The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023366	Escherichia coli strain 1428 chromosome, complete genome	4986712	1792190	1801632	4986712		Enterobacteria_phage(85.71%)	10	NA	NA
WP_022645872.1|1792190_1793117_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
WP_022645871.1|1793121_1793853_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1793833_1793941_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1794000_1794732_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|1794953_1796639_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_012311742.1|1796635_1797355_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1797401_1797872_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1797912_1798374_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_022645869.1|1798498_1800499_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001329822.1|1800495_1801632_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 2
NZ_CP023366	Escherichia coli strain 1428 chromosome, complete genome	4986712	2368431	2437418	4986712	integrase,terminase,protease,lysis,portal,tail	Enterobacteria_phage(41.51%)	82	2376007:2376023	2406748:2406764
WP_001260849.1|2368431_2369253_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2369352_2369436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|2369528_2369864_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2370260_2371514_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2371620_2372514_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225257.1|2372648_2373869_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2373993_2374689_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071586384.1|2374641_2375934_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2376007:2376023	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_021516105.1|2376092_2376707_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
WP_000526500.1|2376749_2377604_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2377605_2378223_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072146081.1|2378233_2380657_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	2.2e-208
WP_022645727.1|2380717_2383144_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001295396.1|2383342_2383648_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|2383755_2384466_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2384468_2385029_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2385063_2385405_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001304355.1|2385539_2385866_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_001295394.1|2386071_2387286_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_096040715.1|2387297_2388317_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2388374_2388503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|2388504_2389785_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001296941.1|2389819_2390056_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_024946566.1|2390143_2392615_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001090200.1|2392707_2392899_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001317853.1|2392895_2393084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000159335.1|2393586_2393787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001320327.1|2393755_2394121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2394132_2394285_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|2394477_2394885_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2394962_2395190_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2395173_2395695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054505.1|2395675_2396641_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
WP_001151189.1|2396681_2397083_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_022645725.1|2397282_2398305_+	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
WP_001546200.1|2399167_2399275_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000887491.1|2399319_2399532_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|2399748_2400000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140164.1|2400066_2400345_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001376415.1|2400346_2401396_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	6.5e-109
WP_000904111.1|2401408_2401765_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_000762886.1|2401779_2402601_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_000562553.1|2403496_2403628_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506936.1|2403994_2404423_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2404594_2404969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839562.1|2405220_2405436_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_096040716.1|2405440_2405752_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	61.6	3.2e-24
WP_001092966.1|2405748_2406282_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|2406278_2406776_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2406748:2406764	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000066495.1|2407139_2407352_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|2407362_2407551_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2407698_2407854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2408026_2408200_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2408495_2408702_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_096040717.1|2409254_2409749_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	98.8	6.4e-83
WP_000934102.1|2409748_2411851_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_001072975.1|2411847_2412060_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985958.1|2412059_2413568_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001136588.1|2413512_2415540_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|2415625_2415949_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_022645721.1|2415941_2416217_+	phage protein	NA	K7PH43	Enterobacteria_phage	98.9	3.8e-45
WP_000677120.1|2416228_2416819_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_001079410.1|2416815_2417217_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
WP_022645720.1|2417227_2417971_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
WP_001370402.1|2418031_2418418_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_063815218.1|2418426_2418744_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	4.4e-53
