The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023377	Escherichia coli strain 127 chromosome, complete genome	4697886	515837	568916	4697886	protease,tail,tRNA,transposase,integrase	uncultured_Caudovirales_phage(12.5%)	53	515654:515670	525227:525243
515654:515670	attL	TTAGTTCATGCCGTATT	NA	NA	NA	NA
WP_000829625.1|515837_517073_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.2	5.5e-123
WP_001439227.1|517367_517547_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000754198.1|517555_517837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096038006.1|517928_519509_+	virulence-associated E family protein	NA	A0A193GYG9	Enterobacter_phage	64.8	3.9e-150
WP_000122089.1|519518_519743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000052065.1|519745_520075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101854.1|520509_521394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000270231.1|521396_521711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032164858.1|522093_522411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224730.1|522413_522623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887033.1|522632_522839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284540.1|522860_525149_+|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	42.9	5.5e-161
WP_000462905.1|525226_525523_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
525227:525243	attR	TTAGTTCATGCCGTATT	NA	NA	NA	NA
WP_001219652.1|525548_526514_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_001145827.1|526842_527724_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_096037749.1|527735_529187_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_000381173.1|529176_529419_-	YhdT family protein	NA	NA	NA	NA	NA
WP_000884639.1|529527_530877_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000354622.1|530887_531358_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000838307.1|532223_533054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037750.1|533090_534065_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001241469.1|534216_536157_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_000913396.1|536461_537505_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_000802511.1|537570_538674_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000179405.1|538673_539162_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000203105.1|539170_539764_+	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000123197.1|539753_541223_+	ribonuclease G	NA	NA	NA	NA	NA
WP_096037751.1|541290_545091_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000055909.1|545520_546966_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_000440317.1|547099_548029_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000051841.1|548211_548415_+	AaeX family protein	NA	NA	NA	NA	NA
WP_000854033.1|548422_549355_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_024250105.1|549360_551328_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_001029013.1|551419_551692_+	barnase inhibitor	NA	NA	NA	NA	NA
WP_000695690.1|551747_552011_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001257846.1|552375_552846_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_001295272.1|553280_554219_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000497723.1|554281_555349_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|555438_556806_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_001295270.1|556959_557358_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001192312.1|557551_558679_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_000847559.1|558897_559326_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|559341_559734_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000257293.1|560128_560767_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000366129.1|560772_561270_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000467018.1|561312_562680_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000523845.1|563059_563851_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000224714.1|563972_564866_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_032298177.1|564974_566465_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	1.7e-09
WP_001300570.1|566512_567202_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209020.1|567198_568074_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979881.1|568070_568535_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000639208.1|568610_568916_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023377	Escherichia coli strain 127 chromosome, complete genome	4697886	802962	823799	4697886	holin,transposase	Escherichia_phage(33.33%)	17	NA	NA
WP_032248128.1|802962_803910_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_000035052.1|803961_807348_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_001288714.1|807374_808529_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000599365.1|808544_808802_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_050491571.1|808828_810415_-	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_001206281.1|810468_810747_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000502010.1|810761_811046_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000502008.1|811063_811342_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001217009.1|811861_812380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001270145.1|812379_813198_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032298845.1|813220_813799_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	31.3	3.8e-10
WP_096037760.1|815710_816691_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.2	2.8e-183
WP_001521630.1|816963_818142_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_047928860.1|818134_819586_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_047928859.1|821177_822275_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	5.3e-37
WP_047928846.1|822320_823301_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	7.5e-184
WP_000747051.1|823448_823799_-|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
>prophage 3
NZ_CP023377	Escherichia coli strain 127 chromosome, complete genome	4697886	1041977	1055160	4697886		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1041977_1042739_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1042732_1043359_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1043498_1044638_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1044700_1045693_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_096037768.1|1045786_1047151_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136916.1|1047239_1048016_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1048020_1048659_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590390.1|1048655_1049918_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	9.8e-136
WP_096037769.1|1049914_1050823_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_001295181.1|1051018_1051786_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_096037770.1|1051836_1052493_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	3.9e-51
WP_001272928.1|1052598_1055160_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 4
NZ_CP023377	Escherichia coli strain 127 chromosome, complete genome	4697886	1090241	1208243	4697886	head,portal,tail,lysis,tRNA,capsid,terminase,integrase,plate	Salmonella_phage(66.07%)	114	1135040:1135085	1169881:1169926
