The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023353	Escherichia coli strain 746 chromosome, complete genome	5089615	1242828	1249968	5089615		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1242828_1243467_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001551546.1|1243463_1244726_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_000847985.1|1244722_1245631_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001596096.1|1245826_1246594_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.1	1.9e-70
WP_001141345.1|1246644_1247301_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272891.1|1247406_1249968_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
>prophage 2
NZ_CP023353	Escherichia coli strain 746 chromosome, complete genome	5089615	1851937	1861380	5089615		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|1851937_1852864_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|1852868_1853600_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1853580_1853688_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1853747_1854479_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1854700_1856386_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|1856382_1857102_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1857148_1857619_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1857660_1858122_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551351.1|1858246_1860247_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|1860243_1861380_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 3
NZ_CP023353	Escherichia coli strain 746 chromosome, complete genome	5089615	1957313	1965970	5089615		Enterobacteria_phage(42.86%)	8	NA	NA
WP_064770392.1|1957313_1958708_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
WP_000183060.1|1958882_1959776_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_032084602.1|1960148_1961234_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_053273168.1|1961233_1962133_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	9.7e-29
WP_064770391.1|1962190_1963066_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	5.6e-106
WP_052925276.1|1963074_1963629_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.3	1.7e-47
WP_064759649.1|1963637_1964876_+	flippase	NA	NA	NA	NA	NA
WP_052925274.1|1964878_1965970_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	64.4	1.9e-140
>prophage 4
NZ_CP023353	Escherichia coli strain 746 chromosome, complete genome	5089615	2496844	2565782	5089615	tail,terminase,portal,lysis,integrase,protease	Enterobacteria_phage(44.23%)	83	2504420:2504435	2534830:2534845
WP_001260850.1|2496844_2497666_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2497765_2497849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|2497941_2498277_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2498673_2499927_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019558.1|2500033_2500927_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2501061_2502282_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2502406_2503102_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071600869.1|2503054_2504347_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2504420:2504435	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_001595811.1|2504505_2505120_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	1.9e-28
WP_001595810.1|2505162_2506017_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2506018_2506636_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072141759.1|2506646_2509070_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041647.1|2509130_2511557_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
WP_001295396.1|2511755_2512061_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_032158983.1|2512168_2512879_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2512881_2513442_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705205.1|2513476_2513818_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001306081.1|2513952_2514279_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001295394.1|2514484_2515699_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|2515710_2516730_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2516787_2516916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557866.1|2516917_2518198_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.9e-155
WP_001296941.1|2518232_2518469_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048387.1|2518556_2521028_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.6	9.4e-58
WP_001090200.1|2521121_2521313_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854561.1|2521309_2521498_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344950.1|2521984_2522560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2522561_2522717_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000381213.1|2522884_2523292_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	1.2e-31
WP_000921592.1|2523372_2523600_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705387.1|2523583_2524105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129766576.1|2524085_2525051_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001151230.1|2525091_2525490_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.2	2.9e-62
WP_096035166.1|2525692_2526358_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001265627.1|2526566_2527181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001323870.1|2527177_2528206_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000887491.1|2528556_2528769_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980983.1|2528985_2529237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023140913.1|2529303_2529582_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001578393.1|2529583_2530633_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.2e-112
WP_096035167.1|2530646_2531399_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	9.3e-134
WP_120795389.1|2531676_2531766_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2531820_2532033_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2532333_2532549_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2533302_2533518_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_001309518.1|2533501_2533834_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.3	1.1e-25
WP_001092971.1|2533830_2534364_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2534360_2534858_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2534830:2534845	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2535221_2535434_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2535444_2535633_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|2535635_2535701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2535780_2535936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2536107_2536281_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035574.1|2536432_2536843_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.0	2.1e-63
WP_001031431.1|2537143_2537350_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000421823.1|2537918_2538458_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
WP_000507036.1|2538466_2540566_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_001595798.1|2540562_2540775_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	3.2e-31
