The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023364	Escherichia coli strain 144 chromosome, complete genome	5134443	1212855	1219995	5134443		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1212855_1213494_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001551546.1|1213490_1214753_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_000847985.1|1214749_1215658_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|1215853_1216621_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141345.1|1216671_1217328_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272891.1|1217433_1219995_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
>prophage 2
NZ_CP023364	Escherichia coli strain 144 chromosome, complete genome	5134443	1822314	1831757	5134443		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|1822314_1823241_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|1823245_1823977_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1823957_1824065_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1824124_1824856_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1825077_1826763_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|1826759_1827479_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001551352.1|1827525_1827996_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001295429.1|1828037_1828499_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551351.1|1828623_1830624_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|1830620_1831757_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 3
NZ_CP023364	Escherichia coli strain 144 chromosome, complete genome	5134443	1847460	1911143	5134443	tRNA,integrase,capsid,holin,lysis,tail,head,portal,terminase,plate	Escherichia_phage(51.11%)	71	1874622:1874656	1906821:1906855
WP_001551343.1|1847460_1849494_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	1.8e-54
WP_001005448.1|1849625_1850735_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001551342.1|1850997_1851279_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1851573_1852116_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001551341.1|1852196_1852871_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001551340.1|1852886_1855367_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001551339.1|1855377_1856412_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153073.1|1856493_1856832_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134572.1|1857050_1857875_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1857995_1858268_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001551337.1|1858490_1859279_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1859275_1860076_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001551336.1|1860140_1860959_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.9	2.3e-24
WP_000434044.1|1861010_1861757_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001551335.1|1861730_1862696_-	kinase	NA	NA	NA	NA	NA
WP_000846217.1|1862692_1863697_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_001551334.1|1863693_1864971_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1865227_1866280_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001551333.1|1866510_1867365_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_001551332.1|1867393_1868656_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001551331.1|1868665_1869118_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823282.1|1869148_1869433_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490663.1|1869436_1870792_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_001551330.1|1870839_1871880_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1871979_1872759_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807371.1|1872840_1873740_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_001303579.1|1874153_1874471_+	hypothetical protein	NA	NA	NA	NA	NA
1874622:1874656	attL	TTACGCGTAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985256.1|1874735_1875749_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|1875864_1876164_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1876278_1876554_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217670.1|1876731_1877232_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|1877295_1877520_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277891.1|1877519_1877819_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_001113277.1|1877821_1878046_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	6.5e-35
WP_000027673.1|1878042_1878318_+	hypothetical protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_021561352.1|1878307_1880608_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
WP_021561351.1|1881025_1881514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021561350.1|1881527_1882619_-	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	33.3	9.1e-05
WP_001752367.1|1882781_1883219_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	86.0	1.4e-65
WP_021561349.1|1883923_1884958_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	1.2e-200
WP_000156872.1|1884957_1886730_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_096040625.1|1886903_1887758_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MF5	Enterobacteria_phage	99.6	4.9e-139
WP_021541106.1|1887816_1888890_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	1.1e-199
WP_001593490.1|1888893_1889637_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	99.2	3.5e-125
WP_000988633.1|1889736_1890246_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|1890245_1890449_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|1890452_1890734_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144091.1|1890733_1891231_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_021561348.1|1891245_1891671_+	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	96.5	2.5e-59
WP_021561347.1|1891658_1892084_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	96.5	6.1e-66
WP_000917155.1|1892191_1892659_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
WP_001001795.1|1892651_1893104_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.1e-76
WP_096040626.1|1893317_1894061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021561345.1|1894144_1894780_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	4.2e-111
WP_000127164.1|1894776_1895124_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121496.1|1895128_1896037_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