WP_000047184.1|1090241_1092872_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1093106_1093292_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273290.1|1094748_1095315_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287454.1|1095311_1095740_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|1095812_1097369_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130211.1|1097518_1098034_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1098097_1099636_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|1099652_1100825_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1100951_1101482_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119763.1|1101572_1101908_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|1101897_1102635_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000165699.1|1102758_1103943_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216521.1|1104134_1105127_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774988.1|1105183_1106248_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985483.1|1106240_1107443_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|1107797_1108757_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_096037773.1|1108766_1110911_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.4e-195
WP_000080947.1|1110883_1111294_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|1111290_1111536_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|1111783_1112113_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1112264_1112609_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1112645_1113095_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115384.1|1113762_1114167_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229445.1|1114213_1114738_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|1114747_1115047_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1115229_1115388_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522424.1|1115471_1115921_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_096037774.1|1115921_1116584_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|1116604_1118005_-	GABA permease	NA	NA	NA	NA	NA
WP_000097662.1|1118242_1119523_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_000772820.1|1119536_1120985_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271962.1|1121007_1122276_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_033554103.1|1122294_1123272_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_016242335.1|1123607_1124612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037775.1|1128016_1129390_+	DUF5507 domain-containing protein	NA	NA	NA	NA	NA
WP_072097107.1|1129753_1129963_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	68.1	1.3e-08
WP_001120794.1|1130117_1130237_+	hypothetical protein	NA	NA	NA	NA	NA
1135040:1135085	attL	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001513130.1|1135307_1137065_+	deoxycytidylate deaminase	NA	G3MA58	Bacillus_virus	22.9	8.6e-05
WP_000155496.1|1137078_1138092_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	95.2	1.6e-189
WP_024203614.1|1138093_1138726_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	90.5	6.9e-106
WP_000102105.1|1138845_1139088_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460856.1|1139120_1139630_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	95.3	1.3e-83
WP_000956182.1|1139637_1139838_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001311552.1|1139801_1140143_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001513128.1|1140210_1140444_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752616.1|1140443_1140671_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_001513126.1|1140667_1141525_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	2.7e-161
WP_057688676.1|1141521_1143936_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_001154434.1|1144088_1144277_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001513124.1|1144287_1144521_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.4e-35
WP_001513123.1|1144935_1146018_+	AAA family ATPase	NA	M4QMW8	Micromonas_pusilla_virus	32.9	4.3e-15
WP_001513122.1|1146010_1148203_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_096037776.1|1148241_1149291_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.9	1.6e-171
WP_001098422.1|1149290_1151057_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_001515566.1|1151199_1152033_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	85.2	4.8e-123
WP_000742510.1|1152049_1153108_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000059191.1|1153111_1153762_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_001513116.1|1153857_1154322_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	3.2e-76
WP_000868175.1|1154321_1154525_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1154528_1154744_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_096038009.1|1154763_1155237_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	8.3e-80
WP_001513114.1|1155238_1155616_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.0e-16
WP_096037777.1|1155612_1156041_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	2.4e-46
WP_001039937.1|1156136_1156568_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_001518815.1|1156560_1157007_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	4.3e-62
WP_001513111.1|1157075_1157654_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	88.0	1.5e-94
WP_057688674.1|1157650_1158010_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	3.6e-51
WP_057108081.1|1157996_1158905_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.0e-143
WP_057688673.1|1158897_1159503_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	9.8e-110
WP_057688672.1|1159499_1161251_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	49.4	3.0e-82
WP_057688671.1|1161250_1161664_+|tail	phage tail protein	tail	U5P0S4	Shigella_phage	73.0	1.5e-21
WP_057108085.1|1161770_1162943_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	1.6e-204
WP_001504081.1|1162952_1163468_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281016.1|1163522_1163825_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_001513105.1|1163839_1163959_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	8.2e-13
WP_096037778.1|1163951_1167029_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.8	0.0e+00
WP_000980397.1|1167025_1167511_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_057688670.1|1167507_1168608_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	3.8e-176
WP_000980504.1|1168676_1168892_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	70.8	2.1e-22
WP_001513102.1|1168994_1169708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162574.1|1170458_1170941_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1169881:1169926	attR	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600189.1|1171072_1171549_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1171538_1171829_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1171890_1172232_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1172380_1174042_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1174127_1175006_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1175128_1175722_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1175776_1177063_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_096038010.1|1177083_1177875_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1178041_1179403_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1179539_1179788_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1179806_1180355_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_033554046.1|1180385_1181153_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1181194_1181542_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|1181617_1182100_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969010.1|1182115_1183342_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1183331_1183850_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1183999_1184365_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|1184574_1185645_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|1185655_1186777_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200120.1|1186819_1187980_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1188077_1188125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1188228_1188570_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1188840_1189578_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079100.1|1189712_1190693_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040129.1|1190689_1191421_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1191550_1194124_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|1199987_1201286_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001295360.1|1201282_1201606_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1201651_1203007_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083015.1|1203120_1205781_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001301152.1|1205812_1206511_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1206579_1206999_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1207205_1208243_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP023377	