WP_001595796.1|2540774_2542283_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	7.8e-289
WP_001595795.1|2542227_2544255_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.5	0.0e+00
WP_001097039.1|2544341_2544665_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_001283153.1|2544657_2544933_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677102.1|2544944_2545523_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001079419.1|2545519_2545921_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_001595794.1|2545931_2546675_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.8	5.0e-132
WP_001299384.1|2546735_2547122_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	4.7e-65
WP_001161009.1|2547130_2547460_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001595793.1|2547431_2550497_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_000447248.1|2550496_2550826_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_001152402.1|2550835_2551534_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	5.1e-134
WP_019843088.1|2551539_2552283_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	5.9e-149
WP_096035168.1|2552180_2552828_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	9.5e-111
WP_096035169.1|2552888_2556368_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_001228252.1|2556435_2557035_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_096035170.1|2557099_2559499_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.0	6.6e-133
WP_000654150.1|2559495_2559777_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	2.4e-18
WP_096035171.1|2559786_2560491_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000355609.1|2560501_2560795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|2561022_2561613_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2561929_2562163_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2562231_2562345_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347485.1|2562948_2564232_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527819.1|2564321_2565782_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.9	5.1e-43
>prophage 5
NZ_CP023353	Escherichia coli strain 746 chromosome, complete genome	5089615	2721561	2834566	5089615	tail,terminase,tRNA,transposase,portal,head,lysis,integrase,capsid	Escherichia_phage(50.0%)	109	2738782:2738796	2832014:2832028
WP_001595397.1|2721561_2722020_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
WP_001296778.1|2722196_2722421_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|2722560_2724216_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_001595710.1|2724440_2725784_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|2726000_2726924_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001595709.1|2726962_2728603_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_085948682.1|2728978_2730347_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
WP_001309484.1|2730447_2730597_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_001595708.1|2730668_2730842_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	7.6e-07
WP_001590124.1|2731086_2731617_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_001595707.1|2731805_2732807_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001595706.1|2732848_2734288_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001595705.1|2734484_2735285_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000343026.1|2735400_2735778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|2735897_2736347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523214.1|2736333_2736672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595704.1|2736956_2740859_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
2738782:2738796	attL	TCTACCCATTCAGGG	NA	NA	NA	NA
WP_000048963.1|2741059_2741665_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_001563833.1|2741778_2742639_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_019842676.1|2742846_2749338_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001551079.1|2749668_2750259_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_001551078.1|2750240_2751191_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632281.1|2751291_2752605_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|2752631_2753837_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_001551077.1|2753836_2754259_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_019842675.1|2754251_2755676_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_001551075.1|2755677_2756466_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001551074.1|2756465_2757233_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001551073.1|2757229_2758300_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189203.1|2758307_2758805_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_096035174.1|2758819_2759566_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2759574_2759862_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_071591516.1|2759873_2760839_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001551071.1|2761087_2763133_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535436.1|2763380_2765654_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001551070.1|2765712_2767212_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001067519.1|2767447_2768353_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001306533.1|2768524_2768851_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2768858_2769044_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001595701.1|2769040_2771680_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2771887_2772877_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001523197.1|2772987_2773410_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2773406_2773673_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001551068.1|2773946_2777471_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837902.1|2777832_2778966_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
WP_001295593.1|2779106_2779541_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000555620.1|2780127_2781042_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001576746.1|2781041_2781869_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	1.5e-07
WP_001101732.1|2781865_2782723_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_001595697.1|2782719_2783577_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001595695.1|2784339_2785542_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	87.8	8.0e-188
WP_001361266.1|2785875_2786169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595694.1|2786179_2786863_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	3.4e-58
WP_001544317.1|2786875_2787145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595693.1|2787144_2789502_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	1.7e-117
WP_001595691.1|2789566_2790166_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	1.4e-100
WP_001595689.1|2790233_2793713_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.4	0.0e+00
WP_125075731.1|2793773_2794406_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	8.5e-96
WP_032160272.1|2794342_2795086_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.1	4.9e-143