WP_001285340.1|1896029_1896641_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_021561458.1|1898271_1898874_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.0	6.0e-99
WP_000905108.1|1899470_1900064_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
WP_021561342.1|1900123_1901314_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_001251408.1|1901326_1901845_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1901901_1902177_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1902209_1902329_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_021561341.1|1902321_1904769_+|tail	phage tail tape measure protein	tail	A0A0F7LA40	Escherichia_phage	99.9	0.0e+00
WP_000978878.1|1904783_1905263_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.7	9.6e-84
WP_021561340.1|1905262_1906426_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	1.2e-204
WP_000468308.1|1906508_1906727_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001551329.1|1906999_1908361_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	98.6	1.0e-215
1906821:1906855	attR	TTACGCGTAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|1908508_1908841_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|1909020_1909743_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675144.1|1909739_1911143_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 4
NZ_CP023364	Escherichia coli strain 144 chromosome, complete genome	5134443	1957661	1966377	5134443		Enterobacteria_phage(42.86%)	8	NA	NA
WP_001116131.1|1957661_1959056_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
WP_000183060.1|1959230_1960124_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699418.1|1960496_1961582_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_001023627.1|1961581_1962481_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000857549.1|1962538_1963417_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001100791.1|1963421_1963970_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_021561337.1|1964001_1965240_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_000735124.1|1965249_1966377_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
>prophage 5
NZ_CP023364	Escherichia coli strain 144 chromosome, complete genome	5134443	2676309	2785441	5134443	tRNA,integrase,lysis,tail,terminase,transposase	Escherichia_phage(46.3%)	98	2752121:2752136	2794531:2794546
WP_085948682.1|2676309_2677678_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
WP_001309484.1|2677778_2677928_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2677999_2678173_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001306523.1|2678417_2678948_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000048646.1|2679136_2680138_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115969.1|2680179_2681619_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027956.1|2681815_2682616_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000343026.1|2682731_2683109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|2683228_2683678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523214.1|2683664_2684003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551082.1|2684287_2688190_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
WP_000048949.1|2688390_2688996_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_096040639.1|2689109_2689970_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_096040640.1|2690177_2696669_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001551079.1|2696999_2697590_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_001551078.1|2697571_2698522_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632281.1|2698622_2699936_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|2699962_2701168_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_001551077.1|2701167_2701590_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_019842675.1|2701582_2703007_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_001551075.1|2703008_2703797_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001551074.1|2703796_2704564_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001551073.1|2704560_2705631_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189203.1|2705638_2706136_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001551072.1|2706150_2706897_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2706905_2707193_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_071591516.1|2707204_2708170_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001551071.1|2708418_2710464_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535436.1|2710711_2712985_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001551070.1|2713043_2714543_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001067519.1|2714778_2715684_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001306533.1|2715855_2716182_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2716189_2716375_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001551069.1|2716371_2719011_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2719218_2720208_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001523197.1|2720318_2720741_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2720737_2721004_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001551068.1|2721277_2724802_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837902.1|2725163_2726297_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
WP_001295593.1|2726437_2726872_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000286867.1|2727458_2728373_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983720.1|2728372_2729200_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	8.7e-08
WP_001101728.1|2729196_2730054_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000355602.1|2731257_2731551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551067.1|2731593_2732634_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	4.9e-125
WP_000654143.1|2732643_2732925_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001310555.1|2733333_2734350_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_001228337.1|2736563_2737163_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	1.7e-101
WP_096040641.1|2737230_2740710_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.4	0.0e+00
WP_050436738.1|2740770_2741379_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	91.6	7.1e-100
WP_032147653.1|2741315_2742059_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	2.8e-146
WP_001152425.1|2742064_2742763_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.3	1.9e-128