WP_022645718.1|2418727_2421793_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_000447253.1|2421792_2422122_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152382.1|2422131_2422830_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_024946565.1|2422835_2423579_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
WP_023277304.1|2423476_2424124_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_022645716.1|2424184_2427664_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_096040718.1|2427731_2428331_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	4.4e-102
WP_001546831.1|2428395_2430768_+|tail	phage tail fiber protein	tail	A0A0E3M0V5	Enterobacteria_phage	47.5	4.1e-103
WP_001546830.1|2430764_2431043_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	54.3	3.8e-24
WP_001546829.1|2431053_2432094_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	80.5	4.5e-155
WP_001546828.1|2432136_2432430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|2432657_2433248_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2433564_2433798_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2433866_2433980_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347484.1|2434584_2435868_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527788.1|2435957_2437418_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.6e-43
>prophage 3
NZ_CP023366	Escherichia coli strain 1428 chromosome, complete genome	4986712	2611617	2664763	4986712	integrase,lysis,tRNA,terminase,tail	Escherichia_phage(52.0%)	60	2630862:2630877	2670364:2670379
WP_001326214.1|2611617_2612658_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	84.1	1.6e-160
WP_000654166.1|2612667_2612949_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	3.1e-18
WP_094970784.1|2612948_2615324_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_094970783.1|2615388_2615988_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	6.3e-101
WP_096040721.1|2616055_2619451_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.0	0.0e+00
WP_072617264.1|2619511_2620159_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	2.5e-111
WP_096040722.1|2620056_2620800_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	8.3e-143
WP_096040723.1|2620805_2621504_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.3	5.4e-128
WP_000024051.1|2621503_2621842_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_000840623.1|2621834_2625068_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.3	8.7e-104
WP_122988492.1|2625539_2625899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2626049_2627012_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000673077.1|2627038_2627431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029819.1|2627427_2627808_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
WP_000524260.1|2627808_2628192_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|2628191_2628587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918487.1|2628809_2629949_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000770042.1|2630047_2630812_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
2630862:2630877	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001363932.1|2630916_2632029_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_095652189.1|2632012_2633419_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	5.2e-186
WP_000625348.1|2633421_2634723_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_095652190.1|2634703_2635798_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	1.3e-112
WP_000126788.1|2635801_2636011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204035.1|2635988_2636921_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_001291093.1|2636913_2637705_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_024165216.1|2637842_2639300_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2639496_2639682_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000992105.1|2639898_2640432_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_000370551.1|2640537_2640810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193293.1|2640775_2641120_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000839599.1|2641124_2641340_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_062875822.1|2642635_2643178_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.6	3.7e-76
WP_000228032.1|2643174_2643465_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000940344.1|2643464_2644064_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_001445776.1|2644931_2645273_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001445775.1|2645355_2645481_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
WP_000200358.1|2646003_2646777_+	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_000137958.1|2646897_2647401_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
WP_143190077.1|2647999_2648761_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.1	5.9e-120
WP_000788968.1|2648783_2649530_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000899746.1|2649536_2650394_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693802.1|2650406_2650829_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_001072343.1|2650825_2651080_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233320.1|2651159_2651579_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000233808.1|2651869_2652004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2652014_2652170_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_010377803.1|2652166_2652655_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2653096_2653318_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2653317_2653488_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2653562_2653838_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_049143878.1|2653939_2656540_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.9e-248
WP_000166319.1|2656532_2657342_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2657398_2657593_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2657585_2657795_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2657873_2658089_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2658090_2659326_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157407.1|2659377_2660313_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_022645642.1|2660441_2661815_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.1e-52
WP_000387388.1|2662292_2663276_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2663530_2664763_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2670364:2670379	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
>prophage 4
