The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023388	Escherichia coli strain 1105 chromosome, complete genome	5059652	1332884	1340024	5059652		Escherichia_phage(83.33%)	6	NA	NA
WP_001279002.1|1332884_1333523_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	3.7e-83
WP_000590411.1|1333519_1334782_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001683230.1|1334778_1335687_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	9.6e-117
WP_001298167.1|1335882_1336650_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_001141305.1|1336700_1337357_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	2.5e-50
WP_000103863.1|1337462_1340024_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 2
NZ_CP023388	Escherichia coli strain 1105 chromosome, complete genome	5059652	1951033	1960478	5059652		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569345.1|1951033_1951960_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
WP_000783127.1|1951964_1952696_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1952676_1952784_-	protein YohO	NA	NA	NA	NA	NA
WP_001240405.1|1952843_1953575_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001295431.1|1953796_1955482_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1955478_1956198_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1956244_1956715_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1956755_1957217_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001337891.1|1957341_1959345_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001683049.1|1959341_1960478_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	4.6e-161
>prophage 3
NZ_CP023388	Escherichia coli strain 1105 chromosome, complete genome	5059652	2884069	2929881	5059652	lysis,head,protease,terminase,portal,integrase,tail,capsid	Enterobacteria_phage(50.77%)	71	2902938:2902952	2934006:2934020
WP_000654168.1|2884069_2884348_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_001524535.1|2884344_2886405_-	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_001682820.1|2886463_2889946_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_071589399.1|2890006_2890639_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.2e-96
WP_000194779.1|2890575_2891319_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152619.1|2891324_2892023_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847330.1|2892022_2892352_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	1.6e-58
WP_001576740.1|2892348_2894916_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.9	0.0e+00
WP_000459452.1|2894908_2895343_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000479173.1|2895324_2895747_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.2e-68
WP_001524522.1|2895762_2896503_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	1.1e-131
WP_000683157.1|2896510_2896906_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	1.2e-68
WP_000985127.1|2896902_2897481_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
WP_000752960.1|2897492_2897846_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000158881.1|2897857_2898253_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.6e-55
WP_000118193.1|2898294_2899320_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_000201478.1|2899375_2899708_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_000123325.1|2899717_2901049_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	96.8	3.0e-228
WP_001682819.1|2901029_2902631_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	3.2e-309
WP_000198149.1|2902627_2902834_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027282.1|2902830_2904756_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
2902938:2902952	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453576.1|2904730_2905276_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_000881610.1|2905839_2906022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2906228_2906555_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2907035_2907329_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2907419_2907602_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001101164.1|2907818_2908352_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.8e-98
WP_001168526.1|2908486_2908726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193273.1|2908722_2909037_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_000839596.1|2909041_2909257_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2909846_2910929_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204794.1|2911117_2911501_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000971095.1|2911586_2911727_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001682817.1|2911723_2912086_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.6	1.1e-60
WP_000950951.1|2912105_2912300_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|2912292_2912634_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254243.1|2912636_2912813_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000153286.1|2912809_2913337_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736913.1|2913333_2913774_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145927.1|2913847_2914138_-	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000788872.1|2914134_2914836_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000185431.1|2914832_2915732_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000442609.1|2915764_2916061_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|2916202_2916418_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2916493_2917189_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001062368.1|2917228_2917786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|2917782_2918535_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|2918811_2918994_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088199.1|2918971_2919244_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_001066176.1|2919260_2919842_-	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	5.2e-92
WP_000213979.1|2920055_2920256_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_000065374.1|2920438_2920807_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|2920879_2921044_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|2921012_2921156_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995434.1|2921231_2921528_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000100847.1|2921533_2922319_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186790.1|2922315_2922996_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	5.1e-131