WP_000024051.1|2742762_2743101_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_016231723.1|2743093_2746327_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.4	7.9e-105
WP_122452218.1|2746798_2747158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551060.1|2747308_2748271_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	3.8e-55
WP_000673077.1|2748297_2748690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551059.1|2748686_2749067_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	2.9e-19
WP_001551058.1|2749067_2749451_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|2749450_2749846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918487.1|2750068_2751208_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_001551057.1|2751306_2752071_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.4	1.8e-79
2752121:2752136	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001363932.1|2752175_2753288_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_001551056.1|2753271_2754678_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	2.3e-186
WP_096040642.1|2754680_2755904_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	56.0	1.9e-136
WP_001551055.1|2755884_2756979_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.2	1.0e-112
WP_000126788.1|2756982_2757192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|2757169_2758102_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_001291094.1|2758094_2758886_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2759023_2760481_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2760677_2760863_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001551053.1|2761079_2761577_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_000839599.1|2761576_2761792_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_000640136.1|2763073_2763616_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.4e-75
WP_001551052.1|2763612_2763903_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	85.4	9.0e-45
WP_000940316.1|2763902_2764502_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.6e-107
WP_001551050.1|2764915_2767180_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000385105.1|2767154_2768309_-	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
WP_001403739.1|2768502_2768934_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.7	4.4e-64
WP_001551048.1|2768949_2769711_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	93.3	2.3e-119
WP_001551047.1|2769733_2770480_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_001551045.1|2771355_2771778_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	5.3e-70
WP_001551044.1|2771800_2772097_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	43.5	1.6e-09
WP_001551043.1|2772220_2772697_+	DNA-binding transcriptional repressor RacR	NA	NA	NA	NA	NA
WP_001551042.1|2773150_2773303_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000560221.1|2773723_2773945_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	3.1e-37
WP_096040682.1|2773944_2774115_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	87.5	1.4e-21
WP_001314664.1|2774189_2774465_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	1.3e-40
WP_021561303.1|2774566_2777218_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.5	0.0e+00
WP_001551037.1|2777210_2778020_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	4.4e-105
WP_001317028.1|2778076_2778271_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001551036.1|2778263_2778452_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.2	7.9e-26
WP_000079604.1|2778551_2778767_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001551035.1|2778768_2780004_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.3e-238
WP_000662472.1|2780055_2780991_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
WP_001551034.1|2781119_2782493_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2782970_2783954_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001314661.1|2784208_2785441_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2794531:2794546	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
>prophage 6
NZ_CP023364	Escherichia coli strain 144 chromosome, complete genome	5134443	3376995	3424177	5134443	protease,integrase,capsid,lysis,tail,head,portal,terminase	Enterobacteria_phage(56.14%)	63	3373767:3373781	3424251:3424265
3373767:3373781	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001550854.1|3376995_3378036_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	1.7e-125
WP_001550853.1|3378045_3378327_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	1.2e-17
WP_096040650.1|3378323_3380723_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	57.7	2.9e-136
WP_021523092.1|3380787_3381387_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	2.6e-102
WP_096040651.1|3381454_3384934_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.1	0.0e+00
WP_000090890.1|3384994_3385627_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.2e-96
WP_071839544.1|3385563_3386307_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	1.5e-144
WP_001555432.1|3386311_3387010_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	5.2e-131
WP_000847355.1|3387009_3387339_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_096040652.1|3387335_3389915_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.6	0.0e+00
WP_000459472.1|3389907_3390342_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	3.8e-63
WP_001563776.1|3390323_3390737_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	93.6	5.4e-67
WP_001301125.1|3390752_3391493_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	100.0	3.5e-133
WP_000683147.1|3391500_3391896_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	8.5e-70
WP_096040653.1|3391892_3392471_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	1.7e-79
WP_000752974.1|3392482_3392836_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	97.4	2.9e-61
WP_000158862.1|3392847_3393246_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	83.3	1.2e-50
WP_000063277.1|3393287_3394313_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001563774.1|3394368_3394701_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	99.1	2.5e-54
WP_001563773.1|3394710_3396030_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	4.8e-234
WP_001563772.1|3396010_3397612_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.2e-309
WP_000198149.1|3397608_3397815_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001563771.1|3397811_3399737_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.6	0.0e+00