NZ_CP023366	Escherichia coli strain 1428 chromosome, complete genome	4986712	3529869	3584047	4986712	integrase,lysis,terminase,transposase,protease,capsid,tail,head,portal	Enterobacteria_phage(60.38%)	67	3538278:3538324	3584061:3584107
WP_022645324.1|3529869_3531006_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_022645323.1|3531203_3533441_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_063815185.1|3533427_3536400_+	phage receptor	NA	NA	NA	NA	NA
WP_022645321.1|3536400_3537291_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177457.1|3537473_3538235_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
3538278:3538324	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|3538747_3539701_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3539949_3540699_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355602.1|3541374_3541668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001353819.1|3541710_3542751_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.3	1.4e-124
WP_000654143.1|3542760_3543042_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_000290529.1|3543038_3545384_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
WP_096040736.1|3545442_3548922_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_071597161.1|3548982_3549615_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.4e-95
WP_022645608.1|3549551_3550295_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	2.9e-143
WP_001152612.1|3550299_3550998_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847401.1|3550997_3551327_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_077737833.1|3551323_3553885_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	89.6	0.0e+00
WP_000459458.1|3553877_3554312_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000479193.1|3554293_3554716_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_001317730.1|3554731_3555472_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_021550753.1|3555479_3555875_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	97.7	8.5e-70
WP_001398561.1|3555871_3556450_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
WP_000752960.1|3556461_3556815_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000158868.1|3556826_3557222_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_032140162.1|3557263_3558289_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	3.8e-186
WP_001338090.1|3558344_3558677_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_022645599.1|3558686_3560006_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	8.1e-234
WP_077737832.1|3559986_3561588_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	3.2e-309
WP_000198149.1|3561584_3561791_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_022645597.1|3561787_3563713_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000453611.1|3563687_3564233_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001415975.1|3564621_3564816_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|3565176_3565470_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3565560_3565743_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|3565959_3566457_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|3566456_3566672_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737280.1|3567244_3568342_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_001204791.1|3568531_3568915_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3569000_3569141_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3569137_3569500_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|3569496_3569787_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|3569779_3569950_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|3569949_3570405_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|3570401_3570503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3570619_3571417_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|3571426_3571978_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|3572442_3573969_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|3574026_3574176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|3574223_3574556_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145916.1|3574623_3574926_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	98.9	2.7e-44
WP_000788884.1|3574922_3575624_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	100.0	3.4e-130
WP_001397823.1|3575620_3576550_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.6	6.1e-111
WP_001182868.1|3576636_3577176_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	7.5e-61
WP_001067459.1|3577245_3577476_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_000858975.1|3577580_3578270_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001226567.1|3578499_3578880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157732837.1|3579276_3579567_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.6	1.9e-26
WP_000995455.1|3579642_3579939_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	8.1e-49
WP_000100847.1|3579944_3580730_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_077737862.1|3580726_3581407_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	6.0e-132
WP_000149544.1|3581403_3581586_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548530.1|3581558_3581750_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001386642.1|3581760_3582042_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|3582140_3582359_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3582406_3582685_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|3582656_3583028_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_001299447.1|3582883_3584047_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
3584061:3584107	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 5
NZ_CP023366	Escherichia coli strain 1428 chromosome, complete genome	4986712	3872441	3938265	4986712	plate,tRNA,transposase,protease	Shigella_phage(11.11%)	57	NA	NA
WP_096040744.1|3872441_3873654_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_001142958.1|3873841_3874360_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_023909030.1|3874486_3874645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037391.1|3875056_3875557_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_022645217.1|3875591_3875816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645216.1|3875866_3877342_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_022645215.1|3877348_3877762_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_022645214.1|3877765_3879616_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_063815230.1|3879579_3880662_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113710.1|3880686_3881967_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3881963_3882488_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_022645212.1|3882490_3883822_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_022645211.1|3883826_3884588_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_022645210.1|3884596_3887356_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.0	7.2e-83
