The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	845	59061	3323092	tRNA,integrase,transposase	Burkholderia_phage(18.18%)	51	2348:2363	41752:41767
WP_096035852.1|845_2207_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017046370.1|2319_3942_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
2348:2363	attL	AGCGCTTTGTAAATCA	NA	NA	NA	NA
WP_081265547.1|3944_4205_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	57.8	7.1e-17
WP_026027667.1|4171_4528_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_010319951.1|4540_4678_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_017047819.1|4875_5625_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	4.3e-30
WP_010319949.1|5621_6293_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_026027668.1|6368_7118_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010319947.1|7427_8831_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_010319946.1|8904_10005_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	31.4	5.0e-51
WP_096035853.1|10014_11094_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_013855574.1|11113_13531_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.5	6.5e-112
WP_017046366.1|14037_14310_+	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_172858976.1|14510_15208_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_026027704.1|15336_16368_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_010319943.1|16740_17178_+	Hsp20 family protein	NA	A0A1D7SYT7	Cyanophage	38.1	2.4e-17
WP_076611262.1|17234_18542_-|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
WP_010319942.1|18670_19918_-	valine--pyruvate transaminase	NA	NA	NA	NA	NA
WP_096035854.1|20131_22213_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_013855568.1|22214_23132_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017046363.1|23546_24101_+	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_172858977.1|24256_24517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010319937.1|24600_24849_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	69.4	2.2e-07
WP_010319936.1|24982_25168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017044147.1|25323_26268_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088720683.1|26314_27295_-	oxidoreductase	NA	NA	NA	NA	NA
WP_096035855.1|27442_28981_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_017046358.1|28984_30826_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_010319931.1|30842_31781_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_010319930.1|31793_32078_-	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_017044151.1|32077_33724_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	8.5e-63
WP_096035856.1|34201_35137_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_026027704.1|35239_36271_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096035857.1|38461_39823_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_076611988.1|39915_41085_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_096035858.1|41288_41540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611988.1|42004_43174_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
41752:41767	attR	AGCGCTTTGTAAATCA	NA	NA	NA	NA
WP_096036775.1|43307_43835_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_096035859.1|43949_44597_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_096035860.1|45744_46704_-	DUF2860 domain-containing protein	NA	NA	NA	NA	NA
WP_076612072.1|46813_48082_+|transposase	IS4-like element ISVa14 family transposase	transposase	NA	NA	NA	NA
WP_026028316.1|48336_48936_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_026028317.1|48966_49953_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_096035861.1|49999_51418_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_026028318.1|51687_51954_-	YihD family protein	NA	NA	NA	NA	NA
WP_017043678.1|52652_53321_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_096035863.1|53317_53863_-	DUF3157 family protein	NA	NA	NA	NA	NA
WP_017043680.1|53864_55310_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_026027554.1|55322_56699_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_096035864.1|56773_58054_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_096035865.1|58113_59061_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	27.9	3.8e-07
>prophage 2
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	225365	305813	3323092	tRNA,transposase,protease	Vibrio_phage(18.18%)	56	NA	NA
WP_076611262.1|225365_226673_+|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
WP_094145051.1|226754_227249_-	sigma D regulator	NA	NA	NA	NA	NA
WP_172859037.1|227429_228215_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_010318957.1|228464_229532_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_013857945.1|229633_230272_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096035911.1|230361_231324_+	acetyltransferase	NA	NA	NA	NA	NA
WP_096035912.1|231361_232513_-	murein hydrolase activator EnvC	NA	NA	NA	NA	NA
WP_013857941.1|232668_234201_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_013857940.1|234357_235245_-	DMT family transporter	NA	NA	NA	NA	NA
WP_096035913.1|237535_238951_-	SLC13/DASS family transporter	NA	NA	NA	NA	NA
WP_017046689.1|239164_240022_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_013857936.1|240197_241259_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_010318948.1|241413_241959_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.2	9.1e-30
WP_096035914.1|244076_245207_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010318946.1|245427_245892_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_064624230.1|245885_247607_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	29.2	2.2e-13
WP_172859038.1|247615_249592_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.1	8.9e-59
WP_026028407.1|249607_250555_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_013857931.1|250736_251003_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_010318941.1|251044_252334_+	GTPase HflX	NA	NA	NA	NA	NA
WP_013857930.1|252379_253573_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_013857929.1|253575_254556_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_017043313.1|254626_254815_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_010318937.1|254879_255107_-	SlyX family protein	NA	NA	NA	NA	NA
WP_026027456.1|255109_256090_-	lipoprotein	NA	NA	NA	NA	NA
WP_017043312.1|256229_257018_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_013857924.1|257203_257923_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_096035916.1|257916_258321_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	33.6	5.5e-16
WP_064624234.1|258317_258674_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_010318931.1|258683_258959_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_010318930.1|259141_259516_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_013857921.1|259612_260083_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_010318928.1|260158_262255_+	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	25.8	3.1e-54
WP_013857920.1|262378_263563_+	elongation factor Tu	NA	M4M9V7	Vibrio_phage	60.0	3.4e-05
WP_096035917.1|263621_265010_-|transposase	IS4-like element ISVa18 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.8	1.3e-48
WP_013857919.1|265284_265653_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_026027846.1|265661_265964_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000090472.1|265980_266208_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_013857917.1|266241_266691_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_047691125.1|266754_267519_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_013857915.1|267693_269100_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	72.1	2.0e-182
WP_172858981.1|269104_270187_+	alanine racemase	NA	NA	NA	NA	NA
WP_096035919.1|270409_272062_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017043302.1|272157_272619_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_017043301.1|272637_273096_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_013857910.1|273347_274328_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_096035920.1|274538_274748_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_096035921.1|274847_275504_+	TIGR04219 family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_157733251.1|275669_275828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096035922.1|275832_276954_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_096035923.1|277255_279109_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_096035924.1|279108_280842_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_017047140.1|280834_281587_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_013857902.1|299488_300835_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	37.7	2.6e-38
WP_096035926.1|300951_304629_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	84.7	5.4e-25
WP_076611988.1|304643_305813_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
>prophage 3
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	385101	450499	3323092	integrase,tRNA,protease,transposase	Staphylococcus_phage(16.67%)	49	421261:421320	452195:452981
WP_026027213.1|385101_385821_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_096035955.1|385964_386885_+	glutaminase B	NA	NA	NA	NA	NA
WP_096035956.1|386966_388124_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017042394.1|388123_388723_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_013857823.1|388735_389167_-	DUF4426 domain-containing protein	NA	NA	NA	NA	NA
WP_026028229.1|389209_389500_-	YggU family protein	NA	NA	NA	NA	NA
WP_010320643.1|389499_390057_-	YggT family protein	NA	NA	NA	NA	NA
WP_096036776.1|390127_390946_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_096035957.1|391007_391709_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_013857819.1|391734_392772_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_017048293.1|392782_393889_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_017045508.1|393957_394386_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017045507.1|394468_395032_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_040122940.1|395078_396032_-	glutathione synthase	NA	NA	NA	NA	NA
WP_096035958.1|396045_396777_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_010320653.1|397731_398232_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_096036777.1|398299_399454_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.3	2.1e-124
WP_172858985.1|399784_401794_+	transketolase	NA	NA	NA	NA	NA
WP_019282284.1|401857_402760_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096035960.1|402907_404863_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	28.3	1.7e-09
WP_026027970.1|405062_406088_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_026027969.1|406236_407400_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_013857804.1|407553_408630_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_172858986.1|408863_409790_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_017047512.1|409864_410497_-	amino acid transporter	NA	NA	NA	NA	NA
WP_017045436.1|410619_411516_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_038148141.1|411618_412311_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_096035962.1|412476_414342_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_026027602.1|414445_415858_-	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_013857797.1|416282_417044_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017045440.1|417131_418964_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HRE7	Paramecium_bursaria_Chlorella_virus	44.4	1.4e-130
WP_096035963.1|419234_421046_-	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
421261:421320	attL	GGTCGTGACTCCAACATGGAGATGTTGTGTTAAAATGGTAGCCTTTTCACCCTCAAATTA	NA	NA	NA	NA
WP_172858976.1|421326_422023_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_157733252.1|422075_422894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096035965.1|422896_423844_+	DUF1848 domain-containing protein	NA	NA	NA	NA	NA
WP_096035966.1|424041_424872_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096035967.1|424855_426946_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_096035968.1|426942_428580_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_096035969.1|428580_430125_+	TniQ family protein	NA	NA	NA	NA	NA
WP_096035970.1|430082_431690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096035971.1|432042_432963_+	DUF4007 family protein	NA	NA	NA	NA	NA
WP_096035972.1|432955_436225_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_096035973.1|436214_437048_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_096035974.1|437251_439081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096035975.1|439080_440613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096035976.1|440609_445970_+	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	31.1	1.3e-35
WP_019281920.1|446238_447045_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_019281921.1|447034_449116_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_076611988.1|449329_450499_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
452195:452981	attR	TAATTTGAGGGTGAAAAGGCTACCATTTTAACACAACATCTCCATGTTGGAGTCACGACCTATCGTGGAGTATAAATACCATCGTTCTAATGAAGGAAGTGAGAATGAGTATTTCTATAATGCTCTCTATAAAGGTTTATCAGGAGAGTATGCTTTTGATGTTCATACTTTGAATGAAGAAGAAAAAGCAAAGATAAATGAAAAAGTTAAGTTATTTATGAAAGATATTACACCAATGATATATATCGATGGCTTTACTAGCCGTGATGACTGGGTGGATTAGTTGCTAAGGCAAATACTTTAGCCGATATAATACGGCATAAACTACCTAAACCCTTAGGGTAAAAACAACATCGCAACAAGCTTAATCAACGAATCTGATAAGGAGCAAATCAATGGCAAATGGTGCATTAGTAGGAGATATCGGATCCGATCATGATGGTTTTCCTCCGACGCCGATCACCGCTGGGTCACCGACGGTAAAAATTGATGGCAAAGCGGTGGCAAGGCAGGGCGACCCGCTAGAGCCTCATGATAAGCCGAACAACCCAAGCCACCCGCGTGCAATTAAAGGCGGCTCGGGTAGTGTTATGATTGATGGCAAGCCCGCCGCGCGAGTCGGCGATGCCGTTGACTGCGGTGGCGTAATTATTGGTGGTTCATCGGTCAATATTGGTTAAGGTTGTAGCCCATTTAATCAATAAAGCGGCGCTTCAAACCTTGAGTGCCGCTTTATTGTTTTAAGCGCAGCACCTTTAGCACCAGTGAGCCAGCGTTATCCCTCTTT	NA	NA	NA	NA
>prophage 4
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	467446	475943	3323092	transposase	uncultured_Mediterranean_phage(28.57%)	8	NA	NA
WP_010320454.1|467446_468193_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.5	1.0e-68
WP_013857716.1|468192_468819_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.9	8.0e-38
WP_172859039.1|468824_469757_+	murein hydrolase activator NlpD	NA	I3PV79	Clostridium_phage	32.8	7.7e-13
WP_096035986.1|469829_470831_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.8	3.5e-35
WP_096036778.1|470989_472543_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.3	2.8e-68
WP_096035987.1|472602_472956_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.1	3.1e-15
WP_094499630.1|472952_473273_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096035988.1|473354_475943_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	20.8	1.8e-35
>prophage 5
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	639064	703922	3323092	transposase,integrase	uncultured_virus(18.75%)	53	632243:632257	643069:643083
632243:632257	attL	TACAGTTGGGAAATA	NA	NA	NA	NA
WP_096036032.1|639064_640242_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.8	1.9e-117
WP_096036033.1|641485_642895_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_096036034.1|642971_643316_-	hypothetical protein	NA	A0A218MNF2	uncultured_virus	76.3	9.1e-28
643069:643083	attR	TATTTCCCAACTGTA	NA	NA	NA	NA
WP_011788455.1|643323_643773_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	57.1	4.1e-36
WP_096036035.1|643882_644806_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_096036036.1|645484_646390_+	DNA polymerase III subunit epsilon	NA	A0A2H4P6W5	Pseudomonas_phage	24.6	8.1e-07
WP_008305543.1|646603_646903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036037.1|647220_648144_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_041588353.1|648292_648520_+	helix-turn-helix transcriptional regulator	NA	S5MTW4	Brevibacillus_phage	45.3	2.2e-06
WP_096036038.1|648519_650574_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	32.7	1.0e-20
WP_096036039.1|650570_651866_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_096036040.1|651868_652525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036041.1|652521_653931_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_096036042.1|653940_658074_+	protein kinase	NA	A0A2R8FG14	Cedratvirus	25.4	1.5e-12
WP_096036043.1|658070_659717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036044.1|659713_665176_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_096036045.1|665339_667490_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_096036046.1|667537_669358_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_096036047.1|669367_669928_+	conjugative transfer protein	NA	NA	NA	NA	NA
WP_011788471.1|669914_670550_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_096036048.1|670688_671795_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	21.9	7.5e-07
WP_096036049.1|671996_672287_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_096036050.1|672512_672794_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000667170.1|672790_673417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036779.1|673400_674297_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_096036051.1|674299_675589_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_157733254.1|675663_676236_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_096036053.1|676232_676619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036054.1|676683_677604_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_096036055.1|677593_678130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001228924.1|678506_679199_+	DsbC family protein	NA	NA	NA	NA	NA
WP_096036056.1|679198_681598_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_011788500.1|681590_681938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172858988.1|681921_682434_+	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_096036057.1|682444_683569_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_096036058.1|683552_684581_+	TraU family protein	NA	NA	NA	NA	NA
WP_096036059.1|684583_688276_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_096036060.1|688485_689655_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_096036061.1|689955_690558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036062.1|690925_691252_+	plasmid-related protein	NA	NA	NA	NA	NA
WP_012368368.1|691267_691687_+	single-stranded DNA-binding protein	NA	A0A0R6PHK0	Moraxella_phage	41.4	1.9e-19
WP_096036063.1|691766_692585_+	phage recombination protein Bet	NA	A0A0N7C1T0	Escherichia_phage	53.5	2.3e-53
WP_015066581.1|692666_692810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036064.1|692870_693887_+	YqaJ viral recombinase family protein	NA	U6C712	Ralstonia_phage	37.4	6.9e-07
WP_096036065.1|694096_695056_+	CbbQ/NirQ/NorQ C-terminal domain-containing protein	NA	L7TKP0	Rhizobium_phage	35.0	6.5e-31
WP_096036066.1|695055_695823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036067.1|695921_696875_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_096036068.1|696936_697377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036069.1|697446_699102_+	VWA domain-containing protein	NA	L7TNG1	Rhizobium_phage	29.8	8.4e-10
WP_096036070.1|699185_699683_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_001014428.1|699682_700024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086558351.1|700720_701959_-|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_096036072.1|702744_703922_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.8	1.9e-117
>prophage 6
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	718394	785222	3323092	tRNA,integrase,transposase	Vibrio_phage(20.0%)	41	736297:736356	758362:759459
WP_096036080.1|718394_719117_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_013857601.1|719425_720739_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_096036081.1|720909_722007_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	41.4	4.1e-05
WP_013857598.1|722041_723574_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.4	7.3e-85
WP_013857597.1|723836_725171_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_010319130.1|725670_725922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013857595.1|725959_726994_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_026028083.1|727128_727794_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_010319133.1|728408_728927_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_088720923.1|728929_731176_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.4	1.1e-12