WP_000149544.1|2922992_2923175_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|2923147_2923339_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001360114.1|2923349_2923631_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763378.1|2923729_2923951_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289890.1|2923947_2924712_+	ead/Ea22-like family protein	NA	K7PKG8	Enterobacteria_phage	94.8	3.6e-56
WP_001518554.1|2924713_2924968_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	91.1	1.7e-34
WP_001327280.1|2924985_2925519_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	82.1	2.5e-64
WP_000951713.1|2925520_2925730_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000208010.1|2925726_2926467_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.1	6.5e-47
WP_001304460.1|2926459_2926744_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	89.4	4.0e-45
WP_000490215.1|2926769_2927009_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	93.7	8.8e-38
WP_000088653.1|2927148_2927385_+	excisionase	NA	NA	NA	NA	NA
WP_000741334.1|2927374_2928517_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.7	1.1e-205
WP_000444487.1|2928630_2929881_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2934006:2934020	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 4
NZ_CP023388	Escherichia coli strain 1105 chromosome, complete genome	5059652	3269338	3357518	5059652	lysis,plate,protease,head,terminase,portal,integrase,tail,capsid,tRNA	Salmonella_phage(61.82%)	90	3321889:3321914	3357593:3357618
WP_000886683.1|3269338_3270631_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3270721_3272065_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3272075_3272687_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001682761.1|3272845_3276889_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3277023_3277518_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3278061_3279027_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001682760.1|3279149_3280916_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202186.1|3280916_3282638_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	1.4e-15
WP_001241673.1|3282679_3283384_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3283668_3283887_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3284572_3286849_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001682759.1|3286879_3287200_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3287522_3287747_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188147.1|3287819_3289766_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746479.1|3289762_3290878_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_131728210.1|3291028_3291985_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599804.1|3291981_3293640_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488716.1|3294065_3294761_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491136.1|3295255_3296155_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3296298_3297951_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178693.1|3297962_3298931_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815367.1|3299063_3300782_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_001682757.1|3300818_3301820_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136519.1|3301830_3303261_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001305933.1|3303359_3304373_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255186.1|3304369_3305200_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3305196_3305520_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001313703.1|3305645_3306161_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3306378_3307107_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|3307124_3307856_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3307862_3308579_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3308578_3309247_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3309472_3310204_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001682756.1|3310232_3311360_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.7	5.1e-27
WP_000389260.1|3311400_3311889_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3311948_3312794_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105433.1|3312790_3313744_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|3313753_3314887_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126095.1|3314981_3316094_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3316443_3316920_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3317007_3317910_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189165.1|3317970_3318693_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201575.1|3318676_3318964_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195230.1|3319123_3319381_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_000681104.1|3319410_3319788_-	membrane protein	NA	NA	NA	NA	NA
WP_001024876.1|3320057_3321743_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3321889:3321914	attL	ATGGGTTTTTTGTTGCCTGAAATTTA	NA	NA	NA	NA
WP_000972391.1|3321979_3322198_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001682754.1|3322288_3323389_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	6.5e-176
WP_000980413.1|3323385_3323871_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001682752.1|3323867_3326945_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.4	0.0e+00
WP_024194071.1|3326937_3327057_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	1.8e-12
WP_001682751.1|3327071_3327374_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.2e-39
WP_001207660.1|3327428_3327944_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001682750.1|3327953_3329126_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.7	5.1e-203
WP_016237350.1|3329268_3329835_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	8.4e-87
WP_001682745.1|3332530_3333136_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	9.8e-110
WP_001583364.1|3333128_3334037_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_001682744.1|3334023_3334383_-	hypothetical protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	1.2e-51
WP_001682743.1|3334379_3334958_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	1.9e-94
WP_001682742.1|3335172_3335802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682741.1|3335838_3336291_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.0	1.7e-61