Escherichia coli strain 127 chromosome, complete genome	4697886	1702810	1711119	4697886		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569357.1|1702810_1703737_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_096037809.1|1703741_1704473_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1704453_1704561_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1704620_1705352_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1705573_1707259_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1707255_1707975_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1708021_1708492_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001702450.1|1708532_1708994_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_096037810.1|1709118_1711119_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
>prophage 6
NZ_CP023377	Escherichia coli strain 127 chromosome, complete genome	4697886	1880127	1890752	4697886	integrase,transposase,tail	Enterobacterial_phage(33.33%)	11	1879954:1880013	1893745:1893808
1879954:1880013	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
WP_047633075.1|1880127_1881102_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	86.6	8.0e-170
WP_152953564.1|1881091_1881250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047633073.1|1881377_1882163_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	3.1e-63
WP_047928777.1|1882162_1882462_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	3.2e-13
WP_096037820.1|1883006_1883987_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.7e-184
WP_004184740.1|1884281_1884758_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	2.0e-12
WP_004202052.1|1884859_1885123_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	46.6	1.8e-12
WP_024250321.1|1885151_1885604_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.2	1.3e-66
WP_053274530.1|1886480_1887323_+|tail	phage tail protein	tail	K7PKN5	Enterobacterial_phage	42.8	1.6e-17
WP_000901073.1|1887301_1888393_-	acyltransferase	NA	NA	NA	NA	NA
WP_001565623.1|1888757_1890752_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	27.2	2.4e-27
1893745:1893808	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
>prophage 7
NZ_CP023377	Escherichia coli strain 127 chromosome, complete genome	4697886	2269445	2318852	4697886	protease,tail,lysis,transposase,holin,integrase	Escherichia_phage(27.59%)	56	2277021:2277037	2305989:2306005
WP_001260849.1|2269445_2270267_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2270366_2270450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2270542_2270878_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2271274_2272528_-	MFS transporter	NA	NA	NA	NA	NA
WP_096037838.1|2272634_2273528_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2273662_2274883_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2275007_2275703_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071607222.1|2275655_2276948_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2277021:2277037	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_096037839.1|2277106_2277721_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	3.3e-28
WP_000526503.1|2277763_2278618_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2278619_2279237_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001433342.1|2279247_2281671_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
WP_096037840.1|2281731_2284158_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
WP_001300836.1|2284356_2284662_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2284769_2285480_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2285482_2286043_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2286077_2286419_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2286553_2286880_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2287085_2288300_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836067.1|2288311_2289331_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2289388_2289499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877007.1|2289518_2290799_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	7.3e-155
WP_001296941.1|2290833_2291070_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_033873403.1|2291157_2293629_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001083273.1|2293722_2293914_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_096037841.1|2293910_2294099_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001328010.1|2294514_2294802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023281935.1|2294770_2295136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050491573.1|2295147_2295273_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000705349.1|2295348_2295870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054483.1|2295850_2296816_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_085947917.1|2297143_2298417_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_073511943.1|2298462_2298591_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	85.7	2.5e-15
WP_032298921.1|2299309_2300359_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	4.3e-113
WP_001204787.1|2300376_2300754_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_000780584.1|2300909_2301434_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_000592549.1|2301626_2302586_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_001146313.1|2302992_2303706_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839588.1|2303896_2304112_+|holin	holin	holin	A5LH82	Enterobacteria_phage	91.5	1.2e-30
WP_000189900.1|2304116_2304668_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.0e-36
WP_001557934.1|2304615_2304876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|2304989_2305523_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001071778.1|2305519_2306017_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2305989:2306005	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000072434.1|2306380_2306593_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	75.7	2.4e-23
WP_071528545.1|2306603_2306792_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2306938_2307094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2307266_2307440_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2307733_2307940_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_140047246.1|2309076_2311428_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	85.9	0.0e+00
WP_001233123.1|2311495_2312095_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	2.2e-106
WP_085947917.1|2315200_2316473_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_096038012.1|2316451_2317258_+	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	93.0	4.1e-127
WP_072133544.1|2317312_2317432_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	89.7	1.1e-12
WP_096037842.1|2317529_2318120_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	4.3e-25
WP_000836768.1|2318436_2318670_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2318738_2318852_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