WP_000867489.1|3399711_3400257_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	1.2e-79
WP_001307652.1|3400644_3400839_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738423.1|3401201_3401495_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3401585_3401768_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135247.1|3401984_3402482_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839582.1|3402481_3402697_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001563769.1|3403966_3404926_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3405118_3405643_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3405798_3406176_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971071.1|3406261_3406402_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_001099655.1|3406398_3406761_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
WP_000774479.1|3406757_3407048_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224911.1|3407040_3407211_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	66.0	9.1e-13
WP_001053029.1|3407210_3407666_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_072198841.1|3407662_3407764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550848.1|3407964_3411873_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001550847.1|3412112_3412814_-	replication protein P	NA	M1FJ72	Enterobacteria_phage	98.3	1.6e-127
WP_000185505.1|3412810_3413710_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000438490.1|3413742_3414042_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
WP_001180318.1|3414148_3414376_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250470.1|3414454_3415162_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.7	2.2e-132
WP_000076839.1|3415291_3416191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032145726.1|3416419_3416635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216183.1|3416633_3416942_+	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	70.6	7.9e-31
WP_001550846.1|3416958_3417540_-	hypothetical protein	NA	K7P6T7	Enterobacteria_phage	92.2	4.0e-92
WP_001550845.1|3417753_3417954_+	restriction inhibitor protein ral	NA	K7P7K1	Enterobacteria_phage	100.0	1.9e-33
WP_024189690.1|3418136_3418505_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	5.0e-64
WP_001198861.1|3418577_3418742_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3418710_3418854_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001550843.1|3418928_3419225_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001550842.1|3419230_3420016_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000186804.1|3420012_3420693_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_000682318.1|3420689_3420872_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548531.1|3420844_3421036_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|3421046_3421328_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763367.1|3421426_3421648_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001348592.1|3421858_3422461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3422703_3422871_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3422910_3423129_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001550841.1|3423106_3424177_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	4.3e-201
3424251:3424265	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 7
NZ_CP023364	Escherichia coli strain 144 chromosome, complete genome	5134443	3987087	4060090	5134443	plate,tRNA,protease,transposase	Ralstonia_phage(11.11%)	58	NA	NA
WP_024192499.1|3987087_3988224_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001077735.1|3988444_3988822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550647.1|3993397_3995539_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_001142958.1|3995748_3996267_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001550646.1|3996963_3997464_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001521869.1|3997498_3997723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550644.1|3997773_3999249_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001521866.1|3999255_3999669_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001521865.1|3999672_4001523_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348804.1|4001486_4002569_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001550643.1|4002593_4003874_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4003870_4004395_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246418.1|4004397_4005729_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001521863.1|4005733_4006495_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_096040663.1|4006503_4009317_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.2	3.4e-80
WP_001550641.1|4009313_4010057_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240537.1|4010061_4011474_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122989438.1|4011582_4015017_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001563736.1|4015027_4016380_+	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_000002621.1|4016403_4016886_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908071.1|4016929_4017844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236629.1|4017853_4018321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086163.1|4018469_4019255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001308374.1|4019793_4020525_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|4020589_4021057_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308373.1|4021053_4021776_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052732.1|4021809_4022565_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4022636_4023995_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001550637.1|4024041_4024812_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4024889_4025690_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648583.1|4025930_4026845_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997053.1|4026841_4027645_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_001140178.1|4033403_4033976_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4034162_4035194_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4035186_4035840_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4035879_4036695_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4036812_4037217_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094022.1|4037213_4037921_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260708.1|4038031_4039750_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001550629.1|4039802_4040627_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239188.1|4040657_4041368_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635534.1|4041381_4041804_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185287.1|4041800_4042346_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4042511_4042712_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062311.1|4042698_4042959_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_001550628.1|4043007_4044306_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4044370_4044760_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|4044816_4046958_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055748.1|4047055_4048015_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294781.1|4048027_4051510_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	2.2e-209