WP_001682740.1|3336283_3336715_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_001682739.1|3336810_3337239_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	74.6	1.4e-46
WP_000727851.1|3337235_3337613_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_001069893.1|3337614_3338127_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	5.2e-88
WP_000171568.1|3338107_3338323_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3338326_3338530_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673500.1|3338529_3338994_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000059191.1|3339089_3339740_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742510.1|3339743_3340802_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_001682738.1|3340818_3341652_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	3.1e-122
WP_001098431.1|3341794_3343561_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_001682737.1|3343560_3344589_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.1	1.3e-170
WP_001682736.1|3344625_3346311_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001059831.1|3346840_3347176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3347368_3347602_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|3347612_3347801_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001682735.1|3347953_3350368_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.6	0.0e+00
WP_000104147.1|3350364_3351222_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	3.6e-158
WP_000196280.1|3351218_3351521_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_000752613.1|3351517_3351745_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244216.1|3351744_3351978_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000996717.1|3352045_3352387_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_071591047.1|3352504_3352801_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460893.1|3352808_3353318_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000035244.1|3353350_3353572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001682733.1|3353697_3354579_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	45.3	6.4e-41
WP_000047742.1|3354659_3355862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000584504.1|3355863_3356385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290950.1|3356465_3357518_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3357593:3357618	attR	ATGGGTTTTTTGTTGCCTGAAATTTA	NA	NA	NA	NA
>prophage 5
NZ_CP023388	Escherichia coli strain 1105 chromosome, complete genome	5059652	4493335	4554191	5059652	transposase,plate,integrase	Enterobacteria_phage(16.67%)	45	4489155:4489169	4509206:4509220
4489155:4489169	attL	TCATCAGACAGAAAA	NA	NA	NA	NA
WP_001683520.1|4493335_4494526_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.4	5.8e-122
WP_001535762.1|4494957_4496001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001683521.1|4496360_4497863_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000755105.1|4498018_4498759_-	porin family protein	NA	NA	NA	NA	NA
WP_001275822.1|4498976_4499345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113287125.1|4500109_4500409_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_096057989.1|4500640_4501791_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.9	2.6e-50
WP_050582914.1|4502991_4503543_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033558336.1|4503689_4504430_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_157740135.1|4504733_4505633_-	S-fimbrial adhesin minor pilin SfaH	NA	NA	NA	NA	NA
WP_000767892.1|4505694_4506186_-	S-fimbrial adhesin minor subunit SfaS	NA	NA	NA	NA	NA
WP_021531200.1|4506207_4506735_-	S/F1C fimbrial adhesin minor pilin SfaG/FocF	NA	NA	NA	NA	NA
WP_001350164.1|4506747_4509378_-	S/F1C fimbrial biogenesis usher protein SfaF/FocD	NA	NA	NA	NA	NA
4509206:4509220	attR	TCATCAGACAGAAAA	NA	NA	NA	NA
WP_001683631.1|4509447_4510143_-	S/F1C fimbrial biogenesis chaperone SfaE/FocC	NA	NA	NA	NA	NA
WP_077634342.1|4510183_4510708_-	S/F1C fimbrial minor subunit SfaD	NA	NA	NA	NA	NA
WP_001683632.1|4510793_4511348_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000046975.1|4511719_4512049_-	S/F1C fimbrial major subunit operon transcriptional regulator	NA	NA	NA	NA	NA
WP_001683034.1|4513344_4514592_-	two-component system response regulator PgtA	NA	NA	NA	NA	NA
WP_096057991.1|4514581_4516591_-	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
WP_085973481.1|4516587_4517805_-	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
WP_001683037.1|4518203_4519568_+	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
WP_001536552.1|4521582_4522194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536551.1|4522586_4523225_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	5.1e-56
WP_024194107.1|4523209_4524442_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.6	1.4e-62
WP_024191635.1|4524981_4527150_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001536546.1|4528341_4529706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068590.1|4529760_4530066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536545.1|4530118_4530568_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001536544.1|4530570_4531107_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032157327.1|4531087_4532188_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001536542.1|4532142_4533906_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001536541.1|4534039_4535638_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001683040.1|4535637_4539027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096057994.1|4539019_4540114_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_000033410.1|4540171_4540438_-	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	39.0	6.9e-07
WP_016237387.1|4540469_4541147_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-EAEC	NA	NA	NA	NA	NA
WP_016237388.1|4541291_4541969_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-EAEC	NA	NA	NA	NA	NA
WP_001683579.1|4541988_4543671_-	T6SS effector phospholipase Tle1-EAEC	NA	NA	NA	NA	NA
WP_001536536.1|4543667_4546187_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_001536533.1|4546489_4547131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536532.1|4547117_4549805_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.7	8.9e-94
WP_001007315.1|4549973_4550465_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001536531.1|4550470_4552201_-	OmpA family protein	NA	NA	NA	NA	NA
WP_001536530.1|4552203_4552857_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001536529.1|4552853_4554191_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