>prophage 8
NZ_CP023377	Escherichia coli strain 127 chromosome, complete genome	4697886	2447117	2567325	4697886	head,coat,tail,lysis,tRNA,terminase,transposase,integrase	Escherichia_phage(39.71%)	121	2439538:2439554	2559718:2559734
2439538:2439554	attL	CAGGGCGTTGGCCTGAT	NA	NA	NA	NA
WP_000826416.1|2447117_2448326_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001261013.1|2448857_2449526_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586744.1|2449828_2450422_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001301046.1|2450418_2451411_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234053.1|2451534_2452515_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140885.1|2452509_2453046_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2453108_2453333_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|2453472_2455128_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_000013759.1|2455352_2456696_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|2456912_2457836_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096037852.1|2457873_2459514_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_085947770.1|2459889_2461258_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001309484.1|2461358_2461508_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2461579_2461753_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2461997_2462528_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|2462716_2463718_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_033554315.1|2463759_2465199_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_033554317.1|2465395_2466196_-	YdcF family protein	NA	NA	NA	NA	NA
WP_024250173.1|2466467_2470370_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048950.1|2470570_2471176_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627356.1|2471229_2472546_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_047928696.1|2472535_2474197_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000752043.1|2475167_2475494_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2475501_2475687_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_033554175.1|2475683_2478323_-	YdbH family protein	NA	NA	NA	NA	NA
WP_077473150.1|2478530_2479520_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.3	5.1e-71
WP_001298828.1|2479630_2480053_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2480049_2480316_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628174.1|2480589_2484114_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|2484479_2485613_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001300461.1|2485753_2486188_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000286867.1|2486773_2487688_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_012565075.1|2489081_2489441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037853.1|2489604_2490555_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.0	3.4e-56
WP_047632210.1|2490581_2490974_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_021564336.1|2490970_2491351_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	43.6	1.9e-18
WP_047632215.1|2491351_2491735_-	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	40.0	1.2e-15
WP_047632218.1|2491734_2492130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908083.1|2492133_2492358_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	52.7	5.6e-10
WP_096037854.1|2492400_2493540_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.7	2.8e-158
WP_096037855.1|2493638_2494403_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	3.3e-86
WP_096037856.1|2494507_2495620_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	1.3e-112
WP_021546823.1|2495603_2497010_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	6.1e-187
WP_096002867.1|2497012_2498314_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	2.7e-149
WP_053287081.1|2498294_2499389_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	9.1e-114
WP_000126790.1|2499392_2499602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037857.1|2499579_2500512_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.2	7.8e-82
WP_096037858.1|2500504_2501293_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.9	7.4e-49
WP_001741602.1|2501429_2502887_-	trk system potassium uptake protein trkG	NA	NA	NA	NA	NA
WP_001228696.1|2503083_2503269_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001135274.1|2503485_2503983_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839599.1|2503982_2504198_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_000334743.1|2504454_2504694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001741631.1|2505371_2505914_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	9.8e-77
WP_096037859.1|2505910_2506201_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	1.4e-45
WP_001406929.1|2506200_2506800_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	95.5	2.0e-110
WP_032218041.1|2506866_2507127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001406927.1|2507372_2507528_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_122990642.1|2507630_2507738_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	3.2e-08
WP_073511864.1|2508131_2510693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077897036.1|2512376_2513912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073511867.1|2514263_2514680_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.1	7.6e-61
WP_096037860.1|2514696_2515422_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.2	2.7e-82
WP_096037861.1|2515405_2516191_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.1	9.5e-113
WP_096037862.1|2516197_2516992_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.9	5.7e-41
WP_032218026.1|2517070_2517493_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	90.0	4.4e-64
WP_001406917.1|2517476_2517704_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_073511871.1|2517781_2518189_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	1.6e-23
WP_001406915.1|2518376_2518655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052318727.1|2518786_2518942_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000288022.1|2518938_2519367_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2519869_2520091_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_077897037.1|2520090_2520261_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	73.2	3.6e-17
WP_000632297.1|2520335_2520611_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_023281732.1|2520712_2523313_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.0e-248
WP_000166322.1|2523305_2524139_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	66.8	7.2e-95
WP_072130784.1|2524195_2524390_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	92.2	9.3e-30
WP_001302840.1|2524382_2524571_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2524670_2524886_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040843.1|2524887_2526123_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.3e-238
WP_001157377.1|2526174_2527110_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000123737.1|2527238_2528612_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2529089_2530073_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2530327_2531560_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_001046829.1|2531580_2532144_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_033554177.1|2532473_2532836_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000444949.1|2533011_2534322_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_001156451.1|2534321_2535767_+	amidohydrolase	NA	NA	NA	NA	NA
WP_096038013.1|2537398_2540371_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	75.5	0.0e+00
WP_063117436.1|2546292_2546823_-|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	51.2	8.2e-36
WP_096037863.1|2546765_2547497_-|tail	phage tail protein	tail	Q5G8W2	Enterobacteria_phage	61.0	1.8e-86