WP_022645209.1|3887352_3888096_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_022645208.1|3888100_3889516_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122988716.1|3889624_3893059_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_022645206.1|3893069_3894422_+	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_022645205.1|3894445_3894928_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_022645204.1|3894971_3895880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645203.1|3895894_3896362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063815232.1|3896511_3897297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001308374.1|3897831_3898563_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|3898627_3899095_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308373.1|3899091_3899814_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052732.1|3899847_3900603_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3900674_3902033_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211702.1|3902080_3902851_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3902927_3903728_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648568.1|3903968_3904883_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022645201.1|3904879_3905683_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
WP_001140178.1|3911451_3912024_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593991.1|3912211_3913243_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3913235_3913889_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3913928_3914744_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3914861_3915266_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094006.1|3915262_3915970_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_022645200.1|3916080_3917799_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_022645199.1|3917851_3918676_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239184.1|3918831_3919542_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635528.1|3919555_3919978_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185283.1|3919974_3920520_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3920685_3920886_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062318.1|3920872_3921133_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_022645198.1|3921181_3922480_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3922544_3922934_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020966.1|3922990_3925132_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055746.1|3925230_3926190_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3926202_3929685_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_022645197.1|3929721_3930318_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_022645196.1|3930314_3931463_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3931462_3932251_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3932254_3932710_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|3932814_3933840_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3933843_3934329_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3934450_3936883_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_022645195.1|3936912_3938265_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 6
NZ_CP023366	Escherichia coli strain 1428 chromosome, complete genome	4986712	4272966	4316096	4986712	transposase	Shigella_phage(25.0%)	34	NA	NA
WP_085947772.1|4272966_4274180_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001535681.1|4274806_4275625_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.6e-46
WP_001323397.1|4275779_4275938_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_085947772.1|4276806_4278019_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001069760.1|4280760_4281633_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001297234.1|4282863_4284348_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000813451.1|4284669_4285272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322501.1|4285366_4285645_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000221515.1|4287096_4287666_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|4287925_4288327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|4288314_4288749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|4289103_4289484_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|4289480_4289828_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998017.1|4289877_4291263_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.5	6.9e-260
WP_000823243.1|4291501_4292860_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937736.1|4293238_4293430_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_000555337.1|4293592_4293850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4295600_4296122_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_001068910.1|4296118_4297072_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_074472007.1|4297158_4299483_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879155.1|4299527_4300430_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|4300426_4301425_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_074472008.1|4301421_4302378_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.8	1.4e-17
WP_000175457.1|4302378_4303146_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4303702_4303960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|4305218_4306370_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001293436.1|4307426_4309424_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625671.1|4309486_4309900_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085948656.1|4309834_4311002_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000254999.1|4311315_4311573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594405.1|4311625_4311751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611568.1|4311793_4312912_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000179691.1|4312923_4314141_-	MFS transporter	NA	NA	NA	NA	NA