WP_001595687.1|2795090_2795789_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847345.1|2795788_2796118_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_064770487.1|2796114_2798676_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.8	0.0e+00
WP_001595435.1|2798668_2799103_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_001552795.1|2799084_2799507_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.9	4.2e-59
WP_001595684.1|2799522_2800263_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	8.9e-129
WP_001595682.1|2800270_2800666_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	5.5e-69
WP_001595680.1|2800662_2801241_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	3.1e-76
WP_001204540.1|2801252_2801606_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|2801598_2801973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522651.1|2802024_2803053_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_001595678.1|2803110_2803458_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_001253910.1|2803494_2805000_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.0e-99
WP_001595677.1|2804989_2806582_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.4e-184
WP_000259002.1|2806578_2806785_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001595676.1|2806768_2808697_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.9	3.9e-261
WP_001595675.1|2808668_2809217_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001443307.1|2809603_2809798_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	3.3e-27
WP_024186452.1|2810157_2810343_-	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	81.4	3.2e-19
WP_001595673.1|2810559_2811093_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	4.0e-99
WP_001595672.1|2811198_2811468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595671.1|2811436_2811781_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	91.7	7.0e-36
WP_000839599.1|2811785_2812001_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_000640107.1|2813284_2813827_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_001595670.1|2813823_2814114_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	1.8e-45
WP_001595669.1|2814113_2814713_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.9e-105
WP_001326322.1|2815584_2815923_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001595668.1|2816535_2817204_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000686865.1|2817474_2817747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595666.1|2817883_2818306_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	6.5e-60
WP_001595665.1|2818321_2819083_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	1.0e-119
WP_001595663.1|2819105_2819852_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	3.4e-112
WP_001595662.1|2819858_2820716_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	74.1	1.5e-74
WP_000693801.1|2820728_2821151_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	97.1	8.2e-71
WP_001072343.1|2821147_2821402_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233320.1|2821481_2821901_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001169150.1|2822336_2822489_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-08
WP_000560211.1|2822899_2823121_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.0e-37
WP_001516462.1|2823120_2823291_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	1.1e-23
WP_001314664.1|2823365_2823641_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	1.3e-40
WP_001595659.1|2823742_2826343_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	62.8	1.5e-247
WP_001595658.1|2826335_2827145_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	4.4e-105
WP_001317028.1|2827201_2827396_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001595656.1|2827388_2827577_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	7.2e-27
WP_000079604.1|2827676_2827892_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2827893_2829129_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157377.1|2829180_2830116_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_001551034.1|2830244_2831618_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2832095_2833079_-	zinc transporter ZntB	NA	NA	NA	NA	NA
2832014:2832028	attR	CCCTGAATGGGTAGA	NA	NA	NA	NA
WP_001314661.1|2833333_2834566_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 6
NZ_CP023353	Escherichia coli strain 746 chromosome, complete genome	5089615	3983317	4056368	5089615	tRNA,plate,protease,transposase	Ralstonia_phage(11.11%)	57	NA	NA
WP_024192499.1|3983317_3984454_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001077735.1|3984674_3985052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550647.1|3989627_3991769_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_001142958.1|3991978_3992497_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037390.1|3993193_3993694_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001521869.1|3993728_3993953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550644.1|3994003_3995479_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001521866.1|3995485_3995899_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001521865.1|3995902_3997753_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348804.1|3997716_3998799_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001550643.1|3998823_4000104_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4000100_4000625_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246418.1|4000627_4001959_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001521863.1|4001963_4002725_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_072617203.1|4002733_4005595_+	AAA domain-containing protein	NA	A0A1C3S747	Escherichia_phage	29.6	2.5e-78
WP_001550641.1|4005591_4006335_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240537.1|4006339_4007752_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122987212.1|4007860_4011295_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001563736.1|4011305_4012658_+	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_000002621.1|4012681_4013164_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908071.1|4013207_4014122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086163.1|4014746_4015532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001308374.1|4016070_4016802_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|4016866_4017334_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308373.1|4017330_4018053_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052732.1|4018086_4018842_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4018913_4020272_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001550637.1|4020318_4021089_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4021166_4021967_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648583.1|4022207_4023122_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997053.1|4023118_4023922_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_001140178.1|4029681_4030254_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4030440_4031472_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4031464_4032118_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4032157