WP_094164870.1|731184_731976_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013857591.1|732019_732823_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_096036082.1|734401_735517_+|transposase	ISAs1-like element ISVa13 family transposase	transposase	NA	NA	NA	NA
WP_157733255.1|735597_736308_+	hypothetical protein	NA	NA	NA	NA	NA
736297:736356	attL	TTATACCCGTGATCATTGAAGATGCTTGATTTTCAATAGAATCAGGATCATGCTACAAAC	NA	NA	NA	NA
WP_026027704.1|736357_737389_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036084.1|737395_738646_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_096035882.1|739326_740752_+|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_096036086.1|742867_743728_-	thymidylate synthase	NA	H9EB68	Vibrio_phage	76.9	2.1e-129
WP_088728637.1|743875_744082_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096036087.1|744175_744718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611262.1|745140_746448_+|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
WP_022609500.1|747564_747870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611988.1|749048_750218_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_096035882.1|750329_751756_-|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_096036088.1|752192_753839_+	ABC transporter	NA	NA	NA	NA	NA
WP_096036089.1|753835_755968_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	27.8	6.7e-12
WP_096036090.1|755960_757274_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_026027704.1|757328_758360_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036091.1|758491_769111_-	cadherin-like domain-containing protein	NA	NA	NA	NA	NA
758362:759459	attR	GTTTGTAGCATGATCCTGATTCTATTGAAAATCAAGCATCTTCAATGATCACGGGTATAAAATAGAATAGAAATAAAAAGGAACGCTCAATAGCGTTCCTTTTTTGGTTTTAGTGATTCCATTTTATGAGCTAACTATTGGGATCAATGTCTGGTAAATCATCGACTTGATTATGATGTTGCGTGTCATCGTGATCCTGTTGGTTAGTATCATGTTCATGTCCTTGGTGTTCAAGCGCGTCCGATAAATCTATATGTGAAACATCATCATGCCCTAATGCAGCATGATCCGCCTCTGCCATCACAATATCGATATCTGCAGGTAATTGATGTTCAATTGCATCATTAGCTGATGGAGGCGGTGGTGAAATACCTAACGCATCAAGATAAGCAGCAGCGCCAGTAACAGGGTGAGCATTTACTGCTTGATGTTGGCTATCGGGGACAACGAGACCAACATCATCAAGGGTGACAGAAATATCTTCACTCGTTTCAGCACTAAAGTCAGGTTCATCATGTTGTACTGGCGGTGGTGGCGCTGGTGACGTTAATGGATCATCAACCCCATTCACATTAATTGTTATTGTATGAGAAGCAGTATTATCTGGTGAGTTTATTGTAAAGGTTTCTGTTCCACCCTGCGCAGCGCTTAATGAGTTTGTAGTCGCCAAACTATTATCAAGATGATATACCCAGTCTCCATTGGCTGCTAATTCTAGATGTCCATAAGTTCCTGCAATGTGTGGATCTGGTATGAACTGATCTTCACCATGATCGGCATCGACTAAATTCAAGTGGCCTGCTAAGGTATCCTTCGCAGCATCTTCTGTAATTGTACTTACGCTTTTACTTGTCATAGTACCATTAATAGTCGCACCATCATTTTTACCCGTAACCGCGATAATAACTTGTTCGGTAGCGACCTCTTTACCATTCTGTAAGCCATGGATAGTGAAGTGCTCCTGCTCTACCTGACCTGCTTTTAGGGCATTAAGATCTTTATTGGCCCAATGTTGATCGCCATCATGATCAAGGAAATAAATCCATGTACCACCTGTTGATATTTGTAAGTGGCCATACTTACCCTGAATCATATTAG	NA	NA	NA	NA
WP_017037717.1|769297_769615_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096036092.1|769611_769965_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.6	4.5e-14
WP_086558331.1|772074_773694_+|transposase	IS1634-like element ISVa17 family transposase	transposase	NA	NA	NA	NA
WP_172858976.1|773791_774489_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_166538009.1|775701_775980_+	thymidylate synthase	NA	H9EB68	Vibrio_phage	79.3	2.1e-35
WP_096036093.1|776083_777229_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_026027442.1|777600_778491_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_026028082.1|778765_779059_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_026027444.1|779212_779473_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_026028080.1|779730_781293_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_026028079.1|781364_782300_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_096036094.1|782363_785222_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.1	1.2e-80
>prophage 7
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	855900	925630	3323092	tRNA,transposase	Leptospira_phage(18.75%)	60	NA	NA
WP_096036114.1|855900_856629_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_096036115.1|856744_857266_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_096036116.1|857292_858507_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.4	1.8e-30
WP_010320409.1|858563_858947_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	1.8e-53
WP_010320408.1|859009_859333_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	53.3	3.6e-26
WP_096036117.1|859399_859915_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_096036118.1|859936_861796_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.4	5.0e-112
WP_010320405.1|861807_862146_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_010320404.1|862196_862391_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_026028095.1|862575_863871_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.5	1.1e-33
WP_013857494.1|863943_864369_+	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	41.4	2.7e-21
WP_026028096.1|864578_865700_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_094132401.1|866001_866946_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_010320399.1|866954_868079_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_017044251.1|868104_869373_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_096036119.1|869411_870026_+	YfgM family protein	NA	NA	NA	NA	NA
WP_096036120.1|870038_871199_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_096036121.1|871348_872836_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_019282103.1|873426_873681_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_088720949.1|873685_875017_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.0	4.2e-36
WP_026028100.1|875249_876713_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.8	2.0e-95
WP_096036123.1|876794_878348_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_096036124.1|878607_879465_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_157733257.1|879745_879901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036125.1|879952_880273_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|880269_880623_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_096036126.1|880682_882215_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_096036127.1|884033_884642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036128.1|884734_886279_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_096036129.1|886577_887837_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_096036130.1|888013_888619_-	DedA family protein	NA	NA	NA	NA	NA
WP_017046265.1|888835_889156_+	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_096036131.1|889460_891635_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_096036132.1|892513_893251_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	50.9	1.0e-55
WP_172858989.1|893704_893866_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	51.9	4.4e-09
WP_172858990.1|894027_896373_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_096036135.1|896794_897931_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_096036136.1|897934_898798_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_096036137.1|898785_899508_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_019281732.1|899722_900688_+	sialic acid TRAP transporter substrate-binding protein SiaP	NA	NA	NA	NA	NA
WP_095661341.1|900741_901263_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_020327936.1|901268_902552_+	sialic acid TRAP transporter large permease SiaM	NA	NA	NA	NA	NA
WP_096036139.1|902589_903489_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_019281735.1|903619_904456_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096036140.1|904647_905799_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_019281737.1|905813_906881_+	YjhT family mutarotase	NA	NA	NA	NA	NA
WP_086558351.1|907701_908940_-|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_019283195.1|910261_910615_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_019283194.1|910611_910932_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096036141.1|911678_912887_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_096036142.1|912876_913317_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_019282484.1|913375_914260_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_096036143.1|914249_915038_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_019282487.1|915552_916710_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_096035917.1|917511_918900_+|transposase	IS4-like element ISVa18 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.8	1.3e-48
WP_019282489.1|919538_920315_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_096036782.1|920740_921508_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_086558351.1|921593_922832_+|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_096036144.1|923647_924070_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_096035882.1|924204_925630_+|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	1027784	1091478	3323092	tRNA,transposase	Burkholderia_phage(14.29%)	57	NA	NA
WP_096035882.1|1027784_1029211_-|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_026027704.1|1029601_1030633_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036187.1|1031243_1032560_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_096036188.1|1032631_1033246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017045834.1|1033797_1034499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036189.1|1034501_1036706_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017045832.1|1036719_1037238_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_096036190.1|1037244_1038435_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_096036191.1|1038455_1039850_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_088728717.1|1040223_1040823_-	YitT family protein	NA	NA	NA	NA	NA
WP_013857345.1|1041169_1042420_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.5	9.5e-99
WP_076612072.1|1042541_1043810_+|transposase	IS4-like element ISVa14 family transposase	transposase	NA	NA	NA	NA
WP_013857344.1|1043937_1044264_-	hypothetical protein	NA	A0A0U3TE12	Vibrio_phage	56.0	8.4e-23
WP_013857343.1|1044410_1045379_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_096036192.1|1045384_1046038_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_010317329.1|1046251_1046530_-	YbeD family protein	NA	NA	NA	NA	NA
WP_017045828.1|1046649_1047828_-	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	46.0	3.4e-90
WP_017043435.1|1047920_1048703_-	septal ring lytic transglycosylase RlpA family protein	NA	I3ULW5	Synechococcus_phage	48.8	5.3e-15
WP_013857338.1|1048705_1049827_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_013857337.1|1049826_1051707_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_013857336.1|1051713_1052184_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_013857335.1|1052187_1052505_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_096036193.1|1052567_1053593_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_096036194.1|1053602_1054229_-	luciferase	NA	NA	NA	NA	NA
WP_094132785.1|1054365_1056939_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.7	1.5e-186
WP_026029014.1|1057061_1057532_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_094165695.1|1057583_1059104_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_010317353.1|1059137_1060013_-	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_013857329.1|1060098_1060563_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_096036195.1|1060562_1061663_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	43.8	3.3e-47
WP_096036196.1|1061733_1063158_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_096036197.1|1063425_1064577_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_094124745.1|1064657_1065167_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_096036198.1|1065273_1066998_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	25.8	1.9e-17
WP_026027491.1|1067136_1067394_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013857323.1|1067692_1068661_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.5	3.9e-68
WP_096036199.1|1068818_1069571_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_096036200.1|1069801_1070626_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_096036201.1|1070686_1072702_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	48.1	5.2e-139
WP_013857319.1|1073207_1074320_+	porin	NA	NA	NA	NA	NA
WP_096036202.1|1074382_1075180_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_017043453.1|1075292_1075712_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_096036203.1|1075833_1076301_-	NfeD family protein	NA	NA	NA	NA	NA
WP_013857314.1|1076308_1077232_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_096036204.1|1077539_1078394_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_096036205.1|1078793_1079708_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_157733260.1|1079936_1080494_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_017045494.1|1080511_1080790_-	SelT/SelW/SelH family protein	NA	NA	NA	NA	NA
WP_026027495.1|1080873_1081389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036207.1|1081399_1082266_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_013857307.1|1082524_1084432_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.3	1.7e-107
WP_172858976.1|1084607_1085305_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_013857306.1|1085545_1086190_+	adenylate kinase	NA	NA	NA	NA	NA
WP_096036208.1|1086305_1087274_+	ferrochelatase	NA	NA	NA	NA	NA
WP_026028956.1|1087362_1088751_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.3	1.2e-70
WP_076611988.1|1088927_1090097_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_076611988.1|1090308_1091478_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
>prophage 9
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	1145947	1192599	3323092	transposase	Leptospira_phage(18.18%)	42	NA	NA
WP_096036126.1|1145947_1147480_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_019283195.1|1147539_1147893_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_019283194.1|1147889_1148210_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096036072.1|1148430_1149608_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.8	1.9e-117
WP_096036225.1|1150874_1152347_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	52.6	1.2e-132
WP_096036227.1|1152538_1152766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036228.1|1152813_1153182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036229.1|1153212_1153947_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_017044431.1|1154085_1154262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036230.1|1154265_1154709_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_172858994.1|1154759_1155197_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_096036232.1|1155193_1155667_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_026027704.1|1155915_1156947_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_013856523.1|1157026_1157569_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_172858995.1|1157669_1158521_-	phosphotransferase	NA	NA	NA	NA	NA
WP_013856521.1|1158555_1159146_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_013856520.1|1159168_1159558_-	YcfL family protein	NA	NA	NA	NA	NA
WP_017042311.1|1159557_1160949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026027183.1|1161016_1161367_-	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_172858976.1|1162815_1163512_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_096036234.1|1163509_1164493_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_029189790.1|1164823_1166113_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013856525.1|1166225_1168295_-	hemolysin	NA	NA	NA	NA	NA
WP_088732653.1|1168705_1169476_-	peptidoglycan binding protein CsiV	NA	NA	NA	NA	NA
WP_096036235.1|1169504_1172966_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_096036236.1|1172974_1173544_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_096036237.1|1173709_1174918_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_096036238.1|1174910_1175597_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	42.2	6.5e-41
WP_017042301.1|1175597_1176842_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_096036239.1|1176996_1177506_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_172859042.1|1177587_1179756_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	26.2	8.4e-18
WP_096036241.1|1179788_1181537_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	28.8	1.1e-57
WP_096036242.1|1181540_1182548_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_013856535.1|1182528_1182708_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_096036243.1|1182707_1183466_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_096036244.1|1183543_1185082_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_017042294.1|1185094_1186366_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.9e-10
WP_013856540.1|1186448_1188383_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_013856541.1|1188671_1189172_-	YfbU family protein	NA	NA	NA	NA	NA
WP_017048072.1|1189295_1189961_-	energy-coupling factor ABC transporter permease	NA	NA	NA	NA	NA
WP_013856543.1|1190025_1190766_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	32.0	2.6e-27
WP_172858976.1|1191902_1192599_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
>prophage 11
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	1358481	1409816	3323092	tRNA,plate,transposase,protease	Escherichia_phage(16.67%)	43	NA	NA
WP_172858976.1|1358481_1359178_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_029189803.1|1359407_1360799_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013856681.1|1360825_1361356_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_013856682.1|1361425_1361935_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_064625423.1|1361934_1363416_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013856684.1|1363462_1364818_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013856685.1|1364814_1365231_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_019280942.1|1365223_1367005_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_013856687.1|1366986_1367970_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_096036286.1|1367978_1370585_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.8	2.2e-81
WP_013856689.1|1370727_1371882_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_096036287.1|1371891_1374087_+	MFS transporter	NA	NA	NA	NA	NA
WP_096036288.1|1374083_1375217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013856692.1|1375219_1375915_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_029189804.1|1375948_1376896_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_019282548.1|1376895_1377363_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_019282547.1|1377362_1378679_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_013856696.1|1378686_1379829_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_096036289.1|1379830_1383283_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_029189805.1|1383291_1383924_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_013856699.1|1383939_1385829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036290.1|1386206_1387383_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.5	1.4e-115
WP_019282907.1|1387706_1388417_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019282908.1|1388370_1388898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013856703.1|1389026_1389815_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013856704.1|1389798_1390281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013856705.1|1390485_1391490_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096035882.1|1392282_1393708_+|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_026027608.1|1394032_1394929_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_064624995.1|1394934_1396233_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_094165746.1|1396232_1397273_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_013857094.1|1397353_1398427_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_096036291.1|1398426_1399089_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_096036292.1|1399820_1400594_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_017043909.1|1400590_1401226_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_096036293.1|1401276_1402062_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_026028830.1|1402321_1404547_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_013857087.1|1404627_1404849_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	3.3e-15
