NA
WP_036976694.1|4077794_4078382_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	58.9	7.2e-57
WP_049195341.1|4078378_4079089_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	66.4	1.8e-86
WP_049195343.1|4079085_4079829_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.8	2.6e-88
WP_049195345.1|4079825_4080167_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_004245944.1|4080310_4080511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195346.1|4080530_4080821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247512.1|4080860_4081073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195348.1|4081095_4084035_-|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	34.0	1.3e-133
WP_053089294.1|4084095_4084917_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	50.9	2.3e-21
WP_049195350.1|4085042_4085276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064971710.1|4085343_4085616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195351.1|4085728_4086130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195353.1|4086282_4086672_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049195354.1|4086836_4087673_+	antirepressor	NA	I6S627	Salmonella_phage	59.6	1.3e-72
WP_049195202.1|4087944_4088433_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_049195199.1|4088989_4089277_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	6.9e-13
WP_049195198.1|4089291_4089597_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	8.7e-22
WP_004247505.1|4089648_4090305_-	hypothetical protein	NA	G8C7Q3	Escherichia_phage	57.7	8.6e-59
>prophage 1
NZ_CP017084	Proteus mirabilis strain T21 plasmid pT212, complete sequence	171489	0	34896	171489	integrase,transposase	Salmonella_phage(45.45%)	36	433:445	11477:11489
433:445	attL	ACGAAACGCAACA	NA	NA	NA	NA
WP_000259026.1|975_1947_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_013362812.1|2237_3206_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_085281207.1|3149_3587_+|transposase	transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	4.5e-40
WP_001617865.1|3836_4712_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_013362812.1|4746_5715_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_014342221.1|7787_8702_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000139717.1|9028_9520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997323.1|9516_10386_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000543934.1|10390_11401_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|11403_11940_-	hypothetical protein	NA	NA	NA	NA	NA
11477:11489	attR	TGTTGCGTTTCGT	NA	NA	NA	NA
WP_000932880.1|11932_12220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|12238_12559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|12781_13384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|13399_13852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243483.1|14018_14354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000750746.1|14365_14608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787563.1|14612_14885_-	MafI family immunity protein	NA	NA	NA	NA	NA
WP_001257734.1|14881_19144_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.4	5.8e-23
WP_000988732.1|19276_20002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337692.1|20115_20517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|20736_20976_-	permease	NA	NA	NA	NA	NA
WP_000268337.1|21048_21327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|21313_23041_-	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_001077335.1|23218_23605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|24062_24914_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_000064431.1|24988_25546_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_000260293.1|25619_25838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000184110.1|25851_26121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|26113_26719_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000050848.1|26790_26994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187970.1|27195_29649_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_096043117.1|29799_30946_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	7.8e-148
WP_000042274.1|30968_31355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093868.1|31587_32142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015058950.1|32215_32692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088845919.1|33682_34896_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	1.8e-166
>prophage 2
NZ_CP017084	Proteus mirabilis strain T21 plasmid pT212, complete sequence	171489	44881	49517	171489		Mycobacterium_phage(25.0%)	5	NA	NA
WP_000706865.1|44881_45892_-	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
WP_001282585.1|45954_46944_-	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000987165.1|47038_47569_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
WP_000739139.1|47629_48538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085162.1|48548_49517_-	AAA domain-containing protein	NA	L7TKP0	Rhizobium_phage	32.6	2.8e-29
>prophage 3
NZ_CP017084	Proteus mirabilis strain T21 plasmid pT212, complete sequence	171489	81668	84755	171489		Streptococcus_phage(50.0%)	3	NA	NA
WP_000366822.1|81668_83861_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	1.7e-42
WP_000468105.1|83875_84364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542259.1|84455_84755_-	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
>prophage 4
NZ_CP017084	Proteus mirabilis strain T21 plasmid pT212, complete sequence	171489	88188	98929	171489		Colwellia_phage(16.67%)	16	NA	NA
WP_000647189.1|88188_88689_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
WP_000348669.1|88697_89030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005507681.1|89014_89446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344151.1|89513_90188_-	thymidylate kinase	NA	NA	NA	NA	NA
WP_000044824.1|90162_90444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125905.1|90436_90814_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_000939033.1|91132_91276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074431.1|91367_92003_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000703827.1|92055_92328_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|92376_93558_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|93561_94347_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_000338945.1|94520_94832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|95138_95954_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|96014_96818_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|96817_97654_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000027057.1|98068_98929_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 5
NZ_CP017084	Proteus mirabilis strain T21 plasmid pT212, complete sequence	171489	104978	118731	171489	integrase,transposase	Salmonella_phage(42.86%)	10	104132:104145	107731:107744
104132:104145	attL	AATGCCGTTTGAAT	NA	NA	NA	NA
WP_001067855.1|104978_105683_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|105957_106971_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|107115_107613_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|107724_108015_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
107731:107744	attR	ATTCAAACGGCATT	NA	NA	NA	NA
WP_001206356.1|108020_108812_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_013362812.1|109123_110092_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001161490.1|112159_112720_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|112723_115690_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_000101568.1|115892_116933_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000811656.1|117219_118731_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
>prophage 6
NZ_CP017084	Proteus mirabilis strain T21 plasmid pT212, complete sequence	171489	126059	129806	171489		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000356489.1|126059_126332_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
WP_000790610.1|126331_126865_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000891157.1|126875_127484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020646.1|127480_128032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|128091_128511_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000919078.1|128512_128806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000077458.1|128822_129806_-	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
>prophage 7
NZ_CP017084	Proteus mirabilis strain T21 plasmid pT212, complete sequence	171489	133709	134825	171489		unidentified_phage(100.0%)	1	NA	NA
WP_014342195.1|133709_134825_-	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	28.9	1.4e-45
>prophage 8
NZ_CP017084	Proteus mirabilis strain T21 plasmid pT212, complete sequence	171489	138466	144321	171489		Wolbachia_phage(25.0%)	10	NA	NA
WP_001326179.1|138466_139444_+	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
WP_000139698.1|139459_140320_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000591074.1|140353_140782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422768.1|140838_141198_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000919345.1|141197_141644_+	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_000210756.1|141640_142159_+	nitrite reductase	NA	NA	NA	NA	NA
WP_096043120.1|142158_142389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167032.1|142375_143233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236377.1|143463_143991_+	thermonuclease family protein	NA	O64020	Bacillus_phage	37.0	1.3e-09
WP_001043047.1|144048_144321_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
>prophage 9
NZ_CP017084	Proteus mirabilis strain T21 plasmid pT212, complete sequence	171489	147950	151943	171489		Pseudomonas_phage(50.0%)	4	NA	NA
WP_000286591.1|147950_148412_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
WP_000062185.1|148414_148912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434071.1|149473_150406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280522.1|150479_151943_+	AAA family ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
>prophage 10
NZ_CP017084	Proteus mirabilis strain T21 plasmid pT212, complete sequence	171489	159433	166259	171489	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_000792636.1|159433_159967_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_002210549.1|161316_161658_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	7.3e-62
WP_001067855.1|161694_162399_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|162517_163333_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|163445_164150_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012372818.1|164461_165217_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_014342204.1|165297_165846_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_099147893.1|165866_166259_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.5e-22