WP_096037864.1|2547499_2548204_-|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	72.1	2.6e-98
WP_096038014.1|2548332_2548488_+	transporter	NA	NA	NA	NA	NA
WP_096037865.1|2548500_2548851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037866.1|2548860_2549124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037867.1|2549117_2549321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157739708.1|2549411_2549549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037869.1|2549778_2550132_-|tail	phage tail protein	tail	I6RSL7	Salmonella_phage	68.7	3.1e-39
WP_096037870.1|2550478_2550733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157739710.1|2550852_2551029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037871.1|2551061_2553410_-	tape measure protein	NA	A0A291AXC6	Shigella_phage	36.3	3.8e-56
WP_096037872.1|2553666_2554017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037873.1|2554135_2554438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037874.1|2554452_2555133_-	hypothetical protein	NA	I6R0Q2	Salmonella_phage	40.1	2.9e-41
WP_096037875.1|2555187_2555664_-	hypothetical protein	NA	H6WRU1	Salmonella_phage	62.9	1.3e-51
WP_021519047.1|2555677_2556064_-	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	62.5	2.8e-41
WP_096037876.1|2556060_2556501_-	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	55.2	1.1e-36
WP_096037877.1|2556512_2556899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021519044.1|2556891_2557077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037878.1|2557079_2557466_-	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	64.1	4.3e-42
WP_096037879.1|2557532_2558585_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	62.4	1.2e-126
WP_096037880.1|2558604_2559006_-	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	48.9	1.4e-27
WP_096037881.1|2559017_2560304_-	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	54.2	1.3e-114
2559718:2559734	attR	ATCAGGCCAACGCCCTG	NA	NA	NA	NA
WP_096038015.1|2560294_2561191_-|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	49.8	4.2e-72
WP_096037882.1|2561180_2562551_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	59.5	1.3e-146
WP_096037883.1|2562629_2564108_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	69.8	4.9e-203
WP_096037884.1|2564110_2564596_-	DNA-binding protein	NA	Q716H4	Shigella_phage	40.5	8.9e-21
WP_096037885.1|2565310_2565895_-	hypothetical protein	NA	C6ZR72	Salmonella_phage	41.7	9.1e-20
WP_096037886.1|2566173_2566656_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_096037887.1|2566631_2567123_-	lysozyme	NA	A0A2I6TCA1	Escherichia_phage	62.2	3.6e-54
WP_000460269.1|2567124_2567325_-	hypothetical protein	NA	A0A1V0E5H9	Salmonella_phage	47.1	4.3e-06
>prophage 9
NZ_CP023377	Escherichia coli strain 127 chromosome, complete genome	4697886	2571239	2592915	4697886	integrase	Salmonella_phage(31.58%)	38	2572729:2572742	2594068:2594081
WP_096037898.1|2571239_2571452_-	hypothetical protein	NA	A0A1P8DTK9	Salmonella_phage	49.3	3.4e-09
WP_096037899.1|2571455_2571755_-	RNA-binding protein	NA	I6S5Y4	Salmonella_phage	62.4	1.1e-24
WP_096037900.1|2571744_2572017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037901.1|2572006_2572354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037902.1|2572340_2572547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037903.1|2572543_2573266_-	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	36.6	5.8e-40
2572729:2572742	attL	CGCCGCAATGCTGG	NA	NA	NA	NA
WP_096037904.1|2573265_2573448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037905.1|2573450_2573852_-	RusA family crossover junction endodeoxyribonuclease	NA	F1C5C9	Cronobacter_phage	58.7	1.1e-37
WP_096037906.1|2573848_2574454_-	protein NinG	NA	G0ZNC4	Cronobacter_phage	54.1	6.5e-45
WP_096037907.1|2574803_2575586_-	DNA cytosine methyltransferase	NA	S4TQH6	Salmonella_virus	60.7	1.2e-83
WP_096037908.1|2575582_2576086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096038017.1|2576556_2577096_-	phage N-6-adenine-methyltransferase	NA	H6WCM2	Enterobacteria_phage	93.3	2.3e-102
WP_063117438.1|2577107_2577341_-	hypothetical protein	NA	H6WCM1	Enterobacteria_phage	92.2	1.5e-34
WP_063117391.1|2577343_2577571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063117390.1|2577572_2577776_-	hypothetical protein	NA	H6WCL9	Enterobacteria_phage	82.1	3.7e-29
WP_063117389.1|2577765_2577960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037909.1|2578058_2578277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037910.1|2578376_2578997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037911.1|2579009_2579342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086611455.1|2579331_2579523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037912.1|2579513_2579786_-	toxin-antitoxin system toxin subunit	NA	NA	NA	NA	NA
WP_096037913.1|2580013_2580238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063117383.1|2580252_2580531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037914.1|2580546_2580963_-	single-stranded DNA-binding protein	NA	H9C0R6	Aeromonas_phage	50.5	4.1e-22
WP_096037915.1|2580962_2581604_-	ERF family protein	NA	I6RSN3	Salmonella_phage	54.0	3.6e-54
WP_096037916.1|2581753_2582044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063117379.1|2582547_2583195_-	helix-turn-helix domain-containing protein	NA	A0A286S2B2	Klebsiella_phage	51.8	3.7e-54
WP_096037917.1|2583501_2583756_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096037918.1|2583758_2584805_+	DUF4373 domain-containing protein	NA	A0A2I7RBL5	Vibrio_phage	46.8	1.3e-45
WP_096037919.1|2585944_2587063_+	hypothetical protein	NA	A0A1X7QGR9	Escherichia_phage	65.8	8.1e-150
WP_096037920.1|2587081_2588497_+	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	57.9	7.1e-143
WP_157739712.1|2588573_2589101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037923.1|2589313_2589511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037924.1|2589507_2589939_+	recombination protein NinB	NA	A0A1I9KFA6	Aeromonas_phage	45.0	7.9e-29
WP_096037925.1|2590116_2590770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074152517.1|2590769_2590988_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	42.9	1.6e-09
WP_096038018.1|2590945_2592181_-|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	44.9	3.9e-97
WP_033554179.1|2592399_2592915_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
2594068:2594081	attR	CCAGCATTGCGGCG	NA	NA	NA	NA
>prophage 10
NZ_CP023377	Escherichia coli strain 127 chromosome, complete genome	4697886	2783086	2836730	4697886	head,protease,tail,portal,tRNA,capsid,terminase,transposase,holin,integrase	Escherichia_phage(46.67%)	61	2832947:2832963	2847676:2847692
WP_001297484.1|2783086_2784193_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2784228_2784870_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2784873_2786244_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2786412_2787084_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735409.1|2787083_2788544_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|2788619_2789741_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359441.1|2789789_2791016_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|2791265_2792402_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799406.1|2792385_2793249_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_122990631.1|2793803_2794472_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096037929.1|2794709_2798486_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	80.1	0.0e+00
WP_086624042.1|2798550_2799150_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	2.8e-109
WP_096037930.1|2799216_2802699_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.9	0.0e+00
WP_074180489.1|2802759_2803407_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	2.0e-108
WP_001312811.1|2803304_2804048_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.1e-150