WP_010319243.1|1405322_1405643_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.2	1.6e-13
WP_013857086.1|1405685_1407956_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.7	6.4e-170
WP_006075347.1|1408098_1408317_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_013857085.1|1408398_1409097_-	arginyltransferase	NA	NA	NA	NA	NA
WP_096036294.1|1409099_1409816_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	1473796	1539806	3323092	transposase	Bacillus_virus(14.29%)	49	NA	NA
WP_026027704.1|1473796_1474828_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_017049857.1|1475295_1475934_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_019282608.1|1475926_1476574_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.3	5.7e-23
WP_096036318.1|1476539_1478261_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096036319.1|1478281_1479421_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026028018.1|1479624_1480068_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_096036320.1|1480223_1480484_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_172859001.1|1480488_1480698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036322.1|1480997_1482914_+	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013857026.1|1482975_1483596_-	LysE family translocator	NA	NA	NA	NA	NA
WP_096036323.1|1483796_1485083_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	30.6	1.7e-50
WP_017046184.1|1485373_1485730_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_096036324.1|1485731_1486124_-	RRF family protein	NA	NA	NA	NA	NA
WP_010318386.1|1486289_1486568_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_096036325.1|1486795_1488136_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_010318384.1|1488125_1488785_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	31.2	1.0e-06
WP_157733265.1|1488794_1489184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282882.1|1489246_1490989_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.3	1.8e-95
WP_017044313.1|1491093_1491789_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_013857017.1|1491836_1493045_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_017046180.1|1493044_1493704_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_019282881.1|1493746_1495240_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_086558331.1|1496387_1498007_-|transposase	IS1634-like element ISVa17 family transposase	transposase	NA	NA	NA	NA
WP_013857013.1|1498606_1499278_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	3.4e-26
WP_013857012.1|1499258_1501712_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_096036326.1|1501712_1502846_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_026027720.1|1503126_1504272_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.4	1.8e-96
WP_096036327.1|1504815_1507704_+	diaminobutyrate--2-oxoglutarate transaminase family protein	NA	S4W1T5	Pandoravirus	29.6	1.6e-16
WP_017044304.1|1507720_1508965_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013857007.1|1509029_1510163_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_096036147.1|1510612_1510933_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_061778452.1|1510929_1511283_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.2	7.0e-15
WP_076611502.1|1511342_1512875_+|transposase	IS66-like element ISVa12 family transposase	transposase	S5VTP8	Leptospira_phage	39.5	1.2e-23
WP_076611988.1|1514581_1515751_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_013857004.1|1515930_1516443_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_096036329.1|1516645_1517539_-	DUF3943 domain-containing protein	NA	NA	NA	NA	NA
WP_094127013.1|1517734_1518973_+	CinA family nicotinamide mononucleotide deamidase-related protein	NA	NA	NA	NA	NA
WP_013857001.1|1519236_1519491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013857000.1|1519558_1519837_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_010318364.1|1519836_1520970_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	74.7	1.4e-165
WP_096036330.1|1521038_1523321_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2I7S840	Vibrio_phage	69.1	1.3e-308
WP_094165834.1|1523801_1524509_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017044297.1|1524803_1527527_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.9	1.9e-104
WP_017046166.1|1527884_1529531_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.9	2.9e-23
WP_019281353.1|1531047_1531542_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_013856991.1|1531553_1533059_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_013856990.1|1533318_1534410_+	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_096035882.1|1534606_1536033_-|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_026027704.1|1538774_1539806_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	1547198	1643051	3323092	transposase	uncultured_Caudovirales_phage(28.57%)	54	NA	NA
WP_172858976.1|1547198_1547896_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_013856975.1|1548620_1548896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017042466.1|1549155_1549332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172859002.1|1549427_1550624_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_096036333.1|1550777_1552676_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_096035882.1|1553081_1554507_+|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_017049831.1|1554574_1555477_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096036334.1|1555479_1556274_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_096036335.1|1556280_1556577_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_013856968.1|1556681_1557089_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_026027228.1|1557128_1557407_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_013856966.1|1557403_1557607_-	(Na+)-NQR maturation NqrM	NA	NA	NA	NA	NA
WP_096036336.1|1557606_1558089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026027227.1|1558644_1559619_+	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_026027704.1|1559683_1560715_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_076611649.1|1561208_1562324_+|transposase	ISAs1-like element ISVa13 family transposase	transposase	NA	NA	NA	NA
WP_013856962.1|1564416_1565424_+	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_096036337.1|1565517_1566450_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064626127.1|1566573_1567665_+	alkene reductase	NA	NA	NA	NA	NA
WP_013856959.1|1567769_1568138_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_096036338.1|1568301_1569600_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_013856957.1|1569627_1570329_-	response regulator	NA	NA	NA	NA	NA
WP_017046152.1|1570469_1571996_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_010318351.1|1572005_1572503_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_017047673.1|1572705_1573677_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_096036789.1|1573927_1574758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026028009.1|1575030_1575741_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017046149.1|1575854_1576751_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_096036339.1|1576777_1577905_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_096036340.1|1578014_1580621_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_019282820.1|1580617_1581808_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_094125323.1|1581835_1583713_+	propionyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	31.9	2.4e-69
WP_017046144.1|1583937_1584420_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_064625135.1|1584449_1585874_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_064625137.1|1585932_1586751_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_081265485.1|1586925_1587594_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.2	2.2e-09
WP_170899192.1|1587604_1588300_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	63.6	5.1e-78
WP_013856942.1|1588423_1588774_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_017046139.1|1588891_1589527_-	OmpA family protein	NA	NA	NA	NA	NA
WP_013856940.1|1589507_1590818_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_096036341.1|1591250_1603598_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_096036342.1|1603594_1610197_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_172858975.1|1627157_1629809_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_019282622.1|1629870_1631064_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096035882.1|1631380_1632807_-|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_172859003.1|1634212_1634491_+	acylphosphatase	NA	NA	NA	NA	NA
WP_064625147.1|1634547_1634877_-	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_010318447.1|1635003_1635672_-	Bax inhibitor-1 family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	43.0	5.9e-31
WP_013856933.1|1635876_1636644_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	6.8e-31
WP_026028006.1|1636664_1637762_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_088728833.1|1637763_1638969_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_026027113.1|1639038_1640067_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.5	9.3e-76
WP_017044682.1|1640524_1641445_+	siroheme synthase	NA	NA	NA	NA	NA
WP_076611649.1|1641935_1643051_+|transposase	ISAs1-like element ISVa13 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	1672261	1718144	3323092	integrase,transposase,protease	Vibrio_phage(56.25%)	53	1675431:1675446	1709552:1709567
WP_172858976.1|1672261_1672959_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_010320557.1|1673207_1673750_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_096036352.1|1674226_1676356_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
1675431:1675446	attL	GTTTAAAGAAAAATAT	NA	NA	NA	NA
WP_013856908.1|1676359_1676608_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_017041963.1|1676585_1678502_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	6.8e-56
WP_096036353.1|1678511_1680401_+	DUF3466 family protein	NA	NA	NA	NA	NA
WP_010320553.1|1680570_1680744_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_013856904.1|1680880_1681399_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_096036354.1|1681470_1683114_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_026027109.1|1683278_1683728_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_017047648.1|1683742_1684060_+	DUF3634 family protein	NA	NA	NA	NA	NA
WP_096036355.1|1684188_1684524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086558351.1|1685624_1686863_-|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_157733266.1|1686911_1687121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036790.1|1687549_1687729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036356.1|1687827_1688136_-	hypothetical protein	NA	G8IRU6	Vibrio_phage	52.1	1.5e-21
WP_096036357.1|1688137_1689376_-	replication initiation factor domain-containing protein	NA	G8IRU5	Vibrio_phage	56.7	9.9e-133
WP_096036358.1|1689368_1689587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172859004.1|1689589_1690156_-	3'-5' exonuclease	NA	W6ASW5	Vibrio_phage	55.5	1.3e-50
WP_096036360.1|1690329_1690722_+	hypothetical protein	NA	Q858Q3	Vibrio_phage	73.7	2.1e-44
WP_013867780.1|1690874_1691063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160117742.1|1691211_1691370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036361.1|1691500_1692799_+	hypothetical protein	NA	J7I3Z6	Enterobacteria_phage	41.3	5.2e-84
WP_096036362.1|1692811_1693087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172859005.1|1693089_1693320_+	hypothetical protein	NA	G8IRU7	Vibrio_phage	74.7	2.6e-26
WP_096036363.1|1693349_1693568_+	hypothetical protein	NA	R9TRU5	Vibrio_phage	63.6	1.4e-10
WP_096036364.1|1693702_1695061_+	hypothetical protein	NA	G8IRU9	Vibrio_phage	24.1	1.4e-18
WP_096036365.1|1695060_1695405_+	DUF2523 domain-containing protein	NA	Q64EV1	Vibrio_phage	62.8	3.1e-20
WP_096036366.1|1695407_1696772_+	toxin	NA	R9TQ09	Vibrio_phage	69.9	7.0e-164
WP_157733268.1|1696785_1696926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036367.1|1697135_1697324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036368.1|1697596_1697986_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096036369.1|1698106_1699249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036370.1|1699260_1699539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036372.1|1699821_1700076_+	RstC protein	NA	NA	NA	NA	NA
WP_096036367.1|1700278_1700467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036368.1|1700739_1701129_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096036369.1|1701249_1702392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036370.1|1702403_1702682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036372.1|1702964_1703219_+	RstC protein	NA	NA	NA	NA	NA
WP_096036373.1|1703549_1703765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157733269.1|1703968_1705096_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_096036375.1|1705088_1706207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036376.1|1706207_1706714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036377.1|1706715_1709238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088732402.1|1709234_1709693_+	hypothetical protein	NA	NA	NA	NA	NA
1709552:1709567	attR	GTTTAAAGAAAAATAT	NA	NA	NA	NA
WP_096036378.1|1709700_1710126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096035946.1|1710226_1710661_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_096035945.1|1710660_1712052_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011154682.1|1712129_1712714_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	36.8	6.7e-23
WP_096035944.1|1712833_1715776_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.1	1.3e-50
WP_167372366.1|1716145_1716301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036126.1|1716611_1718144_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
>prophage 15
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	1721676	1778785	3323092	tRNA,transposase	Leptospira_phage(26.67%)	53	NA	NA
WP_096036381.1|1721676_1722826_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.1	1.8e-51
WP_096036382.1|1723129_1724068_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_096036383.1|1724068_1724998_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_076611502.1|1725210_1726743_-|transposase	IS66-like element ISVa12 family transposase	transposase	S5VTP8	Leptospira_phage	39.5	1.2e-23
WP_157733271.1|1726802_1727108_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.6	1.7e-14
WP_096036147.1|1727204_1727525_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_061778452.1|1727521_1727875_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.2	7.0e-15
WP_076611502.1|1727934_1729467_+|transposase	IS66-like element ISVa12 family transposase	transposase	S5VTP8	Leptospira_phage	39.5	1.2e-23
WP_096036147.1|1729538_1729859_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096036791.1|1731140_1732613_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.5	4.2e-130
WP_026027333.1|1733880_1735308_+	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_013856896.1|1735320_1735935_+	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_010320252.1|1735944_1736121_+	CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone	NA	NA	NA	NA	NA
WP_096036386.1|1736117_1737095_+	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_017042885.1|1737181_1737661_+	FixH family protein	NA	NA	NA	NA	NA
WP_013856892.1|1740036_1740207_+	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_013856891.1|1740203_1740884_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010320258.1|1740972_1741725_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_096036387.1|1741852_1742800_+	universal stress protein UspE	NA	NA	NA	NA	NA
WP_013856889.1|1742942_1743875_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	79.2	3.3e-120
WP_017047641.1|1743941_1744604_-	DUF2987 domain-containing protein	NA	NA	NA	NA	NA
WP_013856887.1|1744606_1745413_-	glucosaminidase domain-containing protein	NA	NA	NA	NA	NA
WP_094123675.1|1745405_1746197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036388.1|1746516_1747653_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.5	5.3e-32
WP_026027331.1|1747636_1748494_+	spermidine/putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
WP_096036389.1|1748493_1749264_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_103261224.1|1749418_1750405_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_096036390.1|1750530_1751568_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_064625196.1|1751599_1752337_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	29.3	2.7e-16
WP_096036391.1|1752506_1753727_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.2	1.0e-44
WP_017042874.1|1754073_1755663_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.0	7.7e-53
WP_013856877.1|1755899_1756535_+	response regulator	NA	NA	NA	NA	NA
WP_096036392.1|1756543_1758163_+	MASE1 domain-containing protein	NA	NA	NA	NA	NA
WP_013856875.1|1758250_1759582_+	MFS transporter family glucose-6-phosphate receptor UhpC	NA	NA	NA	NA	NA
WP_013856874.1|1759708_1760743_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026027999.1|1760852_1762949_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_017044718.1|1762966_1764022_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	5.3e-34
WP_172859006.1|1764290_1764878_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_017044720.1|1764874_1765396_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_026027239.1|1765585_1765861_+	DUF2960 domain-containing protein	NA	NA	NA	NA	NA
WP_096036394.1|1765940_1766852_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_026027704.1|1766967_1767999_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_017042509.1|1768107_1768839_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_096036395.1|1768931_1769723_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_096036396.1|1769760_1771836_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.9	8.6e-12
WP_019282160.1|1771894_1772407_+	C40 family peptidase	NA	Q5ULI0	Lactobacillus_virus	26.7	7.3e-05
WP_026027237.1|1772418_1772760_-	DUF3802 family protein	NA	NA	NA	NA	NA
WP_017042505.1|1773164_1774031_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_010320526.1|1774188_1774392_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_096036381.1|1774490_1775640_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.1	1.8e-51
WP_026027236.1|1775885_1777256_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_157733272.1|1777334_1777502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076612072.1|1777516_1778785_-|transposase	IS4-like element ISVa14 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	2057929	2120708	3323092	tRNA,transposase	Leptospira_phage(25.0%)	54	NA	NA
WP_017044573.1|2057929_2058631_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_096036485.1|2058639_2060583_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.9	3.5e-92
WP_013857222.1|2060677_2060878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010317194.1|2061065_2061899_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	34.2	3.3e-15
WP_019282282.1|2062026_2064030_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_096036486.1|2064242_2066093_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	31.0	3.5e-17
WP_013857225.1|2066213_2067227_+	asparaginase	NA	NA	NA	NA	NA
WP_013857226.1|2067319_2067604_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_096036487.1|2067705_2068530_+	DUF2989 domain-containing protein	NA	NA	NA	NA	NA