WP_000547191.1|4314767_4316096_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP023366	Escherichia coli strain 1428 chromosome, complete genome	4986712	4524050	4595597	4986712	integrase,lysis,plate,tRNA,terminase,holin,transposase,capsid,protease,tail,head,portal	Shigella_phage(54.55%)	83	4527316:4527332	4599314:4599330
WP_000399648.1|4524050_4525031_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000789589.1|4525410_4526724_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_000812977.1|4527065_4527662_-	heme lyase NrfEFG subunit NrfG	NA	NA	NA	NA	NA
4527316:4527332	attL	ACCGTCGCCAGCGCCGC	NA	NA	NA	NA
WP_022646438.1|4527658_4528042_-	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_023908866.1|4528034_4529693_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_022646436.1|4529772_4530729_-	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
WP_000220272.1|4530725_4531397_-	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
WP_001295391.1|4531393_4531960_-	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_000196875.1|4532004_4533441_-	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
WP_022646435.1|4533833_4535792_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	1.6e-89
WP_001014565.1|4536004_4536319_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_000832548.1|4536315_4537965_+	cation/acetate symporter ActP	NA	NA	NA	NA	NA
WP_000402206.1|4538046_4539696_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_000106892.1|4539846_4541196_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
WP_000412424.1|4541741_4542206_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_000019358.1|4542291_4542615_+	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_000019515.1|4542617_4544204_-	c-di-GMP phosphodiesterase PdeC	NA	NA	NA	NA	NA
WP_001295689.1|4544633_4544915_+	membrane protein	NA	NA	NA	NA	NA
WP_096040751.1|4545013_4545550_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.5e-56
WP_000357740.1|4545804_4548627_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000155657.1|4548661_4549018_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000270375.1|4549021_4549438_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_001226928.1|4549548_4550262_-	class B acid phosphatase	NA	NA	NA	NA	NA
WP_001027697.1|4550662_4551166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646434.1|4551388_4552582_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_001147328.1|4552834_4553914_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|4553966_4555382_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235517.1|4555464_4556448_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891408.1|4556613_4556856_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_001528313.1|4556989_4558027_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_021567874.1|4558115_4559213_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	2.3e-210
WP_001217553.1|4559273_4559522_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_021567873.1|4559882_4561811_-	hypothetical protein	NA	A0A2D2W320	Escherichia_phage	45.0	2.6e-124
WP_021567872.1|4561814_4562399_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	4.1e-113
WP_048230182.1|4562389_4563448_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	3.6e-200
WP_000424732.1|4563434_4563860_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001752126.1|4563859_4564408_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.7	8.1e-95
WP_021567870.1|4564407_4565487_-|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	99.2	3.4e-206
WP_000219915.1|4565483_4566812_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.1	2.5e-246
WP_001439754.1|4566902_4567415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021567868.1|4567496_4569329_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.5	2.5e-305
WP_021567867.1|4569470_4569740_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	98.9	7.8e-43
WP_000090998.1|4569739_4570096_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_021567866.1|4570095_4571592_-|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.8	4.8e-275
WP_000497751.1|4571575_4571746_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_021567865.1|4571754_4572315_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	1.2e-104
WP_000224836.1|4572311_4572818_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_021567864.1|4572792_4573203_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	2.3e-70
WP_000927711.1|4573199_4573523_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_096040752.1|4573525_4573726_-	hypothetical protein	NA	S5FNU1	Shigella_phage	95.5	8.4e-26
WP_000257490.1|4573774_4574980_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	100.0	8.2e-225
WP_001193631.1|4574994_4575645_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_021513315.1|4575622_4576864_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	4.5e-242
WP_000605606.1|4576863_4577046_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_072011717.1|4577057_4578554_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_123059992.1|4578787_4579282_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.1e-87
WP_001764251.1|4579407_4579758_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	94.0	2.2e-61
WP_000892817.1|4579924_4580149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001701537.1|4580416_4580878_-|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	90.8	1.3e-69
WP_001197758.1|4580861_4581338_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	6.4e-88
WP_001120490.1|4581341_4581668_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_096040754.1|4581744_4582797_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	1.5e-206
WP_000917730.1|4582947_4583151_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_000750482.1|4583551_4584415_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	40.8	2.4e-40
WP_077908626.1|4584427_4584793_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.4e-56
WP_096040755.1|4584808_4585798_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
WP_032192240.1|4585805_4586603_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	2.4e-148
WP_000767113.1|4586622_4587012_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210164.1|4587008_4587335_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_001407082.1|4587334_4587829_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	100.0	2.7e-89
WP_000104967.1|4587825_4588767_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_096040756.1|4588756_4588936_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	64.8	3.9e-14