WP_021570076.1|2804053_2804752_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	1.8e-131
WP_001330090.1|2804751_2805108_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_089648138.1|2805085_2808313_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.2	0.0e+00
WP_074185540.1|2808359_2808620_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.0e-39
WP_077249358.1|2808661_2809048_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	99.2	2.6e-63
WP_000097524.1|2809047_2809752_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
WP_001206307.1|2809811_2810156_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	3.9e-55
WP_000968644.1|2810152_2810602_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_021570071.1|2810598_2810937_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	89.3	1.7e-50
WP_000719066.1|2810945_2811263_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766109.1|2811339_2812557_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_096037931.1|2812571_2813171_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	80.5	2.1e-88
WP_000923134.1|2813163_2814390_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_096037932.1|2814537_2816295_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.1	0.0e+00
WP_001333563.1|2816294_2816777_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2816924_2817275_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_085947917.1|2817719_2818993_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000738421.1|2819136_2819430_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2819520_2819703_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|2819919_2820453_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2820516_2820867_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2820871_2821087_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|2821394_2821583_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|2821843_2822179_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|2822249_2822462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2822950_2823037_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000762879.1|2823431_2824253_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_096037933.1|2824249_2824630_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	5.0e-35
WP_001221526.1|2824630_2825689_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2825690_2825969_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|2826136_2826349_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001224662.1|2827383_2827566_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_061349403.1|2827659_2828016_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	8.8e-58
WP_001151150.1|2828073_2828496_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2828536_2829607_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693853.1|2829678_2830104_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2830100_2830355_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2830434_2830854_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_139914699.1|2831290_2831491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2831583_2831802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2831805_2831970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854564.1|2832370_2832559_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001612869.1|2832555_2832747_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_096037935.1|2832840_2835312_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
2832947:2832963	attL	CCCGCGCAAAATTTCAC	NA	NA	NA	NA
WP_000003742.1|2835373_2835643_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|2835611_2836730_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2847676:2847692	attR	GTGAAATTTTGCGCGGG	NA	NA	NA	NA
>prophage 11
NZ_CP023377	Escherichia coli strain 127 chromosome, complete genome	4697886	3479576	3482134	4697886	protease	Stx_converting_phage(66.67%)	6	NA	NA
WP_001741315.1|3479576_3479945_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	97.5	8.5e-64
WP_001198861.1|3480017_3480182_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_001741311.1|3480150_3480294_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	97.9	5.1e-17
WP_000995439.1|3480369_3480666_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3480671_3481457_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_023281837.1|3481453_3482134_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
>prophage 12
NZ_CP023377	Escherichia coli strain 127 chromosome, complete genome	4697886	3701918	3773674	4697886	head,protease,tail,portal,capsid,terminase,transposase,holin,integrase,plate	Shigella_phage(58.62%)	82	3729630:3729689	3769759:3769818
WP_096037971.1|3701918_3703081_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	8.9e-51
WP_122997413.1|3703223_3703298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131044.1|3703603_3705637_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3705765_3706353_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001514956.1|3706366_3707839_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_096037972.1|3707852_3709523_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
WP_001209100.1|3709735_3710404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3710646_3711342_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3711334_3712762_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102100.1|3712772_3713492_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3714018_3714873_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|3715098_3716424_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3716532_3716769_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3716780_3717374_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3717964_3718816_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024250650.1|3718955_3723212_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3724328_3724430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3724793_3725057_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3725056_3725197_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_032338128.1|3725231_3725423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|3725407_3726681_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_061091801.1|3727027_3728650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001384291.1|3728736_3729333_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.9	5.0e-98
3729630:3729689	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000749408.1|3730024_3730456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949416.1|3730832_3731995_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
WP_023147381.1|3732077_3732410_-	protein FlxA	NA	NA	NA	NA	NA
WP_032193087.1|3733265_3735155_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_023147383.1|3735405_3735780_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	49.4	2.8e-14
WP_001515122.1|3735779_3736223_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.4	1.5e-46
WP_001515121.1|3736194_3736605_-|tail	tail assembly chaperone	tail	U5P0S4	Shigella_phage	81.6	2.3e-25
WP_039000333.1|3736604_3737531_-	hypothetical protein	NA	U5P0I1	Shigella_phage	83.1	9.3e-51
WP_000383536.1|3737534_3738119_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_023147736.1|3738109_3739168_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	8.1e-200
WP_016244980.1|3739154_3739580_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_001259084.1|3739579_3740128_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000999511.1|3740127_3741207_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_032193238.1|3741203_3742532_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	2.5e-246
WP_016244982.1|3742592_3744428_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.3	2.9e-306