WP_094163341.1|2068577_2068982_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010317219.1|2069319_2070315_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_096036488.1|2070470_2071355_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_013857231.1|2071474_2072296_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_096036489.1|2072354_2073290_+	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_017044563.1|2073440_2073791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010317229.1|2073813_2074254_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_096036490.1|2074503_2075148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283194.1|2075213_2075534_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|2075530_2075884_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_096036126.1|2075943_2077476_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_096036126.1|2077911_2079444_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_019283195.1|2079503_2079857_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_019283194.1|2079853_2080174_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096036492.1|2080498_2080735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036794.1|2080744_2081197_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_096036493.1|2081637_2081883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013857236.1|2081960_2082560_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_013857237.1|2082594_2082924_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_096036494.1|2083006_2085151_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.4	6.7e-44
WP_013857239.1|2085172_2085718_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.0e-29
WP_017044101.1|2085875_2086241_-	YbaN family protein	NA	NA	NA	NA	NA
WP_017044561.1|2086572_2087691_-	response regulator	NA	NA	NA	NA	NA
WP_026027659.1|2087947_2088823_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013857243.1|2088884_2089433_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_096036495.1|2089584_2091708_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_017044104.1|2091707_2093015_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_088717986.1|2093705_2094254_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	28.5	2.0e-05
WP_096036497.1|2094246_2094972_+	DUF3379 domain-containing protein	NA	NA	NA	NA	NA
WP_096036498.1|2095217_2096501_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_096036499.1|2096802_2098077_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_088728742.1|2098205_2098811_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_096036500.1|2098872_2100999_-	AsmA family protein	NA	NA	NA	NA	NA
WP_010320672.1|2101080_2101722_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.3e-32
WP_094149287.1|2101914_2102991_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_096036501.1|2103146_2105213_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	29.9	4.5e-61
WP_013857254.1|2105429_2106242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010320675.1|2106369_2107128_-	uridine phosphorylase	NA	NA	NA	NA	NA
WP_096036502.1|2107462_2109757_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	37.3	5.0e-122
WP_013857256.1|2110043_2110460_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_076611988.1|2111218_2112388_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_026027704.1|2113332_2114364_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036503.1|2115208_2115661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036032.1|2117171_2118349_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.8	1.9e-117
WP_076611988.1|2119538_2120708_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
>prophage 17
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	2209823	2270722	3323092	transposase,integrase,protease	Leptospira_phage(22.22%)	50	2217281:2217298	2268760:2268777
WP_096035882.1|2209823_2211250_-|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_076611502.1|2211637_2213170_-|transposase	IS66-like element ISVa12 family transposase	transposase	S5VTP8	Leptospira_phage	39.5	1.2e-23
WP_096036148.1|2213229_2213583_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.2	7.0e-15
WP_096036147.1|2213579_2213900_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096036534.1|2214401_2215301_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088721201.1|2215646_2217686_-	hypothetical protein	NA	A0A2H4J5Y0	uncultured_Caudovirales_phage	39.8	1.7e-129
2217281:2217298	attL	AGGTTTTTAAACATGTTT	NA	NA	NA	NA
WP_157722359.1|2217742_2217901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036536.1|2218116_2218839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036537.1|2218882_2219590_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096036538.1|2219765_2220326_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	40.8	3.7e-26
WP_096036539.1|2220352_2220565_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096036540.1|2220667_2221207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036541.1|2226267_2226906_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_096036542.1|2226898_2229487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036543.1|2229483_2230959_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_096036544.1|2231402_2233469_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.4	1.6e-13
WP_013856445.1|2233552_2234296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013856444.1|2234365_2234668_+	MGMT family protein	NA	NA	NA	NA	NA
WP_172858976.1|2235178_2235875_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_013856442.1|2235997_2236858_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_017044403.1|2236877_2237339_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017045283.1|2237458_2238526_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_013856439.1|2238583_2239453_-	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_017048569.1|2239631_2240228_+	WHG domain-containing protein	NA	NA	NA	NA	NA
WP_096036545.1|2240237_2242109_+	MFS transporter	NA	NA	NA	NA	NA
WP_013856435.1|2242207_2242606_+	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_094128939.1|2242611_2243322_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	39.8	2.2e-36
WP_096036800.1|2243268_2244915_-	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_096036546.1|2244923_2245904_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_026027256.1|2245998_2246865_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_096036547.1|2246910_2247699_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_096036548.1|2247688_2249413_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_013856429.1|2249409_2250717_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_013856428.1|2250934_2252149_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_026028390.1|2253625_2254210_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_096036549.1|2254268_2255594_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_096036550.1|2255624_2256233_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_017045270.1|2256236_2256830_+	rhombosortase	NA	NA	NA	NA	NA
WP_096036551.1|2256894_2257956_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.6	5.2e-21
WP_017048556.1|2258046_2258790_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_017048555.1|2258921_2259866_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.2	5.2e-33
WP_013856420.1|2259956_2261174_-	ROK family protein	NA	NA	NA	NA	NA
WP_017045267.1|2261453_2262902_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_064625709.1|2262920_2264120_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_094123948.1|2264138_2264228_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_096036552.1|2264266_2264947_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_096036553.1|2265424_2266885_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_010319106.1|2266884_2266980_+	MetS family NSS transporter small subunit	NA	NA	NA	NA	NA
WP_013856413.1|2267342_2268773_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_096035882.1|2269295_2270722_-|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
2268760:2268777	attR	AGGTTTTTAAACATGTTT	NA	NA	NA	NA
>prophage 18
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	2372874	2425464	3323092	tRNA,integrase,transposase	Burkholderia_phage(33.33%)	50	2376580:2376639	2433012:2434361
WP_096036583.1|2372874_2374902_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_026027294.1|2375016_2375541_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013856329.1|2375658_2375922_-	YfcL family protein	NA	NA	NA	NA	NA
WP_096036584.1|2375954_2376485_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
2376580:2376639	attL	GGCTCTTCTCCGCTTTCATGAGTCTGTATGCACAGGCTCATTCATCATAATCACATGATT	NA	NA	NA	NA
WP_076611988.1|2376745_2377915_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_096036585.1|2378075_2378699_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_026028357.1|2378866_2379952_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.2	1.3e-88
WP_086558331.1|2380264_2381884_+|transposase	IS1634-like element ISVa17 family transposase	transposase	NA	NA	NA	NA
WP_013856325.1|2381962_2382895_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013856324.1|2382958_2383489_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_096036586.1|2383545_2384676_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_013856322.1|2384685_2385468_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_013856321.1|2385476_2385746_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_017042736.1|2385757_2386597_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_013856319.1|2386643_2387024_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_010318705.1|2387057_2387468_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_088729043.1|2387485_2388538_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017045735.1|2388545_2389046_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_096036587.1|2391280_2391733_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_013856312.1|2391736_2393059_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_013856311.1|2393058_2393862_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017042742.1|2393892_2394936_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_096036588.1|2394928_2396671_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_010318714.1|2396685_2396997_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_096036589.1|2397081_2398491_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_096036590.1|2398490_2399549_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_088729045.1|2399678_2401145_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_010318718.1|2401393_2401804_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_013856304.1|2401814_2402120_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017047852.1|2402121_2404122_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_013856302.1|2404144_2404573_-	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_026028066.1|2404647_2405778_-	flagellin	NA	NA	NA	NA	NA
WP_019281599.1|2406063_2407197_-	flagellin	NA	NA	NA	NA	NA
WP_096036591.1|2407440_2408574_-	flagellin	NA	NA	NA	NA	NA
WP_096036592.1|2408699_2409602_-	Dyp-type peroxidase	NA	A0A0M5KAH8	Mollivirus	31.2	4.1e-27
WP_088732761.1|2409668_2410136_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_096036593.1|2410315_2410657_+	DUF2956 domain-containing protein	NA	NA	NA	NA	NA
WP_096036594.1|2410661_2411015_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_010318729.1|2411036_2411324_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096036595.1|2411526_2411874_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_096036596.1|2411890_2413024_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_096036597.1|2413027_2413711_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_013856288.1|2413682_2413892_+	DUF2897 family protein	NA	NA	NA	NA	NA
WP_096036598.1|2413935_2414955_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_096036599.1|2415006_2415885_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_096036600.1|2416166_2416709_+	glycine cleavage system protein R	NA	NA	NA	NA	NA
WP_096036601.1|2417149_2418565_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_026027704.1|2420815_2421847_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036082.1|2422038_2423154_+|transposase	ISAs1-like element ISVa13 family transposase	transposase	NA	NA	NA	NA
WP_096036602.1|2423268_2425464_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2433012:2434361	attR	AATCATGTGATTATGATGAATGAGCCTGTGCATACAGACTCATGAAAGCGGAGAAGAGCCCTTTAAGTAATGCATAAAATACTAATTTAGCAAAACCGATAGCTCACAAATGTCCACAAATGAGTTACAGACTCAGAGTCATACTTGTGATCACCGAGCGATTCTGTCGCAATGAAAATCAGCTTCATCTTATAACATCGCCTAAACTTTTTATGACAAGTTCCCGCTTGGAATAGCGTCAAAAATAGCCCAATTTACAAAAAAATATGACAACTGCTATAATTAGGGTTCAAACAAGAAATTTATTAACTTAACTCACTGTTAAAGATAGACTTTATTAAGAATCGTCAAATTTTATGTCTTAGCATATTTCCAAGGGTGGTACCTCATGGGCAAAGTTTATGATGGTCTACACCGGATTAGCTTTTTAATTAACGAGCAAGGTATCATTGAACAGGTTTTTGATAAATTCAAAACCAAAGATCACCATGAAGTGGTACTTGATTATCTAAACGCCCAATAATCAAAGCTCGACTGAAATAAAAAATGCCAGTTCTTAATACTGGCATTTTTGTAACACGGCTAATCAAAAGTTGATGTGTAATTACACAATGAACTTATTGAGCAGAGCATCTTGCTCACGAACGTTTTCCGTTTGAACCTGCATTGCGATATTGGCTTCTTCAGCAGATTGTGCCACTTGCGTCGACAAATCTTTAATCTTCACTGTATTGGTGTTGATCTCTTCAGCCACAAGGCTTTGCTCTTCTGCCGCAGATGCAATTTGGATATTCATGTCCGAAATCACTTGTATCGCATCACGAATACGGTTCAATGCCGAATTTGCCGTTTTCGCTTTATTCACCGCATCAACAGCCGTCGTTTTACTTTCATTCATAGCCGAAGAGACGGAACTTGCCCCTGCTTGTAATTGCTCAATCATACTGCGAATTTCGGTGGTCGATTGTTGAGTGCGCTGAGCTAGTGTACGCACTTCATCAGCAACAACGGCAAAACCACGGCCAGATTCACCCGCTCGAGCCGCTTCAATCGCCGCGTTTAAGGCAAGCAAGTTAGTTTGATCAGCAATGTCATTAATCACTTTCAAAATAGTTTCAATATTCGCCGTCGCGGACTCTAGGCCTTTCACCTCTTCCACCGCTTGGTCAATGCGGGCCGATAAATTGTCGATCGACAATGTCGTTTCACTGACCACACTGGAACCATCTTGCGTTGCTTCATCGGCTTCTTTCGCCGCTGCTGCTGCACCTTGCGCATTATTGGCAACTTCTGTCGATGTCACTGCCATTTCGTGCATTGCAGTGGCTAGTTGCTCTAACTCTTGTAACT	NA	NA	NA	NA
>prophage 19
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	2506524	2559846	3323092	tRNA,protease,transposase	Staphylococcus_phage(28.57%)	47	NA	NA
WP_096036624.1|2506524_2507835_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_013856219.1|2507967_2508927_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_096036625.1|2508974_2512454_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	4.1e-200
WP_096036626.1|2512535_2513177_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	44.1	1.3e-30
WP_096036627.1|2513194_2514343_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_096036628.1|2514448_2515237_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_026027636.1|2515238_2515670_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017046602.1|2515786_2516818_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_013856212.1|2516825_2517335_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_096036629.1|2517350_2519783_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_013856210.1|2519831_2521190_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_096036630.1|2521186_2522395_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_096036631.1|2522443_2523286_-	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	33.3	4.7e-09
WP_013856207.1|2523299_2524055_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	38.8	1.4e-20
WP_010320122.1|2524150_2524708_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_096036632.1|2524743_2525475_-	UMP kinase	NA	NA	NA	NA	NA
WP_013856205.1|2525628_2526474_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_013856204.1|2526602_2527334_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_081245045.1|2527718_2528561_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017049712.1|2528678_2531303_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_026027637.1|2531431_2531815_+	DUF3461 family protein	NA	NA	NA	NA	NA
WP_096036633.1|2531867_2533070_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	73.1	1.8e-78
WP_047689286.1|2533261_2533765_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_026027917.1|2533761_2534736_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_013856197.1|2534859_2535327_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_026027639.1|2535326_2535797_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	8.4e-32
WP_076611262.1|2535981_2537289_-|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
WP_053411098.1|2537460_2538849_+|transposase	IS4-like element ISVa18 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.6	1.1e-47
WP_013856195.1|2538941_2540051_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.3	9.7e-63
WP_096036634.1|2540139_2540796_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.5	3.3e-34
WP_096036635.1|2540797_2541895_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.1	7.9e-49
WP_096036636.1|2541901_2542351_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_096036637.1|2542482_2543733_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.7	9.5e-99
WP_038148735.1|2543746_2544886_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	2.9e-62
WP_157733278.1|2545008_2545398_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_017047326.1|2545498_2546746_-	esterase FrsA	NA	NA	NA	NA	NA
WP_010320141.1|2546835_2547300_-	oxytetracycline resistance phosphoribosyltransferase domain-containing protein Tet(34)	NA	NA	NA	NA	NA
WP_013856188.1|2547339_2548635_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	38.2	1.8e-68
WP_017046587.1|2549521_2550994_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_013856185.1|2551289_2551730_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_010320145.1|2551729_2552635_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A127KMC2	Cyanophage	34.4	3.4e-37
WP_088718002.1|2552594_2553692_+	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_026027641.1|2553798_2555154_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_172859024.1|2555280_2556837_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_096036639.1|2556902_2557646_-	YggN family protein	NA	NA	NA	NA	NA
WP_096036640.1|2557788_2558853_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_096036641.1|2558922_2559846_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	3055177	3159717	3323092	tRNA,bacteriocin,transposase,integrase	Leptospira_phage(23.53%)	96	3102970:3103029	3148354:3150729
WP_172858976.1|3055177_3055874_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_081245518.1|3056245_3057775_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	33.8	3.5e-63
WP_139788304.1|3057861_3058209_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.7	3.5e-19
WP_019282915.1|3058202_3058511_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019282749.1|3059284_3061225_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	26.5	1.3e-17
WP_019282750.1|3061257_3062436_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	47.2	2.3e-102
WP_019282751.1|3062438_3063101_-	acetyltransferase	NA	NA	NA	NA	NA
WP_019282752.1|3063090_3063705_-	sugar transferase	NA	NA	NA	NA	NA
WP_010317081.1|3064159_3065386_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010317083.1|3065382_3066453_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	34.5	6.5e-48
WP_081245382.1|3066462_3067566_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010317086.1|3067562_3068489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282755.1|3068499_3069642_-	N-acetyl sugar amidotransferase	NA	NA	NA	NA	NA
WP_019282756.1|3069648_3070413_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_019282757.1|3070406_3071036_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_019282758.1|3071035_3072172_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_069211953.1|3072171_3073503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069211954.1|3073499_3074855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282761.1|3074934_3075897_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001221372.1|3075905_3076862_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.2	6.5e-07
WP_019282763.1|3076869_3078660_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2P1EMF5	Moumouvirus	25.5	3.6e-06
WP_069211958.1|3078678_3079926_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_096036702.1|3079918_3081781_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	33.2	2.1e-49
WP_019282765.1|3081777_3082857_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	29.6	5.8e-28
WP_019282766.1|3082930_3083515_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_069211956.1|3083702_3084977_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.4	5.4e-25
WP_019282767.1|3084993_3086034_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_081245193.1|3086095_3087229_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_096036703.1|3087411_3088548_-	LPS chain length-determining protein	NA	NA	NA	NA	NA
WP_019282768.1|3088802_3089744_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	38.9	3.9e-36
WP_029388338.1|3089887_3091657_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_019282770.1|3091720_3092281_+	acyltransferase	NA	NA	NA	NA	NA
WP_029388339.1|3092315_3093521_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_029388340.1|3093504_3094233_-	glycosyltransferase family 25 protein	NA	A0A1D8KNF8	Synechococcus_phage	31.0	5.8e-16