WP_001550627.1|4051546_4052143_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	7.9e-27
WP_001550626.1|4052139_4053288_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4053287_4054076_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4054079_4054535_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139287.1|4054639_4055665_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4055668_4056154_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4056275_4058708_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001520521.1|4058737_4060090_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 8
NZ_CP023364	Escherichia coli strain 144 chromosome, complete genome	5134443	4291880	4342653	5134443	integrase,capsid,holin,tail,head,portal,terminase	Enterobacteria_phage(36.0%)	61	4303184:4303198	4344634:4344648
WP_000490275.1|4291880_4292042_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4292168_4292774_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|4293166_4294753_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217539.1|4294972_4295221_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_120795384.1|4295647_4295761_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836769.1|4295829_4296063_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_000086527.1|4296444_4297035_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_021540513.1|4298649_4298931_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	7.0e-18
WP_096040666.1|4298930_4301306_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_021523092.1|4301370_4301970_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	2.6e-102
WP_096040667.1|4302037_4305517_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.2	0.0e+00
4303184:4303198	attL	ATTGATACTGGCGGC	NA	NA	NA	NA
WP_000090890.1|4305577_4306210_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.2e-96
WP_071839544.1|4306146_4306890_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	1.5e-144
WP_001555432.1|4306894_4307593_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	5.2e-131
WP_000847355.1|4307592_4307922_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_096040668.1|4307918_4310480_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	88.2	0.0e+00
WP_001605279.1|4310472_4310907_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	3.8e-63
WP_000479202.1|4310888_4311302_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	93.6	7.0e-67
WP_001306179.1|4311317_4312058_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.6	7.8e-133
WP_000683147.1|4312065_4312461_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	8.5e-70
WP_001541219.1|4312457_4313036_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_021539745.1|4313046_4313400_-|head,tail	phage head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	65.8	6.9e-39
WP_000201526.1|4313392_4313767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001605273.1|4313818_4314847_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	2.7e-115
WP_000256813.1|4314904_4315252_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_001253996.1|4315288_4316794_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_001306178.1|4316783_4318376_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	1.9e-184
WP_000259002.1|4318372_4318579_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_096040669.1|4318562_4320491_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001519435.1|4320462_4320969_-	hypothetical protein	NA	O64316	Escherichia_phage	48.5	3.3e-34
WP_001307652.1|4321396_4321591_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000548594.1|4321841_4322048_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	80.9	2.6e-22
WP_001019207.1|4322343_4322517_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|4322689_4322845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|4322992_4323181_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4323191_4323404_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|4323767_4324265_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|4324261_4324795_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001557934.1|4324908_4325169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189900.1|4325116_4325668_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.0e-36
WP_000839581.1|4325672_4325888_-|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000066482.1|4326640_4326856_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_001557932.1|4327156_4327369_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_122993159.1|4327423_4327513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203370.1|4328138_4328324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557930.1|4329484_4330237_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.2	2.4e-134
WP_016235097.1|4330250_4331240_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	8.1e-194
WP_001061427.1|4331247_4332090_-	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.5	1.1e-138
WP_000767113.1|4332109_4332499_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001557928.1|4332495_4333149_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	98.2	4.7e-126
WP_021539742.1|4333148_4333637_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	2.1e-86
WP_021561434.1|4333639_4334482_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	94.6	1.2e-118
WP_001447116.1|4334478_4334703_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	95.9	5.9e-36
WP_021561433.1|4334707_4335544_-	hypothetical protein	NA	Q8SBF3	Shigella_phage	90.6	1.1e-135