WP_000661054.1|3744569_3744839_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|3744838_3745195_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_016244983.1|3745194_3746691_-|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.4	5.4e-274
WP_000497751.1|3746674_3746845_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_016244984.1|3746853_3747414_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	3.0e-105
WP_000213503.1|3747410_3747917_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_023147732.1|3747891_3748302_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	2.1e-71
WP_000927711.1|3748298_3748622_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3748624_3748825_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257519.1|3748874_3750080_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	100.0	1.8e-224
WP_016244986.1|3750094_3750745_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	1.6e-118
WP_023147731.1|3750722_3751964_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	1.3e-241
WP_000605606.1|3751963_3752146_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_123010488.1|3752157_3753654_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.8	2.0e-300
WP_000929173.1|3753887_3754382_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_021519684.1|3754507_3754858_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	2.3e-63
WP_021519683.1|3754915_3755422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032193237.1|3755759_3756152_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	82.9	1.3e-49
WP_016236818.1|3756135_3756612_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	94.3	1.5e-84
WP_001120501.1|3756615_3756951_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|3757087_3757381_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|3757659_3757893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|3758036_3758576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021519680.1|3758791_3759544_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	5.8e-136
WP_001360050.1|3759557_3760547_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061403.1|3760554_3761352_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.0e-150
WP_000767095.1|3761371_3761761_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_021549921.1|3761757_3762084_-	LexA repressor	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_015364417.1|3762080_3762734_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_072176118.1|3762733_3763228_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	4.3e-87
WP_000104954.1|3763224_3764166_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|3764155_3764335_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001434539.1|3764510_3765062_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|3765099_3765300_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3765397_3766024_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000917896.1|3766209_3766506_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008202.1|3767182_3767719_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001242749.1|3767709_3768072_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_001519505.1|3768071_3768368_+	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	6.8e-48
WP_077873866.1|3768283_3768718_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_000051893.1|3768594_3769758_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_000893278.1|3769962_3771216_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3769759:3769818	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3771227_3772331_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3772618_3773674_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 1
NZ_CP023378	Escherichia coli strain 127 plasmid p123, complete sequence	123289	10978	56574	123289	integrase,transposase,protease	Escherichia_phage(35.71%)	40	9683:9697	64705:64719
9683:9697	attL	CCGGAGAATGGCTGA	NA	NA	NA	NA
WP_000156883.1|10978_12001_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000083821.1|12405_12663_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|12898_12973_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130948.1|12965_13823_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|14761_15415_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|15507_15765_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|15697_16099_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|17409_18114_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|18313_18517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|18644_19484_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|19477_19825_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|20030_20819_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|20949_21423_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|22325_23030_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|23219_24035_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|24185_24890_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|24950_25787_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|25786_26590_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|26650_27466_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000240536.1|27773_28625_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|29380_30085_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000134999.1|31044_31686_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000147567.1|32258_32819_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|32821_35788_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|35854_36232_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|36432_37092_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_032156742.1|39349_39475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066942.1|39595_40336_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_096038024.1|40620_41598_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	1.1e-99
WP_000246636.1|44884_45880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350635.1|46344_48483_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044768.1|48644_49061_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|49057_49288_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001553851.1|49594_52714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545983.1|52976_54110_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000642771.1|54129_54414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000215657.1|54410_54608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813634.1|55241_55460_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|55461_55767_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016982.1|55767_56574_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
64705:64719	attR	CCGGAGAATGGCTGA	NA	NA	NA	NA
>prophage 1
NZ_CP023381	Escherichia coli strain 127 plasmid p91, complete sequence	91199	0	90873	91199	portal,terminase,integrase,head,tail,holin	Escherichia_phage(62.89%)	100	973:991	91040:91058
WP_001076427.1|0_861_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
973:991	attL	TTTCCCTCCAGCACACATC	NA	NA	NA	NA
WP_001285362.1|1418_2615_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|2631_3633_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_059338140.1|3858_5565_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.2	6.3e-311
WP_096038030.1|5625_7215_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.7	2.4e-301
WP_000041757.1|7224_8040_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	2.6e-113
WP_000035301.1|8075_8657_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000509939.1|8668_9178_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_001313475.1|9294_9450_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_001426344.1|9631_9877_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_033560572.1|9927_10773_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.6	4.2e-151