WP_019282773.1|3094411_3095449_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_096036704.1|3095445_3096486_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_019282774.1|3096497_3097292_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_019282775.1|3097293_3098559_+	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_010320770.1|3098573_3098954_+	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_096036705.1|3100523_3101267_+	capsular biosynthesis protein	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	27.6	6.0e-16
WP_096036706.1|3101263_3102208_+	LPS biosynthesis protein WavE	NA	NA	NA	NA	NA
WP_096036707.1|3102246_3102951_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	46.5	1.6e-15
3102970:3103029	attL	GTATCCGCCCCATGATCCCACGGGGCGATATTGTTAGTGTTGGAAGTTCCAAGGCAGGAG	NA	NA	NA	NA
WP_096036126.1|3103002_3104535_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_019283195.1|3104594_3104948_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_019283194.1|3104944_3105265_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096036708.1|3106484_3107165_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_172858976.1|3107241_3107938_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_096036709.1|3108021_3108789_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000072674.1|3108748_3109348_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001211742.1|3109416_3109617_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	47.6	1.3e-10
WP_096036710.1|3109698_3110139_+	ribonuclease HI	NA	A0A1B2IB52	Erwinia_phage	40.4	3.3e-14
WP_096036711.1|3110348_3112868_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_096036712.1|3112857_3113118_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_096036713.1|3113117_3113366_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_096036714.1|3113474_3113702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036715.1|3113749_3114118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036716.1|3114148_3114883_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_096036718.1|3115201_3115645_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_172859029.1|3115695_3116133_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_096036720.1|3116129_3116603_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_157733280.1|3117031_3119059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031428502.1|3119091_3119520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036722.1|3119615_3120227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080525940.1|3120321_3121509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036147.1|3121792_3122113_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_061778452.1|3122109_3122463_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.2	7.0e-15
WP_076611502.1|3122522_3124055_+|transposase	IS66-like element ISVa12 family transposase	transposase	S5VTP8	Leptospira_phage	39.5	1.2e-23
WP_096036723.1|3124137_3125484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029628131.1|3125662_3126880_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	39.6	3.5e-74
WP_013855720.1|3127115_3127982_-	YicC family protein	NA	NA	NA	NA	NA
WP_017042236.1|3128160_3128877_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_013855722.1|3129123_3129765_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_029388344.1|3129866_3130844_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_029388343.1|3130866_3131814_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	37.2	1.9e-43
WP_010318996.1|3131866_3132457_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_081245190.1|3132665_3133907_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.6	3.8e-39
WP_010318993.1|3134101_3134776_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_004397476.1|3135053_3135290_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_010318992.1|3135303_3135471_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_096036724.1|3135606_3136080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611988.1|3136181_3137351_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_096036725.1|3137532_3138309_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.0	3.2e-20
WP_026028196.1|3138324_3138816_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.2	9.7e-23
WP_019282785.1|3138939_3139974_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_019282784.1|3139942_3140728_-	glycosyltransferase family 2 protein	NA	A0A1C3NFH8	Phage_NCTB	32.4	3.8e-05
WP_096036726.1|3140724_3141795_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_019282782.1|3141856_3142606_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_019282781.1|3142616_3144611_+	acyltransferase	NA	B5WZU0	Pseudomonas_phage	32.3	2.8e-60
WP_076611649.1|3144724_3145840_+|transposase	ISAs1-like element ISVa13 family transposase	transposase	NA	NA	NA	NA
WP_019283194.1|3146117_3146438_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|3146434_3146788_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_096036126.1|3146847_3148380_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_096035882.1|3149116_3150543_-|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_096036727.1|3157379_3157697_+	hypothetical protein	NA	NA	NA	NA	NA
3148354:3150729	attR	CTCCTGCCTTGGAACTTCCAACACTAACAATATCGCCCCGTGGGATCATGGGGCGGATACTTTCTATTCACTTTTACATCTTTATTCGTAGAGGATAAGACAAAAGAAGAATCTGGAGAAAAGGCGACTCATCGTGAGAAAAATTACCAAAAAAGAATGAGTATCATCGCCAAAAAAGAGTCCATCTATACATCTAAAGATGAAAGCTCAAATACTTCAAGCATTGACTATTATCTTTATGGTAAGGAGGGATTTTTCTGGTACCAAAACCAGTTATACACGCTGAAAGTGAATCTGTTGAAACTGGTAAGAGATCCACAAGTGGATGATGCAGTTAAAGTCCACGCTTATCGCATTTTGCTCTAGAAACACAGATGAAACATTCCTGTATTAGTGTATGTTTTCTTGCTAAATCTTACAGATCGTACTAGCGGGTTAACATCCGTCAAAGGCAATAGATTTACCTTGGAGTGCAAAGATTATCCACACCCATACGCCAATAAAAATGAATATCATTTGCATTTATATCATGCCAAAATCTACCTAAATGGTAACTTATACGGATAATGTGTAAATCATTAGATATCCACCAACTGTTAAATGCGGCGACATCTCTATTCGCAGTAGTAGACAAAGGCTGGGGGCTGAATCTCAAGACAGTACGTAAAAAATGTGATATTACCTAGATTAGCACTGGAAGACTCAATCATCAAAAGTAAAACTATTGTGTAACCGTTCACCAGTAGGAGCTTGATTTAATGGATTACAGACTAAATACGTTTGGGTAAGGCTTGCGAAGGGTAACAGCTTGAACGATTTCCATTAGAGCAGACAGGCTCGAGATGCCTCGTTTGTTACAGGTCTCAACAAGCGAATGCATACGGCCCCTGAACTTGTCGCCCGCATCAGATGTCGTTCCGAAGCTAATCTTACGCTGGATGACACTGCCACGTATTCTCCGCTCTGCTTCGTTGTTGGTGAGTGGTATTGAGGTATCGGTTAAGAACAACCACAAGCTTTGCCTATGAGATTGTAGCTTTTTACATCGACCTTTGTATCGCTGAACGACTATCCCACTGCCTTTTTGCAGCCAGTGGTCAAAGGATTTTCGAAGTCGATTCATGCGGCGAATATACTGTTCGTACTGGATTTCTGTATTTTCCAAACGGTGACGTATTCTAAAAACCATATTGGCGAGCAGTGTTAGCCGTTGTCCAACGAGAGCGGTATAACCGCCGCCAGTATAATCTGCGATTTGCTGAAGATTTCGCCTCACATGCGACCAGCACAGCTGATGTTGTTCTGGTTTTAGCCAGTTATAGCTTGGGCACTGGTCAGTGACGACAAGACCACTATAATTCTTACCTAACATGGTCTTGGCAGAATGGGTTGAACGAGAGAACAAGATCTTTTCGTAGACAAGGTCTTCACTGGCGACCAACCAACACCAACGTAAGCTCTCTTCACCATTACGAGGGTGGGAAGTTTCATCTACATGAACTAGCGGTGCTGTTTGGATGCTATCTCGGATTGCATGATGTAAAGGAGTCAGCATTGAAGCCACTTTAGTCTGAGCTTCGCTGATGGCACCAACAGAGAACGTCGTACCCAGTTGTTCTTTTAGTAGAGAGCAAATTTTGCGGATACTTAAATGATATTGTCCTGCTAATACAGCGATATAGCTGAGCAAGTTCGGCCCAATAATACCTTGTGAGACATTCTCAGGTTTCTTGCCTCTGACAACCTCATTGCAATGTCGACATTGGCCTGAAAATAATCGGTACTCAGAGATATCGACCGCTGGCTTTGGTATTTCATGAACTTGATGTCGATAAAACGGGTTATTGTGAACGAAGATGTCCGATTGACCACAACACGGACACGTAGGATCAGGCAAGCAGTCGATGACAGTGTCCGTTTTCTTTAGTTTCGAGAGTTGTCGTTGACTCCCTGAGTGACCCTGTTTAGCTCCTCTCGGATTGCGGTCACCAGAGCTTTGAGCTTTTTTCGCTCAGCCCGCTCTTTTGGGCCATCCGAAGACGGTGGTTTTGAAGAGTTAGAGCAACTGGTTTTCAGCTTATCTTCATAATGGCGAAGTTGTTCCCACAACTCTTCGATGAGTGCGTTAGCTTCATTGATATCAGAGGCAACAGGAGGAGCTTCTGCGAATTTGGATTTCTTCTTTTTCATACCTTCATCATGAAGGCTGTAAATGATCACTCAAGAAGAAAAAGTGGATCAAGTGCGGAGTGTCACACTTGATTGTCAATGGGGGACTGGTGAACGGTTACACTATTGTTAATGTAAAAACGCGATGATTTAAACCAACTGGGTAGTATATTGGGTAGTAAGATCCTGAAATACACAAAACAAAAA	NA	NA	NA	NA
WP_157733282.1|3157693_3158059_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	32.0	1.1e-10
WP_096036806.1|3158232_3159717_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	27.8	5.0e-38
>prophage 22
NZ_CP023310	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 1, complete sequence	3323092	3187510	3237091	3323092	transposase,integrase	Bacillus_phage(25.0%)	33	3187451:3187510	3212768:3213868
3187451:3187510	attL	TATACCCGTGATCATTGAAGATGCTTGATTTTCAATAGAATCAGGATCATGCTACAAACC	NA	NA	NA	NA
WP_026027704.1|3187510_3188542_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_019283408.1|3189833_3191582_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_096036741.1|3191581_3193627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283409.1|3193629_3194088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036743.1|3195186_3195951_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	6.8e-15
WP_076611988.1|3196113_3197283_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_096036744.1|3197891_3198836_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	35.9	9.5e-59
WP_019281833.1|3198832_3199786_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_019281832.1|3199842_3200811_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096036745.1|3200917_3203107_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_096036746.1|3203377_3204988_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	4.2e-14
WP_019281830.1|3204984_3206610_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	7.4e-19
WP_008218079.1|3208023_3208428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019281827.1|3208616_3209210_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_076611649.1|3211198_3212314_+|transposase	ISAs1-like element ISVa13 family transposase	transposase	NA	NA	NA	NA
WP_026027704.1|3212827_3213859_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_172858976.1|3214022_3214720_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
3212768:3213868	attR	TATACCCGTGATCATTGAAGATGCTTGATTTTCAATAGAATCAGGATCATGCTACAAACCATGAAAATCACACTGACTCCTCAACAGAAACTGCAACTCGAACAGATGCACGACATTGAGCGTGATAGTCGAGTTTGCGACCGTATTAAGGCTGTTTTGCTGGCTTCTGAAGGCTGGAGTCAGACTATGATTTCACAAGCTCTTCGTATTCATGAATCGACCGTTGCACGTCACCTCAGTGACTACGTACTTTCTGAAAAACTTAAGCCTGAGAATGGAGGAAGCCAAAGCAAGCTTTCTGCTATTCAAACCATGCACCTAATCGAGCATTTGACTGAGAAAACCTATTCTCATACTCATCAAATTGTCGCCTATGTTAAAGAGACGTTTGGGCTTGATTATACTGTTTCTGGTATGAACAAATGGCTTCACCATAATGGTTTTAGCTACAAGCAACCGAAAGGCATACCACACAAGTTTGATGAAGCAAAACAGCAAGCATTCATAGAGGCGTATGAAGCGCTAAAGGCAAGCTGTGGCGAGGATGAATCGATAGTCTTTATCGATGCAGTTCACCCAACACTATCAACAAAGATATCGCATGGCTGGATACGTACTGGTCAGGATAAAGTGATTGAAACAACGGGTAATCGTAGCCGATTGAACATTATTGGCGCACTGAACCTGTCGGATATTGGTGCAACCATTGTTCACGACTATGAGAGCATTAACAGTGAATCGATTGTTCGTTTTTTCTGTAAGTTAAGAGAGAGTTATTCGTTAGCCCATAAGCTTCATATCATATTAGATGGTGCGGGATATCACCGCAGTGACTTAGTCAAAGATGCGGCGTTTGTCCTGAATATTAAACTGCATTATCTTCCACCTTACAGTCCAAACCTCAACCCAATAGAGCGGCTATGGAAAGTAATGAATGAGAAGTCGAGGAACAACGTTTACTTCAAAAGAAAACGGGACTTCAAGGCGGCAATAGACCAATTTTTTTCTGTGACTCTTCCAGAGATCGCAGGCTCTTTGACATCTCGAATTAATGATCATTTTCAGGTTCTCAAGCCTGCATCTTCAAGTTGATTCGGTATA	NA	NA	NA	NA
WP_096036747.1|3214986_3215883_-	response regulator	NA	NA	NA	NA	NA
WP_096036748.1|3215980_3216730_+	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_096036749.1|3216764_3217691_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_010319654.1|3217857_3218796_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013855660.1|3218798_3219776_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_026027967.1|3219974_3221531_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_094147789.1|3221639_3223355_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	7.1e-20
WP_013855655.1|3225029_3225470_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_017048508.1|3225539_3227558_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	38.0	4.0e-115
WP_026028267.1|3227727_3228309_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017042454.1|3228327_3229434_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013855651.1|3229445_3232568_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010319855.1|3232690_3232942_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_096036750.1|3233134_3234619_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_096036751.1|3234762_3235653_+	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_076611262.1|3235783_3237091_+|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP023311	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 2, complete sequence	1282503	9078	158713	1282503	transposase,plate	Clostridium_phage(14.29%)	111	NA	NA
WP_172859050.1|9078_9775_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	3.1e-67
WP_096036812.1|9848_10706_+	MBL fold metallo-hydrolase	NA	F2NZ47	Diadromus_pulchellus_ascovirus	31.2	1.3e-25
WP_013868244.1|10721_11129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019283044.1|11125_11617_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	51.0	5.1e-32
WP_019283045.1|11618_12971_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_013868248.1|13148_14039_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017049330.1|14187_14547_+	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_017044957.1|14813_15065_-	DUF3081 domain-containing protein	NA	NA	NA	NA	NA
WP_013868251.1|15376_16177_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_080569446.1|16304_16706_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_017044959.1|16609_17557_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	39.6	6.4e-15
WP_096036813.1|18196_20146_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_096036814.1|20262_21411_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_010319258.1|21472_22003_+	MltR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096036815.1|23048_24497_-	sodium:proton antiporter NhaD	NA	NA	NA	NA	NA
WP_029189696.1|24666_25971_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_013868258.1|26453_26897_-	DoxX family protein	NA	NA	NA	NA	NA
WP_019281855.1|27917_28826_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	60.8	9.3e-104
WP_096036816.1|29817_30852_-	DUF2955 domain-containing protein	NA	NA	NA	NA	NA
WP_010318632.1|30864_31920_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_019283056.1|31926_32409_-	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_017046842.1|32522_33551_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_096035882.1|33704_35131_-|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_096036817.1|35206_35920_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_017046839.1|37721_38096_-	rhodanese-like domain-containing protein	NA	H8ZJP5	Ostreococcus_tauri_virus	38.5	1.8e-05
WP_096036818.1|38146_39244_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096036819.1|39240_40167_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-19
WP_029388409.1|40166_41123_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_096036820.1|41220_41880_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017046834.1|41884_42934_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.3	1.8e-34
WP_010318639.1|42930_43734_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096037214.1|43720_44620_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_096036821.1|44619_45423_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_013868276.1|46705_47458_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_094147393.1|47503_48730_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.4e-46
WP_096036822.1|49176_50412_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_017044984.1|50551_51208_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_096036823.1|51424_53161_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_096036824.1|53414_54296_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_096036825.1|54295_55849_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_013868283.1|55994_56609_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_096036826.1|56622_57654_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_170900486.1|57738_58335_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096036828.1|58508_60806_-	glycoside hydrolase	NA	NA	NA	NA	NA
WP_096036829.1|60881_61715_-	DUF2861 family protein	NA	NA	NA	NA	NA
WP_017044992.1|61707_62361_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	1.8e-24
WP_096036830.1|62357_63803_-	DUF3404 domain-containing protein	NA	NA	NA	NA	NA
WP_096036831.1|63896_65594_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_076611988.1|65714_66884_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_026027753.1|67291_68767_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_096036832.1|69149_70919_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_094132575.1|70882_71905_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_094125344.1|71909_73382_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_013868298.1|73384_73864_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_017044997.1|73868_75203_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_096036833.1|75205_75979_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_096036834.1|76002_78621_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.5	1.1e-88
WP_172859051.1|78623_80186_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_096036836.1|80182_80842_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_096036837.1|80851_82261_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_096036838.1|85889_87185_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096036839.1|87352_90856_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	4.2e-27
WP_019283119.1|90880_91678_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_172858976.1|93242_93940_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_019283121.1|94612_95353_+	DUF2931 family protein	NA	NA	NA	NA	NA
WP_096036840.1|95429_95825_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_076611988.1|96356_97526_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_019281428.1|97986_98736_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013868314.1|98795_99752_-	AEC family transporter	NA	NA	NA	NA	NA
WP_019283475.1|99878_100487_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017049281.1|100634_101492_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017043564.1|101687_103073_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_172859088.1|103134_103761_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_096036842.1|104235_106761_+	chitinase	NA	B0FDP2	Orgyia_leucostigma_nucleopolyhedrovirus	47.4	3.6e-145
WP_026028428.1|106955_107327_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096036844.1|107323_108187_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.5	1.8e-11
WP_096036845.1|108186_109044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036846.1|109177_110503_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_172859050.1|111433_112131_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	3.1e-67
WP_172859089.1|112136_113213_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036848.1|113397_115026_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.2e-18
WP_096036849.1|116585_117323_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_017043842.1|117300_117930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069212035.1|118029_119364_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_096036850.1|119824_121063_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_017044901.1|121397_122405_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.8	7.1e-28
WP_013868155.1|122435_123683_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_013868154.1|123777_124764_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_096036851.1|124768_125635_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_096036852.1|125715_126810_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	33.7	5.5e-26
WP_096036853.1|126809_129410_+	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096036854.1|129473_130496_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	30.5	2.5e-33
WP_026027704.1|130487_131519_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036855.1|133434_136353_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_172859090.1|136449_136968_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	29.5	1.1e-05
WP_096036857.1|137176_138505_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	35.8	2.8e-32
WP_096037215.1|138622_139453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010320225.1|139536_140058_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_096036858.1|140238_141138_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_094501008.1|141137_141554_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096036859.1|141607_143077_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_013868139.1|143352_143904_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_096036860.1|143915_144761_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096036861.1|144774_147618_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_094130067.1|147690_148827_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_172859052.1|148934_150635_-	L-lactate permease	NA	NA	NA	NA	NA