_4032973_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4033090_4033495_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094022.1|4033491_4034199_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260708.1|4034309_4036028_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001550629.1|4036080_4036905_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239188.1|4036935_4037646_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635534.1|4037659_4038082_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185287.1|4038078_4038624_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4038789_4038990_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062311.1|4038976_4039237_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_001550628.1|4039285_4040584_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4040648_4041038_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|4041094_4043236_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055748.1|4043333_4044293_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294781.1|4044305_4047788_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	2.2e-209
WP_001550627.1|4047824_4048421_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	7.9e-27
WP_001550626.1|4048417_4049566_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4049565_4050354_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4050357_4050813_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139287.1|4050917_4051943_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4051946_4052432_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4052553_4054986_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001520521.1|4055015_4056368_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 7
NZ_CP023353	Escherichia coli strain 746 chromosome, complete genome	5089615	4849971	4899769	5089615	tail,terminase,portal,head,lysis,plate,holin,capsid,integrase,protease	Escherichia_phage(47.62%)	62	4865869:4865915	4896981:4897027
WP_000208242.1|4849971_4850502_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293344.1|4850511_4851843_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4851909_4852836_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4852928_4853414_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4853498_4853744_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4854168_4855014_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4855036_4856545_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4856679_4857690_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796330.1|4857786_4858533_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|4858537_4858966_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4858992_4859292_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155255.1|4859503_4859944_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|4860044_4860644_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4860751_4861519_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|4861573_4862329_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|4862435_4863425_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|4863744_4864707_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4864887_4865790_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4865869:4865915	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4866025_4866244_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_064770409.1|4866325_4867489_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	3.5e-204
WP_064770410.1|4867488_4867968_-|tail	phage tail protein	tail	O64315	Escherichia_phage	96.9	3.6e-83
WP_016235449.1|4867982_4870430_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	92.9	0.0e+00
WP_000785970.1|4870422_4870542_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4870574_4870850_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_021512565.1|4870906_4871425_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	1.9e-93
WP_064770411.1|4871437_4872628_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_016235447.1|4872904_4873507_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	85.5	2.7e-91
WP_021512563.1|4873506_4875030_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	54.4	1.1e-125
WP_001285352.1|4875026_4875638_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_064770412.1|4875630_4876539_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	2.2e-161
WP_064770413.1|4876543_4876891_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	98.3	5.5e-57
WP_021512561.1|4876887_4877523_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	5.5e-111
WP_001001767.1|4877589_4878042_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
WP_000917186.1|4878034_4878502_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_001440152.1|4878464_4878638_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_064770414.1|4878609_4879035_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	1.2e-64
WP_064770415.1|4879022_4879448_-	hypothetical protein	NA	M1SV74	Escherichia_phage	97.2	3.6e-58
WP_001144101.1|4879462_4879960_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|4879959_4880241_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|4880244_4880448_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|4880447_4880957_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_064770417.1|4881056_4881794_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	97.6	2.8e-127
WP_064770418.1|4881797_4882871_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	98.9	5.7e-201
WP_001085946.1|4882929_4883784_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	97.2	7.6e-132
WP_021512555.1|4883957_4885730_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_021512554.1|4885729_4886764_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	1.8e-199
WP_001123601.1|4887159_4888143_+	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	63.3	3.4e-120
WP_001469928.1|4888150_4889107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000742296.1|4889109_4890285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512553.1|4890481_4892776_-	replication endonuclease	NA	M1SV59	Escherichia_phage	97.2	0.0e+00
WP_000027667.1|4892765_4893041_-	hypothetical protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113263.1|4893037_4893262_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_001277958.1|4893261_4893564_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_000557701.1|4893563_4893788_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217667.1|4893851_4894352_-	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.0e-91
WP_001284599.1|4894816_4895005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001430611.1|4895059_4895332_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	80.0	3.1e-39
WP_000703053.1|4895478_4895772_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	64.9	4.0e-32
WP_000027751.1|4895884_4896865_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.9	4.1e-182
WP_001223800.1|4897050_4897551_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4896981:4897027	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|4897700_4898399_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580422.1|4898395_4899769_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