WP_000515830.1|4589111_4589663_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|4589706_4589907_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|4589997_4590672_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549623.1|4590906_4591113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|4591084_4591519_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000135682.1|4591987_4592350_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_023307624.1|4592415_4593240_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.0e-149
WP_029396186.1|4593458_4594211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022630955.1|4594247_4594520_+	Pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	97.8	8.8e-42
WP_021563277.1|4594553_4595102_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	96.2	4.6e-90
WP_000287252.1|4595123_4595597_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
4599314:4599330	attR	ACCGTCGCCAGCGCCGC	NA	NA	NA	NA
>prophage 8
NZ_CP023366	Escherichia coli strain 1428 chromosome, complete genome	4986712	4623865	4640386	4986712	tail,plate	Burkholderia_phage(33.33%)	22	NA	NA
WP_000619864.1|4623865_4624213_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_022646418.1|4624750_4625038_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
WP_000266448.1|4625040_4625646_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000777272.1|4625658_4625973_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_022646417.1|4626117_4626573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|4626569_4626767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646416.1|4626756_4628181_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
WP_000907502.1|4628180_4628705_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_022646415.1|4628755_4629073_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_015674804.1|4629032_4629161_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_096040757.1|4629262_4631638_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	25.8	5.0e-56
WP_022646413.1|4631637_4632591_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001269711.1|4632590_4632800_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_022646412.1|4632787_4633828_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	2.0e-73
WP_096040758.1|4633837_4634539_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	35.4	2.4e-11
WP_022646411.1|4634637_4634997_+	hypothetical protein	NA	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
WP_022646410.1|4634987_4636103_+	hypothetical protein	NA	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_022646409.1|4636095_4636812_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	3.1e-22
WP_022646408.1|4636814_4638425_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
WP_022646407.1|4638421_4639129_+	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	5.3e-14
WP_022646406.1|4639125_4639581_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
WP_022646405.1|4639594_4640386_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
>prophage 1
NZ_CP023367	Escherichia coli strain 1428 plasmid p111, complete sequence	111523	4676	69963	111523	lysis,integrase,protease,transposase	Escherichia_phage(25.0%)	51	43443:43465	65698:65720
WP_001595244.1|4676_5699_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001352814.1|6290_6575_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_001595243.1|6562_7048_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001595242.1|7727_8303_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	6.2e-53
WP_001595241.1|8762_9356_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001595240.1|9429_10134_+	molecular chaperone	NA	NA	NA	NA	NA
WP_001595237.1|10219_10552_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001595236.1|10580_13088_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_024192260.1|13278_13680_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001595235.1|13740_14259_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001595234.1|14323_15499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595233.1|16192_16798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096040774.1|17151_18489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595229.1|18770_20651_+	colicin 1B	NA	NA	NA	NA	NA
WP_001595228.1|20668_21016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595227.1|21134_21482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595223.1|22476_22755_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421257.1|22754_23030_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001595222.1|23135_23417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137498364.1|23854_24091_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001595221.1|24543_25494_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_096040775.1|25678_27163_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_019842660.1|29323_29584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595327.1|29887_32065_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	32.5	5.6e-06
WP_001595326.1|32109_33066_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_000933675.1|33150_34380_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_112861041.1|34483_38269_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	2.8e-45
WP_001318220.1|38282_39398_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_112861042.1|42219_42402_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	67.3	2.4e-11
WP_001595320.1|42505_42790_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.4	3.1e-42
43443:43465	attL	TGTCAACGACGGATGAAAAGTGA	NA	NA	NA	NA
WP_096040776.1|45233_46401_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	4.0e-184
WP_001595315.1|46792_47209_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	33.6	3.3e-16
WP_000280980.1|48481_49435_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_000771475.1|49867_50977_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000175738.1|51039_51948_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_032160254.1|52321_52510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066953.1|52630_53371_+	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361611.1|53655_54633_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001595311.1|55414_56005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343099.1|56004_56262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595310.1|56581_57514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595309.1|57517_58513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813639.1|59219_59438_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|59439_59745_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001595307.1|59745_60555_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.4	2.1e-54