WP_013868134.1|150855_151755_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096036863.1|151999_153472_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.3	1.0e-128
WP_096036032.1|154897_156075_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.8	1.9e-117
WP_096037216.1|156119_156782_-	reverse transcriptase N-terminal domain-containing protein	NA	A0A0U4J920	Pseudomonas_phage	55.2	1.1e-45
WP_076611988.1|157543_158713_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
>prophage 2
NZ_CP023311	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 2, complete sequence	1282503	166583	248185	1282503	protease,transposase	Escherichia_phage(15.0%)	54	NA	NA
WP_172858976.1|166583_167280_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_096036225.1|167561_169034_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	52.6	1.2e-132
WP_096036865.1|169276_172156_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.5	3.1e-270
WP_013868476.1|172237_172618_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017043957.1|172675_173983_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.1	2.5e-102
WP_010320321.1|174378_175002_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172859053.1|175293_176427_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_076611988.1|176454_177624_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_088729428.1|177861_178848_+|protease	trypsin-like serine protease	protease	D2TEK9	Emiliania_huxleyi_virus	29.3	9.7e-14
WP_172859054.1|178976_180074_+|protease	trypsin-like serine protease	protease	Q6JPG5	Neodiprion_lecontei_nucleopolyhedrovirus	28.6	7.2e-10
WP_096036868.1|183016_184879_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	31.3	1.3e-67
WP_076611988.1|187935_189105_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_094124215.1|189767_191198_+	DUF4118 domain-containing protein	NA	W8CYF6	Bacillus_phage	32.6	3.7e-22
WP_096036870.1|191187_191901_+	response regulator	NA	W8CYM9	Bacillus_phage	27.0	4.1e-22
WP_172859055.1|192228_192915_-	DedA family protein	NA	NA	NA	NA	NA
WP_096036872.1|193487_195230_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_013868484.1|195248_196202_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_096036873.1|196212_197355_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_170935193.1|197581_198715_+	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_172858976.1|199589_200286_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_096037217.1|200978_201590_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	5.4e-15
WP_086558351.1|202726_203965_+|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_157733284.1|205291_206317_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_094163690.1|206309_207296_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_096036874.1|207475_208618_+	exonuclease SbcCD subunit D	NA	A0A217ER54	Bacillus_phage	23.7	1.6e-07
WP_096036875.1|208617_211659_+	SMC family ATPase	NA	A0A1S5R3N7	Pseudomonas_phage	21.4	6.0e-06
WP_096036876.1|211797_213849_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	31.3	2.8e-07
WP_017050024.1|213935_215117_-	quorum-sensing autoinducer synthase	NA	NA	NA	NA	NA
WP_096036877.1|215316_216291_-	TDT family transporter	NA	NA	NA	NA	NA
WP_013868492.1|216439_217837_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_096036878.1|218328_219315_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_172858976.1|219423_220120_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_017045357.1|220227_220947_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	8.6e-36
WP_017046954.1|220939_222223_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_064626682.1|222225_223443_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_088729436.1|223439_224726_-	TolC family protein	NA	NA	NA	NA	NA
WP_017045360.1|224715_225861_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_064626687.1|226086_227031_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_096036879.1|227539_228382_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_096036880.1|228384_228585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611988.1|228552_229722_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_026027704.1|230684_231716_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036881.1|231761_234227_-	glycogen debranching protein	NA	NA	NA	NA	NA
WP_026027704.1|234482_235514_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_026027704.1|236747_237779_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036883.1|238003_238921_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096036884.1|239139_240777_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_019282475.1|241122_242268_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_026028166.1|242379_243597_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_096036885.1|243951_244395_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_094133716.1|244396_245005_-	SCO family protein	NA	NA	NA	NA	NA
WP_019282478.1|245001_245430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017042156.1|245573_246494_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_026027704.1|247153_248185_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP023311	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 2, complete sequence	1282503	329758	390394	1282503	transposase	Hokovirus(20.0%)	35	NA	NA
WP_076611262.1|329758_331066_-|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
WP_019282634.1|337855_339184_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_017042187.1|339470_339920_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096036915.1|341180_345143_+	response regulator	NA	A0A1V0SGX0	Hokovirus	33.2	7.0e-71
WP_096036916.1|345287_347024_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.0	3.0e-26
WP_172858976.1|347117_347814_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_019282631.1|347947_349225_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_026027704.1|349281_350313_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036917.1|350528_351143_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017045072.1|351225_351435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036918.1|351764_353426_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_096036919.1|353521_354577_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096036920.1|354683_356126_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_096036921.1|356641_359299_+	response regulator	NA	A0A1V0SGX0	Hokovirus	43.0	7.0e-43
WP_094125608.1|359411_359828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036922.1|361328_362831_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_096036923.1|362827_365956_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_096036924.1|366011_366542_+	cupredoxin family protein	NA	NA	NA	NA	NA
WP_017048181.1|366569_367601_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017048182.1|367845_368289_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_088733162.1|368344_368632_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_172858976.1|369306_370003_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_096036925.1|370000_371569_-	recombinase family protein	NA	D2IZV7	Enterococcus_phage	25.4	7.6e-13
WP_013868365.1|371707_373288_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	40.1	6.7e-17
WP_013868366.1|373268_374756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026028170.1|374919_376389_-	lactate dehydrogenase	NA	NA	NA	NA	NA
WP_013868368.1|376449_377160_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_141138389.1|377471_378425_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_096036927.1|378414_379248_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	30.7	5.7e-15
WP_096036928.1|379264_380677_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1K1	Organic_Lake_phycodnavirus	32.3	4.4e-60
WP_013868372.1|380682_381606_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_026027153.1|381714_381984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026027154.1|382383_383730_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.6	3.3e-41
WP_076612072.1|384428_385697_+|transposase	IS4-like element ISVa14 family transposase	transposase	NA	NA	NA	NA
WP_096035922.1|389272_390394_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP023311	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 2, complete sequence	1282503	399497	596925	1282503	tRNA,transposase,integrase	Vibrio_phage(15.91%)	183	488752:488767	586906:586919
WP_026027704.1|399497_400529_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036931.1|403198_405247_-	alpha-amylase	NA	NA	NA	NA	NA
WP_047688732.1|405568_406477_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_096036932.1|406697_407516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020477135.1|407530_408214_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	5.3e-35
WP_094132982.1|408201_409461_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017042180.1|409453_410215_+	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_088729380.1|410216_411518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088729381.1|411517_412570_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	32.0	3.1e-18
WP_017048167.1|412566_413355_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_076611262.1|418244_419552_-|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
WP_096036933.1|420155_420827_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017045996.1|420897_422016_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G3M9Y6	Bacillus_virus	33.3	1.4e-24
WP_026027705.1|422673_423855_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_096036934.1|423931_425524_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_010317575.1|425536_426427_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_017045998.1|426745_426991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026027856.1|427084_427570_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_013868065.1|427870_428452_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096036935.1|429304_430612_+|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
WP_013868063.1|430741_431503_-	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096036936.1|431699_432617_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.3	1.5e-16
WP_013868061.1|432746_433646_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026028665.1|433745_434534_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096036937.1|434666_435578_-	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_076611262.1|435596_436904_-|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
WP_096036938.1|437281_438610_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_096036939.1|438744_439656_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_172859060.1|439744_440893_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	28.6	3.5e-31
WP_096036941.1|440960_441989_-	dihydroorotase	NA	NA	NA	NA	NA
WP_096036942.1|442197_444015_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_096036943.1|444602_445811_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	28.4	2.7e-26
WP_096036944.1|446009_447242_+	peptidase T	NA	NA	NA	NA	NA
WP_017047149.1|447452_448331_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_096036945.1|448424_450011_-	nitric oxide reductase transcriptional regulator NorR	NA	NA	NA	NA	NA
WP_064626435.1|450214_451402_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_013868041.1|451592_452138_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_010318975.1|452209_452419_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	2.6e-17
WP_026027849.1|453214_453577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017046015.1|453786_454026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019281663.1|454190_455195_+	response regulator	NA	NA	NA	NA	NA
WP_019281664.1|455197_455638_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_096036946.1|455713_456715_-	2-hydroxyacid dehydrogenase	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	43.8	4.3e-70
WP_019281666.1|457280_458324_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	53.8	2.8e-96
WP_081245099.1|458468_459092_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_172859061.1|460118_460818_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	43.1	2.0e-53
WP_096036948.1|464102_465011_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	60.8	4.2e-104
WP_096036949.1|465229_466612_-	DEAD/DEAH box helicase family protein	NA	I4AZM6	Saccharomonospora_phage	31.3	4.8e-35
WP_013855668.1|466596_467139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036950.1|467240_467570_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019281889.1|467814_468333_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_096036951.1|468471_470451_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.6	6.9e-35
WP_096036952.1|470450_471239_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_081245286.1|471228_472845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081245289.1|473049_473838_+	glycosyl hydrolase family 26	NA	NA	NA	NA	NA
WP_081245287.1|473847_474147_+	type VI secretion system PAAR protein	NA	NA	NA	NA	NA
WP_076611649.1|474405_475521_-|transposase	ISAs1-like element ISVa13 family transposase	transposase	NA	NA	NA	NA
WP_076611988.1|477189_478359_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_096036953.1|478866_479580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026027704.1|480178_481210_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_026027796.1|481398_481743_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_026027797.1|482414_482966_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_096036954.1|482979_483972_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_094151745.1|483982_484345_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_013868508.1|484403_485183_+	sorbitol-6-phosphate dehydrogenase	NA	W8CYX9	Bacillus_phage	44.1	5.0e-05
WP_013868509.1|485278_485635_+	transcriptional regulator GutM	NA	NA	NA	NA	NA
WP_013868510.1|485717_486494_+	DNA-binding transcriptional repressor	NA	A0A077SK06	Escherichia_phage	26.5	5.6e-17
WP_096036955.1|486686_487250_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_096035882.1|487717_489144_-|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
488752:488767	attL	CCGCTGGCTTTGGTAT	NA	NA	NA	NA
WP_157733285.1|489166_489304_+	hypothetical protein	NA	NA	NA	NA	NA
488752:488767	attL	CCGCTGGCTTTGGTAT	NA	NA	NA	NA
WP_013868513.1|489795_490152_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_096036956.1|490256_492230_-	cyclomaltodextrin glucanotransferase	NA	NA	NA	NA	NA
WP_096036957.1|492270_493398_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.2	2.5e-21
WP_047691240.1|493430_493913_-	glycosidase	NA	NA	NA	NA	NA
WP_094125752.1|493959_494970_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_047691245.1|494989_496024_-	porin	NA	NA	NA	NA	NA
WP_013868518.1|496432_497662_+	maltose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096036958.1|497664_498948_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013868520.1|498950_499784_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_064626704.1|499802_501587_+	alpha-glycosidase	NA	NA	NA	NA	NA
WP_029189831.1|501795_502596_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_019281634.1|502770_503460_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_019281633.1|503552_504056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036959.1|504153_505992_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_096036960.1|505994_506897_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.5	1.0e-38
WP_013868527.1|506998_507133_-	TIGR02808 family protein	NA	NA	NA	NA	NA
WP_096036961.1|507145_507724_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_013868529.1|507756_508212_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_096036962.1|508285_510763_-	periplasmic nitrate reductase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	3.0e-11
WP_013868531.1|510759_511065_-	chaperone NapD	NA	NA	NA	NA	NA
WP_013868532.1|511067_511562_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_096036963.1|511777_513499_+	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_013868534.1|513485_514118_+	response regulator	NA	NA	NA	NA	NA
WP_017045375.1|514183_515551_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_088729444.1|515847_516975_-	fatty acid desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	32.7	4.8e-33
WP_076612072.1|517157_518426_-|transposase	IS4-like element ISVa14 family transposase	transposase	NA	NA	NA	NA
WP_013868537.1|518549_519092_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013868538.1|519687_520365_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_172859062.1|520418_521240_-	phosphate ABC transporter substrate-binding protein	NA	H6WG65	Cyanophage	28.0	1.2e-06
WP_026027345.1|521414_521765_+	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
WP_096036966.1|521826_523836_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	23.1	8.3e-28
WP_096036967.1|524198_526211_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.5	4.1e-51
WP_010319593.1|526424_528353_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	3.8e-123
WP_080569453.1|528356_528908_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	39.0	1.2e-13
WP_010319591.1|529011_529206_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_010319590.1|529247_529601_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_094167992.1|529672_530620_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.9	2.2e-55
WP_172858976.1|530688_531385_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
531050:531065	attR	CCGCTGGCTTTGGTAT	NA	NA	NA	NA
WP_001100052.1|531850_532132_+	hypothetical protein	NA	NA	NA	NA	NA
531050:531065	attR	CCGCTGGCTTTGGTAT	NA	NA	NA	NA
WP_096036968.1|532869_533553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172859063.1|533716_534109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044128081.1|535225_535678_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_064626878.1|535870_536299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005386962.1|536436_536874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036970.1|536907_537876_-|transposase	IS30-like element ISVa6 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.5	2.0e-43
WP_096037220.1|537906_538083_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_063345490.1|538111_538729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036972.1|539798_540224_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_096036973.1|540246_541203_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_096036974.1|541605_542247_+|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_017420820.1|542719_542842_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_045621755.1|542999_543275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081324179.1|543279_543405_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_013571614.1|544383_544752_+	VOC family protein	NA	NA	NA	NA	NA
WP_076611502.1|545231_546764_-|transposase	IS66-like element ISVa12 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.3e-69
WP_061778452.1|546823_547177_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096036147.1|547173_547494_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096036976.1|547759_548155_+	DUF3465 domain-containing protein	NA	NA	NA	NA	NA
WP_088733285.1|548313_548877_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_088733599.1|548884_548995_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_096036977.1|549576_550176_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_096036978.1|550329_550698_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_076611988.1|550690_551860_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_096036979.1|552007_552391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036981.1|553104_553830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037221.1|553792_553942_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_064626913.1|553980_554271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107489896.1|554326_554437_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_086558351.1|555223_556462_+|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_164996843.1|558422_558704_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_017049660.1|558700_558988_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_088129430.1|558997_559108_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_096036984.1|559168_559534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026027704.1|559566_560598_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036985.1|560835_561300_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096037222.1|561788_561881_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_086558331.1|561909_563529_-|transposase	IS1634-like element ISVa17 family transposase	transposase	NA	NA	NA	NA