WP_000521508.1|4335540_4336092_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|4336135_4336336_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848749.1|4336426_4337101_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_000081280.1|4338198_4339023_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000008196.1|4339150_4339687_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	97.2	1.3e-97
WP_021561432.1|4340125_4341259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218291.1|4341417_4342653_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	2.6e-234
4344634:4344648	attR	GCCGCCAGTATCAAT	NA	NA	NA	NA
>prophage 1
NZ_CP023363	Escherichia coli strain 144 plasmid 134q, complete sequence	134388	0	8081	134388		Bacillus_phage(100.0%)	3	NA	NA
WP_000271277.1|1921_2878_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_000933672.1|2962_4192_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_011402704.1|4295_8081_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
>prophage 2
NZ_CP023363	Escherichia coli strain 144 plasmid 134q, complete sequence	134388	12355	14503	134388	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_000738422.1|12355_12649_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_096040601.1|13230_14503_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.3	7.0e-174
>prophage 3
NZ_CP023363	Escherichia coli strain 144 plasmid 134q, complete sequence	134388	21141	23144	134388	integrase	Macacine_betaherpesvirus(50.0%)	2	15792:15806	35644:35658
15792:15806	attL	AAAACCTGCTCATAC	NA	NA	NA	NA
WP_001514245.1|21141_21882_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_000361611.1|22166_23144_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
35644:35658	attR	GTATGAGCAGGTTTT	NA	NA	NA	NA
>prophage 4
NZ_CP023363	Escherichia coli strain 144 plasmid 134q, complete sequence	134388	27039	31198	134388		Cedratvirus(50.0%)	4	NA	NA
WP_000983710.1|27039_27867_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000992806.1|27863_28721_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|28717_29575_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001318207.1|30817_31198_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
>prophage 5
NZ_CP023363	Escherichia coli strain 144 plasmid 134q, complete sequence	134388	42399	47616	134388	transposase	Macacine_betaherpesvirus(66.67%)	5	NA	NA
WP_001238646.1|42399_43566_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000817028.1|43565_44537_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_000343071.1|45583_46159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092896.1|46171_46384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000082154.1|46644_47616_-|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
>prophage 6
NZ_CP023363	Escherichia coli strain 144 plasmid 134q, complete sequence	134388	51770	59758	134388		Thalassomonas_phage(25.0%)	11	NA	NA
WP_001332335.1|51770_52334_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	3.9e-20
WP_015056142.1|52419_52839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290818.1|53139_53772_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.1	1.8e-45
WP_000005988.1|53734_53968_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000117202.1|54031_55990_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.1	4.3e-21
WP_000845922.1|56044_56479_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000994098.1|56475_57195_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001332444.1|57470_57632_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001337416.1|58230_58467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000107520.1|58530_58818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234468.1|58936_59758_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	2.6e-44
>prophage 7
NZ_CP023363	Escherichia coli strain 144 plasmid 134q, complete sequence	134388	67858	68080	134388		Vibrio_virus(100.0%)	1	NA	NA
WP_001278689.1|67858_68080_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
>prophage 8
NZ_CP023363	Escherichia coli strain 144 plasmid 134q, complete sequence	134388	91071	94451	134388		Xanthomonas_phage(33.33%)	5	NA	NA
WP_000205766.1|91071_91818_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.3	1.1e-09
WP_000704522.1|91876_92737_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840464.1|92839_93400_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001371875.1|93532_93745_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001514236.1|93989_94451_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.7	7.2e-20
>prophage 9
NZ_CP023363	Escherichia coli strain 144 plasmid 134q, complete sequence	134388	98982	120168	134388	transposase,integrase	Escherichia_phage(27.27%)	22	97495:97510	119110:119125
97495:97510	attL	CGGCCAGGCTGCTGGC	NA	NA	NA	NA
WP_000105636.1|98982_100677_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|100694_101057_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|101053_101290_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|101286_101994_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|102032_103337_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|103383_104088_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|104148_104985_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|104984_105788_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|105848_106664_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001518958.1|106920_107823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|108578_109283_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|109329_109731_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|109880_110741_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|111325_112030_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001317507.1|112181_112655_-	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_000845048.1|112810_113824_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|114026_114377_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|114552_115113_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|115116_118083_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_000079941.1|118726_118996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000969996.1|118992_119274_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
119110:119125	attR	GCCAGCAGCCTGGCCG	NA	NA	NA	NA
WP_001057989.1|119319_120168_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	2.0e-28
>prophage 10
NZ_CP023363	Escherichia coli strain 144 plasmid 134q, complete sequence	134388	132198	133233	134388		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001190234.1|132198_133233_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