WP_001187875.1|10802_11603_-	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_096038031.1|11767_12805_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	93.1	3.7e-173
WP_000245712.1|12801_13023_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
WP_063120244.1|13423_14098_+	hypothetical protein	NA	Q71TC4	Escherichia_phage	92.2	4.0e-19
WP_000846124.1|14356_14626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000188924.1|14684_15251_+	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	6.6e-100
WP_000523978.1|15261_15873_+	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
WP_063120243.1|15887_16769_+	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.3	8.3e-174
WP_096038032.1|16850_20642_+	lytic transglycosylase domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	86.1	0.0e+00
WP_089581147.1|20641_20998_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	99.2	1.1e-60
WP_029487598.1|20994_22428_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	3.4e-270
WP_001561131.1|22427_23264_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.6	1.5e-153
WP_029487597.1|23342_23777_+	hypothetical protein	NA	Q71TD4	Escherichia_phage	98.6	3.7e-74
WP_096038033.1|23788_26860_+	hypothetical protein	NA	Q71TP5	Escherichia_phage	73.7	3.8e-242
WP_063078302.1|26859_27270_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	81.6	5.6e-24
WP_000332810.1|27687_27969_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	98.9	1.8e-45
WP_000887652.1|28036_28366_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|28362_28806_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000164724.1|28792_29395_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
WP_096038034.1|29396_31316_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	95.9	0.0e+00
WP_000175490.1|31312_31678_+	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	97.5	2.1e-46
WP_096038035.1|31690_34678_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.1	0.0e+00
WP_001376906.1|34667_34985_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	88.6	7.6e-45
WP_032185981.1|35014_35803_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	96.6	1.5e-142
WP_096038051.1|35809_36487_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	97.8	3.2e-125
WP_000068865.1|36684_37173_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
WP_001345478.1|37342_37900_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_096038037.1|38191_39211_-|head	head processing protein	head	Q71TR6	Escherichia_phage	99.7	1.2e-184
WP_096038038.1|39203_40913_-|portal	phage portal protein	portal	Q71TR7	Escherichia_phage	99.3	0.0e+00
WP_096038039.1|40989_47757_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.3	0.0e+00
WP_000224043.1|47790_48231_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|48227_48476_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_024245513.1|48534_49044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096038040.1|49043_50084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096038041.1|50174_50816_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	96.7	6.5e-112
WP_096038042.1|51006_51567_-	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	95.7	1.0e-97
WP_023156636.1|51812_52124_-	hypothetical protein	NA	A0A077SK03	Escherichia_phage	98.1	3.9e-46
WP_096038043.1|52174_53206_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	99.1	1.9e-193
WP_000542332.1|53213_53435_-	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
WP_000874154.1|54038_54248_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000611656.1|54358_55210_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_096038044.1|55234_56719_-|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	99.6	9.6e-292
WP_096038045.1|56718_57912_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	99.0	2.8e-209
WP_001312282.1|57998_58451_-	late promoter-activating protein (Gp10)	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
WP_000648827.1|58539_59583_-	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	100.0	1.0e-207
WP_000113019.1|59610_59790_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_001216045.1|59794_60175_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_001190712.1|60174_60396_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000506726.1|60468_60858_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001377386.1|60981_61233_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
WP_001261544.1|61894_62257_-	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_000057449.1|62253_63186_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	98.4	1.4e-179
WP_000988658.1|63167_63542_-	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.0	3.2e-66
WP_001677496.1|63548_63842_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	91.8	9.1e-45
WP_000516537.1|64020_64254_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_023153863.1|64336_65224_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	59.3	1.8e-80
WP_000224220.1|65234_65498_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_033550033.1|65499_66057_-	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	62.8	5.1e-36
WP_000118152.1|66058_66358_-	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_023154014.1|66354_67080_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	49.8	7.5e-48
WP_023352820.1|67076_67316_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	1.3e-36
WP_000158004.1|67308_67512_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_023153717.1|67595_68324_-	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	1.7e-140
WP_000021768.1|68518_69025_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.8e-93
WP_055388165.1|69097_70360_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.5	6.0e-234
WP_000684868.1|70661_71363_-	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	2.1e-143
WP_096038046.1|71359_72037_-	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	96.9	3.0e-131
WP_000484110.1|72033_72660_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_012817939.1|72557_73220_-	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000096174.1|73161_73317_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_096038047.1|73383_73962_-	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.0	1.7e-106
WP_000840931.1|73964_74210_-	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000235786.1|74356_74734_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141908.1|74743_75961_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000896806.1|75964_76693_+	hypothetical protein	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
WP_000602711.1|76679_77465_+	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.6	2.7e-144
WP_000212018.1|77466_78483_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_000535203.1|78475_79108_+	hypothetical protein	NA	A0A077SK50	Escherichia_phage	100.0	6.9e-90
WP_096038048.1|79154_80153_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	97.3	7.6e-192
WP_001276603.1|80152_81517_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
WP_000751808.1|81906_82734_-	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
WP_096038049.1|84708_86973_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	68.1	0.0e+00
WP_000472529.1|86969_87875_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_001177862.1|87867_88152_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
WP_001369296.1|88425_88605_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_060588823.1|88613_89402_+	hypothetical protein	NA	A0A077SK48	Escherichia_phage	99.2	3.4e-118
WP_096038050.1|89441_89864_+	ppfA	NA	A0A1B0VCB0	Salmonella_phage	83.6	1.1e-43
WP_001281923.1|90041_90401_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	69.1	4.6e-38
WP_000458377.1|90471_90873_+	hypothetical protein	NA	Q71TL7	Escherichia_phage	54.0	5.5e-32
91040:91058	attR	GATGTGTGCTGGAGGGAAA	NA	NA	NA	NA