WP_096036986.1|563942_565955_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.7	2.9e-17
WP_013867804.1|566273_566486_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.2	7.6e-17
WP_013867803.1|566661_568026_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.9	6.0e-14
WP_013867802.1|568140_568509_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_026027783.1|568519_568804_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_088733374.1|569093_570644_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_017046914.1|570655_572032_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_096036987.1|572183_573638_+	DUF3404 domain-containing protein	NA	NA	NA	NA	NA
WP_013867797.1|573612_574272_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	1.2e-28
WP_096036988.1|574268_575153_+	DUF2861 family protein	NA	NA	NA	NA	NA
WP_094163305.1|575213_576404_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_096036989.1|576449_576605_+	YoaH family protein	NA	NA	NA	NA	NA
WP_086558351.1|576802_578041_-|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_096036990.1|578180_579357_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.5	3.6e-116
WP_096036991.1|580181_581069_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096036992.1|581112_583803_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013867790.1|584022_584604_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_096036993.1|584775_585780_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_096036994.1|585763_586723_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7R1N2	Vibrio_phage	23.9	4.2e-14
WP_013867787.1|586825_587197_+	DUF3319 domain-containing protein	NA	NA	NA	NA	NA
WP_064626153.1|587204_587516_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_076611649.1|587699_588815_+|transposase	ISAs1-like element ISVa13 family transposase	transposase	NA	NA	NA	NA
WP_096036995.1|588934_589225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036996.1|589303_589546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013867780.1|589818_590007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036995.1|590218_590509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036996.1|590587_590830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013867780.1|591102_591291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157733268.1|591499_591640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036997.1|591653_593018_-	toxin	NA	R9TQ09	Vibrio_phage	70.1	2.4e-164
WP_096036998.1|593020_593365_-	DUF2523 domain-containing protein	NA	Q64EV1	Vibrio_phage	62.3	1.3e-13
WP_096036364.1|593364_594723_-	hypothetical protein	NA	G8IRU9	Vibrio_phage	24.1	1.4e-18
WP_096036363.1|594857_595076_-	hypothetical protein	NA	R9TRU5	Vibrio_phage	63.6	1.4e-10
WP_172859005.1|595105_595336_-	hypothetical protein	NA	G8IRU7	Vibrio_phage	74.7	2.6e-26
WP_096036362.1|595338_595614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036361.1|595626_596925_-	hypothetical protein	NA	J7I3Z6	Enterobacteria_phage	41.3	5.2e-84
>prophage 5
NZ_CP023311	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 2, complete sequence	1282503	600481	773700	1282503	transposase	Vibrio_phage(32.0%)	182	NA	NA
WP_096036366.1|600481_601846_-	toxin	NA	R9TQ09	Vibrio_phage	69.9	7.0e-164
WP_096036365.1|601848_602193_-	DUF2523 domain-containing protein	NA	Q64EV1	Vibrio_phage	62.8	3.1e-20
WP_096036364.1|602192_603551_-	hypothetical protein	NA	G8IRU9	Vibrio_phage	24.1	1.4e-18
WP_096036363.1|603685_603904_-	hypothetical protein	NA	R9TRU5	Vibrio_phage	63.6	1.4e-10
WP_172859005.1|603933_604164_-	hypothetical protein	NA	G8IRU7	Vibrio_phage	74.7	2.6e-26
WP_096036362.1|604166_604442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036361.1|604454_605753_-	hypothetical protein	NA	J7I3Z6	Enterobacteria_phage	41.3	5.2e-84
WP_160117742.1|605883_606042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036367.1|606190_606379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157733268.1|606588_606729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036997.1|606742_608107_-	toxin	NA	R9TQ09	Vibrio_phage	70.1	2.4e-164
WP_096036998.1|608109_608454_-	DUF2523 domain-containing protein	NA	Q64EV1	Vibrio_phage	62.3	1.3e-13
WP_096036364.1|608453_609812_-	hypothetical protein	NA	G8IRU9	Vibrio_phage	24.1	1.4e-18
WP_096036363.1|609945_610164_-	hypothetical protein	NA	R9TRU5	Vibrio_phage	63.6	1.4e-10
WP_172859005.1|610193_610424_-	hypothetical protein	NA	G8IRU7	Vibrio_phage	74.7	2.6e-26
WP_157733286.1|610426_610558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026027704.1|610603_611635_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096036999.1|611612_611801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086558351.1|611930_613169_-|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_096037000.1|613209_614487_-	hypothetical protein	NA	J7I3Z6	Enterobacteria_phage	41.1	8.2e-82
WP_088733363.1|614612_614792_+	hypothetical protein	NA	Q9MBU8	Vibrio_virus	81.0	8.9e-19
WP_013867780.1|614925_615114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157733268.1|615322_615463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037001.1|615476_616811_-	toxin	NA	R9TQ09	Vibrio_phage	67.5	7.9e-152
WP_096037002.1|616855_618220_-	toxin	NA	R9TQ09	Vibrio_phage	68.7	3.7e-165
WP_096036998.1|618222_618567_-	DUF2523 domain-containing protein	NA	Q64EV1	Vibrio_phage	62.3	1.3e-13
WP_096037003.1|619237_619924_-	hypothetical protein	NA	R9TMT0	Vibrio_phage	39.8	4.4e-13
WP_096036363.1|620058_620277_-	hypothetical protein	NA	R9TRU5	Vibrio_phage	63.6	1.4e-10
WP_172859005.1|620306_620537_-	hypothetical protein	NA	G8IRU7	Vibrio_phage	74.7	2.6e-26
WP_096036362.1|620539_620815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037004.1|620827_622126_-	hypothetical protein	NA	J7I3Z6	Enterobacteria_phage	41.4	1.5e-83
WP_088733363.1|622251_622431_+	hypothetical protein	NA	Q9MBU8	Vibrio_virus	81.0	8.9e-19
WP_013867780.1|622564_622753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037005.1|622968_623262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037223.1|623340_623550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013867780.1|623846_624035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037005.1|624250_624544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036147.1|625087_625408_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_076611988.1|625503_626673_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_157733287.1|626866_627115_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_076611502.1|627174_628707_+|transposase	IS66-like element ISVa12 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.3e-69
WP_172858976.1|628842_629539_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_157733288.1|629536_629713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037007.1|629954_630623_-	QnrVC family quinolone resistance pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_017045844.1|633407_633521_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_096037008.1|634587_634767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037009.1|634947_635397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037011.1|635922_636402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036376.1|636403_636910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172859064.1|638016_638379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037014.1|638874_639138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036373.1|639342_639558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036372.1|639887_640142_-	RstC protein	NA	NA	NA	NA	NA
WP_096036370.1|643549_643828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036367.1|645759_645948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037015.1|648566_648785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037224.1|649952_650084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157733290.1|650097_650235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037005.1|653632_653926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036147.1|654468_654789_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_157733287.1|656246_656495_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_076611502.1|656554_658087_+|transposase	IS66-like element ISVa12 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.3e-69
WP_172858976.1|658222_658919_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_157733288.1|658916_659093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037007.1|659334_660003_-	QnrVC family quinolone resistance pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_096037017.1|660082_661233_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.1	3.4e-50
WP_170908065.1|661991_662705_-	Fic family protein	NA	NA	NA	NA	NA
WP_017045844.1|662788_662902_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_096037018.1|662905_663304_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_094182979.1|663589_663994_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_094127560.1|664661_665297_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	34.7	1.8e-16
WP_026027704.1|666308_667340_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096037020.1|668176_668596_-	effector binding domain-containing protein	NA	NA	NA	NA	NA
WP_076612072.1|668701_669970_+|transposase	IS4-like element ISVa14 family transposase	transposase	NA	NA	NA	NA
WP_081989899.1|670053_670170_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_096037021.1|670314_671151_+	glycosyl transferase	NA	A0A0S1TKJ6	Elephant_endotheliotropic_herpesvirus	28.0	2.0e-15
WP_096037023.1|671411_672380_+|transposase	IS30-like element ISVa6 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.8	8.8e-44
WP_096037024.1|672431_672857_-	DMT family transporter	NA	NA	NA	NA	NA
WP_096037025.1|672856_673255_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026027704.1|673297_674329_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096037026.1|674506_675427_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088733311.1|676086_676527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069573255.1|677286_677619_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_026028227.1|678326_678617_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_096037028.1|679354_679642_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	51.6	4.9e-19
WP_013868555.1|679631_679883_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_026028286.1|680179_680428_-	DUF3297 family protein	NA	NA	NA	NA	NA
WP_013868597.1|680746_680977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017048743.1|681096_681303_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_019283194.1|682265_682586_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|682582_682936_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096036126.1|682995_684528_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_157733292.1|684454_685063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037029.1|685384_685582_-	DUF3709 domain-containing protein	NA	NA	NA	NA	NA
WP_096037030.1|685886_686066_-	DUF645 family protein	NA	NA	NA	NA	NA
WP_026027704.1|686244_687276_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_000734783.1|687568_687946_+	PEGA domain-containing protein	NA	NA	NA	NA	NA
WP_096037032.1|688117_688633_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_096037033.1|688974_689931_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_096037034.1|689984_690341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037035.1|690538_690952_-	VOC family protein	NA	NA	NA	NA	NA
WP_076612072.1|691200_692469_-|transposase	IS4-like element ISVa14 family transposase	transposase	NA	NA	NA	NA
WP_096037228.1|693452_693578_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_096036126.1|694508_696041_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_019283195.1|696100_696454_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096036125.1|696450_696771_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_017039704.1|697933_698338_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_095470047.1|698475_699012_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_096037229.1|700037_700199_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_019283269.1|700238_700511_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_017045788.1|700507_701005_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096036126.1|701245_702778_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_019283195.1|702837_703191_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096035882.1|703338_704765_-|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_096037036.1|704827_705079_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096037037.1|705350_705464_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_045571622.1|705489_705915_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_094166354.1|706671_706920_+	DUF3297 family protein	NA	NA	NA	NA	NA
WP_019283194.1|707500_707821_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|707817_708171_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096036126.1|708230_709763_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_096037038.1|709759_710029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172859092.1|710045_710117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037039.1|710175_710931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611988.1|711395_712565_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_026027704.1|713403_714435_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096037023.1|715106_716075_+|transposase	IS30-like element ISVa6 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.8	8.8e-44
WP_086558351.1|716672_717911_+|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_096037040.1|717955_718240_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_061778452.1|718236_718590_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_076611502.1|718649_720182_+|transposase	IS66-like element ISVa12 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.3e-69
WP_076611988.1|720271_721441_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_157733295.1|722607_722733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086558351.1|723443_724682_+|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_172859065.1|725114_725738_-	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_088729824.1|726289_726400_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_069648534.1|726396_726933_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_076612072.1|727708_728977_+|transposase	IS4-like element ISVa14 family transposase	transposase	NA	NA	NA	NA
WP_017044326.1|729818_730040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017044325.1|730032_730323_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_172859066.1|730920_731163_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_026027704.1|731181_732213_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_157733296.1|733021_733294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037231.1|733845_733965_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_172859067.1|734231_734932_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	42.7	9.8e-53
WP_096037045.1|734990_735290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037232.1|735318_735495_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_019283194.1|736328_736649_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|736645_736999_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096036126.1|737058_738591_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_013867767.1|739009_739246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626947.1|739920_740454_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017040620.1|741179_741464_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_010320663.1|741460_741739_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_026027704.1|745503_746535_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_080729748.1|749420_749555_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_096037049.1|749538_749736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172858976.1|749892_750590_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_096037050.1|750794_750920_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_096036147.1|751120_751441_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_061778452.1|751437_751791_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_076611502.1|751850_753383_+|transposase	IS66-like element ISVa12 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.3e-69
WP_096037051.1|753374_753665_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017045808.1|753672_753915_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_086558351.1|754025_755264_+|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_096037052.1|755541_756108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037023.1|756133_757102_-|transposase	IS30-like element ISVa6 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.8	8.8e-44
WP_172859068.1|757132_757309_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_096037053.1|757345_758038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096035882.1|758651_760077_+|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_096037235.1|761446_763798_+	fatty acid cis/trans isomerase	NA	NA	NA	NA	NA
WP_013867807.1|763833_764022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037055.1|764080_764578_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_013867809.1|764648_765317_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_064626169.1|765482_765878_+	DUF296 domain-containing protein	NA	NA	NA	NA	NA
WP_017042824.1|766145_767750_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	26.8	4.2e-51
WP_096037056.1|767906_769595_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010320752.1|769674_769908_-	DUF3389 domain-containing protein	NA	NA	NA	NA	NA
WP_172859069.1|769909_770362_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_172859070.1|771359_771926_+	PhnA domain-containing protein	NA	NA	NA	NA	NA
WP_017042819.1|772076_772268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611988.1|772530_773700_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
>prophage 6
NZ_CP023311	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 2, complete sequence	1282503	786653	839673	1282503	holin,transposase,protease	Bacillus_virus(25.0%)	38	NA	NA
WP_096037068.1|786653_788354_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	32.7	3.5e-64
WP_096037069.1|788390_789335_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_096037070.1|789384_790233_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_096037071.1|790235_791423_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	34.2	6.0e-26
WP_096037072.1|792099_793545_-	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_096037073.1|793554_795213_-	DUF3763 domain-containing protein	NA	A0A2H4PB07	Aphanizomenon_phage	27.4	8.6e-31
WP_017048791.1|795490_796006_+	NUDIX hydrolase	NA	Q5ULM8	Lactobacillus_virus	30.5	3.0e-06
WP_096037074.1|796115_797120_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_096037075.1|797243_797954_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096037076.1|797964_799230_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.8	7.4e-59
WP_094166103.1|799829_801047_+	amino acid permease	NA	NA	NA	NA	NA
WP_161437648.1|801233_802661_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.4	5.0e-11
WP_029189705.1|802756_803773_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	46.5	8.0e-80
WP_088721589.1|803980_804724_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_094127122.1|804777_805497_+	allophanate hydrolase subunit 1	NA	NA	NA	NA	NA
WP_172859071.1|805493_806423_+	biotin-dependent carboxyltransferase	NA	NA	NA	NA	NA
WP_172859072.1|806467_807916_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096037079.1|808224_810666_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013867953.1|810665_811340_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.7e-23