WP_000239529.1|60692_60968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633911.1|60961_61606_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_001103690.1|61834_62806_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_001595306.1|62810_63203_+	stable plasmid inheritance protein	NA	NA	NA	NA	NA
WP_001595302.1|65554_65713_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_001595295.1|68991_69963_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
65698:65720	attR	TGTCAACGACGGATGAAAAGTGA	NA	NA	NA	NA
>prophage 1
NZ_CP023368	Escherichia coli strain 1428 plasmid p48, complete sequence	48774	11692	48447	48774	protease,portal,terminase,capsid,holin,tail,plate	Vibrio_phage(40.0%)	49	NA	NA
WP_001270825.1|11692_12025_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	39.8	2.9e-15
WP_001250512.1|12028_12406_+	hypothetical protein	NA	A0A2I7R3L8	Vibrio_phage	35.1	6.3e-06
WP_096040784.1|12575_13643_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000823235.1|13720_14002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001521425.1|13998_14364_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	55.9	3.1e-10
WP_001706266.1|14393_14552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042968900.1|14548_15232_+	hypothetical protein	NA	Q71T76	Escherichia_phage	66.8	3.0e-83
WP_032271980.1|15234_15579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042968899.1|15571_16183_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	78.3	9.7e-73
WP_042968898.1|16169_16355_+	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	94.8	2.5e-24
WP_001271967.1|16733_17129_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	82.3	6.1e-52
WP_000254764.1|17115_17412_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	63.7	2.3e-27
WP_024179329.1|17395_17941_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	84.5	2.3e-89
WP_000147212.1|17937_18216_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	52.8	4.0e-18
WP_023278667.1|18893_19481_+	hypothetical protein	NA	G9L699	Escherichia_phage	77.0	9.3e-81
WP_001523045.1|19593_19863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001222808.1|19862_20060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042038383.1|20134_20590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077775197.1|20976_21690_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	79.4	1.1e-38
WP_042038382.1|21924_22548_+	ParB N-terminal domain-containing protein	NA	A0A2I7RQE2	Vibrio_phage	46.3	2.0e-33
WP_001443071.1|22547_23921_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_042038409.1|23961_24657_+	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	33.8	9.8e-29
WP_096040785.1|25214_25805_+	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	58.5	1.6e-40
WP_001019009.1|25804_26356_+	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	29.4	1.7e-07
WP_001406385.1|26361_28218_+|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	62.7	8.5e-237
WP_001058287.1|28229_28469_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	52.0	6.8e-14
WP_001022885.1|28465_30040_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	65.7	1.2e-191
WP_050558846.1|30029_31097_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	46.8	1.8e-77
WP_001209256.1|31106_31490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001523065.1|31510_32554_+|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	47.9	8.8e-74
WP_032145258.1|32629_32947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001083980.1|32946_33291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609134.1|33287_33773_+	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	37.4	3.0e-16
WP_001284547.1|33773_34064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004105325.1|34063_35527_+	hypothetical protein	NA	A0A059WKP9	Vibrio_phage	53.6	4.2e-146
WP_000070729.1|35543_36065_+|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	57.8	1.5e-50
WP_000450805.1|36074_36356_+	hypothetical protein	NA	A0A0C5AEP1	Bacteriophage	37.4	1.0e-05
WP_042968914.1|37170_39303_+|tail	phage tail tape measure protein	tail	A0A097P6S4	Vibrio_phage	39.6	3.7e-18
WP_096040786.1|39503_40505_+	late control D family protein	NA	A0A067ZG47	Vibrio_phage	42.5	1.6e-69
WP_000998645.1|40507_41128_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	51.6	1.8e-29
WP_000635200.1|41124_41592_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001406393.1|41588_41909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032271500.1|41905_43030_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	43.6	5.4e-85
WP_000763347.1|43022_43604_+|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	40.0	7.2e-17
WP_096040787.1|43655_45704_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	44.4	3.1e-131
WP_021579115.1|45706_46240_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	1.4e-96
WP_042035007.1|46268_46796_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	96.6	3.6e-92
WP_042035010.1|46797_47778_-	hypothetical protein	NA	A0A222YWB9	Escherichia_phage	85.9	8.9e-161
WP_042038368.1|47892_48447_+	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	88.4	8.2e-87
>prophage 1
NZ_CP023369	Escherichia coli strain 1428 plasmid p66, complete sequence	66332	16350	23711	66332		Thalassomonas_phage(16.67%)	12	NA	NA
WP_001311069.1|16350_16914_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	38.0	2.7e-21
WP_072165043.1|17065_17350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032144808.1|17400_17595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290816.1|17822_18350_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	54.3	3.9e-46
WP_000005975.1|18405_18639_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.3	3.3e-05
WP_096040789.1|18697_20656_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	1.8e-19
WP_000845966.1|20710_21145_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000994097.1|21141_21861_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000870669.1|21857_22172_+	hypothetical protein	NA	I3UM57	Rhodobacter_phage	38.4	9.9e-13
WP_000775237.1|22380_22542_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001415592.1|22971_23166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000533253.1|23387_23711_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.9	2.8e-26