WP_017046085.1|811338_811941_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_017043170.1|812022_813222_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_096037236.1|813422_815333_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_096037237.1|815420_817076_+	ABC-ATPase domain-containing protein	NA	NA	NA	NA	NA
WP_013867958.1|817242_817905_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_064626276.1|818172_818841_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_172859073.1|819124_819817_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_096037081.1|819957_821748_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_013867962.1|821818_822328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172859074.1|822516_822993_+	CreA family protein	NA	A0A2I7SAK3	Vibrio_phage	38.9	6.7e-21
WP_096037083.1|823106_824411_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_096037084.1|824704_826420_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_017043356.1|826540_827260_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_096037085.1|831360_832290_-	agmatinase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	26.5	2.7e-05
WP_172859075.1|832290_834201_-	arginine decarboxylase	NA	NA	NA	NA	NA
WP_096037086.1|834388_835264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037087.1|835552_836740_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.2	9.8e-29
WP_096037088.1|836742_837846_+	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_076611988.1|838503_839673_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
>prophage 7
NZ_CP023311	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 2, complete sequence	1282503	863684	913571	1282503	transposase	Planktothrix_phage(18.18%)	39	NA	NA
WP_076611988.1|863684_864854_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_094123417.1|865042_866815_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	7.8e-30
WP_013867851.1|866911_867481_-	YceI family protein	NA	NA	NA	NA	NA
WP_096037099.1|867477_868017_-	cytochrome b	NA	NA	NA	NA	NA
WP_026029124.1|868358_868994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611649.1|869555_870671_-|transposase	ISAs1-like element ISVa13 family transposase	transposase	NA	NA	NA	NA
WP_096037100.1|871426_873019_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	4.9e-23
WP_017046433.1|873015_874059_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096037101.1|874055_875141_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_172859077.1|875150_876968_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038169737.1|877219_878167_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_026027704.1|878876_879908_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096037103.1|880233_881415_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_017046428.1|881477_881945_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	60.9	5.5e-52
WP_026028505.1|881968_884089_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.9	2.1e-268
WP_026027704.1|887117_888149_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096037104.1|890932_891958_-	efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	24.9	6.3e-08
WP_013867868.1|892008_892467_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_096037105.1|892477_892897_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_013867870.1|892927_893257_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017042380.1|893389_893575_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_086558351.1|894290_895529_+|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_019282651.1|896747_898103_-	response regulator	NA	NA	NA	NA	NA
WP_096037106.1|898078_899737_-	EAL domain-containing protein	NA	W8CYM9	Bacillus_phage	25.0	3.6e-05
WP_096037107.1|899741_901073_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_064626200.1|901099_902407_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	26.9	3.4e-14
WP_013867877.1|902416_902998_-	chemotaxis protein CheC	NA	NA	NA	NA	NA
WP_019282209.1|902994_903360_-	response regulator	NA	NA	NA	NA	NA
WP_019282210.1|903396_904572_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_096037108.1|904576_904882_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_094145712.1|905046_906021_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	28.1	9.9e-11
WP_017046416.1|906159_906597_+	DUF3069 domain-containing protein	NA	NA	NA	NA	NA
WP_172859078.1|906714_907821_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	36.9	4.4e-23
WP_017046414.1|907820_908510_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_096037110.1|908499_909273_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096037111.1|909274_910750_-	cobyric acid synthase	NA	NA	NA	NA	NA
WP_026028331.1|910923_911295_+	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_017046411.1|911431_911956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026027704.1|912539_913571_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP023311	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 2, complete sequence	1282503	944509	1071375	1282503	tRNA,transposase	Escherichia_phage(17.39%)	105	NA	NA
WP_172858976.1|944509_945207_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_096037122.1|945373_947920_-	response regulator	NA	A0A1V0SGX0	Hokovirus	34.5	3.6e-52
WP_094133943.1|947935_949036_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017046397.1|949279_950431_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_013867913.1|950526_950850_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	49.3	3.0e-12
WP_094124983.1|950850_951504_-	YceH family protein	NA	NA	NA	NA	NA
WP_026028336.1|951561_951765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010319897.1|951955_952273_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_013867916.1|952580_952832_+	YgjV family protein	NA	A0A248SJ16	Salicola_phage	40.3	1.6e-05
WP_026029114.1|952981_954502_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_010319894.1|954554_955409_-	aquaporin family protein	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	29.3	2.9e-14
WP_096037123.1|955938_957588_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_096037124.1|957584_958898_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_064626232.1|958894_960121_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_076611988.1|960195_961365_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_013868112.1|961650_962400_-	phosphate ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	24.6	6.2e-13
WP_026027681.1|962445_963309_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_017045968.1|963314_964247_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_086558351.1|965080_966319_+|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_069212245.1|966937_967840_-	DMT family transporter	NA	NA	NA	NA	NA
WP_069212244.1|967937_969383_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.5	2.0e-20
WP_013868118.1|969473_969995_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017045964.1|970012_970258_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_026027933.1|970309_970918_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_069212243.1|971145_972981_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_019281242.1|973022_973166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037125.1|973606_973954_+	DUF3316 domain-containing protein	NA	NA	NA	NA	NA
WP_096037126.1|974106_974511_+	2-oxoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_172859080.1|974602_975805_-	lytic polysaccharide monooxygenase	NA	Q91BI7	Spodoptera_litura_multicapsid_nucleopolyhedrovirus	36.0	4.8e-31
WP_026029046.1|976272_977649_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_096037128.1|977748_978810_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_096037129.1|978873_979758_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.1	5.1e-06
WP_096037130.1|979843_980641_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_096037131.1|980738_982442_+	acetolactate synthase AlsS	NA	M4QSI1	Ostreococcus_lucimarinus_virus	23.2	3.4e-22
WP_096037132.1|982438_983197_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.0	7.7e-11
WP_096037133.1|983611_985537_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_076611988.1|985999_987169_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_076611649.1|988090_989206_-|transposase	ISAs1-like element ISVa13 family transposase	transposase	NA	NA	NA	NA
WP_019282661.1|991658_992420_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_096037134.1|992926_993172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037135.1|993367_996124_+	immune inhibitor A	NA	NA	NA	NA	NA
WP_096037136.1|996197_997058_-	lipase chaperone	NA	NA	NA	NA	NA
WP_088733177.1|997127_998069_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_096037240.1|998334_1000557_-	hemolysin	NA	NA	NA	NA	NA
WP_096037137.1|1001063_1002314_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_172859081.1|1002352_1002808_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_172859082.1|1002957_1003914_+	DMT family transporter	NA	NA	NA	NA	NA
WP_096037140.1|1003983_1005309_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096037141.1|1005334_1006687_-	molecular chaperone	NA	NA	NA	NA	NA
WP_010317931.1|1006794_1007052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611988.1|1007390_1008560_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_096037142.1|1008616_1009132_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017046070.1|1009128_1010475_+	magnesium transporter	NA	NA	NA	NA	NA
WP_096037143.1|1010610_1012029_-	aspartate kinase	NA	NA	NA	NA	NA
WP_013867980.1|1012077_1012464_-	ectoine synthase	NA	NA	NA	NA	NA
WP_047689962.1|1012473_1013739_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.9	1.0e-20
WP_013867982.1|1013750_1014317_-	diaminobutyrate acetyltransferase	NA	NA	NA	NA	NA
WP_172859083.1|1015361_1015874_-	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_029388415.1|1015978_1016809_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	48.2	7.5e-60
WP_013867986.1|1016902_1017364_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010318562.1|1017873_1018176_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_013867989.1|1018297_1018924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172859084.1|1018987_1020094_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017043337.1|1020270_1020879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037146.1|1020976_1022845_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	84.3	5.3e-13
WP_096037147.1|1022920_1024288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037148.1|1024560_1025241_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_013867995.1|1025360_1025561_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_096035922.1|1026827_1027949_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_096037149.1|1029077_1030034_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_013867998.1|1030054_1030981_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_013867999.1|1030977_1031448_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_096037150.1|1031455_1032424_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_096037151.1|1032416_1034411_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_096037152.1|1034404_1036057_+	BatD family protein	NA	NA	NA	NA	NA
WP_026027736.1|1036175_1036892_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_094123584.1|1036939_1039087_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_013868005.1|1039377_1039860_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_172858976.1|1040084_1040781_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_026028221.1|1041138_1041354_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_096037153.1|1041463_1043419_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_096037154.1|1043692_1044202_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_172858976.1|1044225_1044923_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_013868010.1|1045347_1045707_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_076611649.1|1045852_1046968_-|transposase	ISAs1-like element ISVa13 family transposase	transposase	NA	NA	NA	NA
WP_096035882.1|1048771_1050198_-|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_019281856.1|1051953_1052187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037155.1|1052580_1052955_-	isochorismatase	NA	NA	NA	NA	NA
WP_026027704.1|1053127_1054159_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096037156.1|1054179_1055028_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019281860.1|1055170_1055920_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_019281861.1|1056117_1057149_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	90.4	2.3e-21
WP_096037157.1|1057145_1058342_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	28.7	3.3e-40
WP_096037158.1|1058516_1059440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096037159.1|1059449_1059833_+	VOC family protein	NA	NA	NA	NA	NA
WP_017046046.1|1059862_1060240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037160.1|1060572_1061967_+	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_096037161.1|1062162_1062768_+	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_096037162.1|1062767_1064303_+	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_096037163.1|1064322_1065657_+	MFS transporter	NA	NA	NA	NA	NA
WP_013868020.1|1065702_1066089_-	soluble cytochrome b562	NA	NA	NA	NA	NA
WP_013868021.1|1066186_1066930_-	phosphatase	NA	NA	NA	NA	NA
WP_096037164.1|1067119_1067341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172858976.1|1067399_1068096_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_013868023.1|1070775_1071375_-|tRNA	tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP023311	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 2, complete sequence	1282503	1074782	1171954	1282503	transposase	uncultured_Caudovirales_phage(15.79%)	54	NA	NA
WP_026027704.1|1074782_1075814_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_096037166.1|1076054_1077113_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_019280807.1|1077197_1077527_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	6.3e-18
WP_013868030.1|1077826_1079317_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	75.7	8.7e-208
WP_096037167.1|1079327_1080176_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	43.1	7.7e-60
WP_096037168.1|1080429_1081632_+	acyl-homoserine-lactone synthase VanM	NA	NA	NA	NA	NA
WP_096037169.1|1081624_1084204_+	hybrid sensor histidine kinase/response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	26.7	1.6e-12
WP_172859094.1|1084562_1084799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172858976.1|1084887_1085585_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
WP_096037170.1|1085996_1086977_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017048950.1|1087237_1088116_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172859085.1|1088448_1090434_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017048948.1|1090438_1091707_+	MFS transporter	NA	NA	NA	NA	NA
WP_096037172.1|1091818_1098007_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.3	3.8e-39
WP_096037173.1|1098081_1109976_+	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	41.7	2.9e-56
WP_096037174.1|1109962_1111063_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_096037175.1|1111059_1111932_+	thioesterase	NA	NA	NA	NA	NA
WP_096037176.1|1111924_1113319_+	salicylate synthase	NA	NA	NA	NA	NA
WP_096037177.1|1113315_1114974_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_096037178.1|1115321_1117019_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	1.6e-24
WP_017046020.1|1117011_1118667_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.7	1.1e-20
WP_029388143.1|1119427_1120168_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_096036032.1|1120921_1122098_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.8	1.9e-117
WP_096037242.1|1122427_1123333_-	reverse transcriptase N-terminal domain-containing protein	NA	A0A0U4J920	Pseudomonas_phage	53.8	4.6e-87
WP_069212164.1|1124304_1125396_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_069212165.1|1125560_1126217_-	amino acid adenylation	NA	NA	NA	NA	NA
WP_019281653.1|1126286_1127180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069212166.1|1127182_1128625_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_096037179.1|1133092_1136806_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.7	6.2e-29
WP_096037180.1|1136806_1140115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076612072.1|1140252_1141521_+|transposase	IS4-like element ISVa14 family transposase	transposase	NA	NA	NA	NA
WP_019283227.1|1141893_1143126_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	32.5	6.6e-20
WP_019283228.1|1143122_1144718_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	29.4	9.1e-30
WP_019283229.1|1144880_1148312_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	25.3	2.5e-16
WP_019283230.1|1148384_1149869_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_019283231.1|1150059_1151244_+	TniQ family protein	NA	NA	NA	NA	NA
WP_019283232.1|1151244_1153167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283233.1|1153138_1154197_+	type I-F CRISPR-associated protein Csy3	NA	A0A2I7RCY7	Vibrio_phage	24.6	5.9e-09
WP_019283234.1|1154199_1154799_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_076611988.1|1156005_1157175_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_026028891.1|1157486_1158761_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_096035882.1|1158838_1160265_-|transposase	IS66-like element ISVa8 family transposase	transposase	NA	NA	NA	NA
WP_157733297.1|1160287_1160434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037182.1|1160806_1162768_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_013868344.1|1162869_1163937_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_026027147.1|1164060_1164816_-	HTH-type transcriptional regulator UlaR	NA	A0A077SK06	Escherichia_phage	25.5	1.5e-14
WP_096037183.1|1165206_1166967_+	PTS ascorbate-specific subunit IIBC	NA	NA	NA	NA	NA
WP_019282359.1|1167044_1167527_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_096037184.1|1167534_1168227_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_096037185.1|1168232_1169054_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_096037186.1|1169059_1169707_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_029189691.1|1169715_1170597_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_094126674.1|1170784_1171207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172858976.1|1171256_1171954_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	52.2	1.4e-67
>prophage 10
NZ_CP023311	Vibrio anguillarum strain VIB12 isolate Sea bass chromosome 2, complete sequence	1282503	1180540	1235898	1282503	transposase	uncultured_Caudovirales_phage(20.0%)	41	NA	NA
WP_026027704.1|1180540_1181572_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_047691023.1|1181769_1182156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017050233.1|1182221_1182482_-	DUF3012 domain-containing protein	NA	NA	NA	NA	NA
WP_013868176.1|1182788_1183208_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_013868175.1|1183228_1184734_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	3.4e-18
WP_013868174.1|1184730_1185714_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_010320543.1|1185787_1186666_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	22.4	5.6e-05
WP_088733566.1|1186843_1187764_+	ribokinase	NA	NA	NA	NA	NA
WP_088733565.1|1187780_1188788_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_088733564.1|1188833_1189457_-	DsbA family protein	NA	NA	NA	NA	NA
WP_096037190.1|1189450_1190314_-	MBL fold metallo-hydrolase	NA	F2NZ47	Diadromus_pulchellus_ascovirus	27.1	2.1e-20
WP_010320538.1|1190424_1191327_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017050239.1|1191380_1191521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019283138.1|1191654_1193103_-	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	31.7	3.0e-32
WP_017046895.1|1193116_1193833_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_026027598.1|1193829_1195332_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.3	1.0e-86
WP_064626500.1|1195688_1196201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037191.1|1196410_1198771_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_026027704.1|1198924_1199956_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_010316838.1|1201495_1202230_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010316840.1|1202236_1203073_+	arginase family protein	NA	NA	NA	NA	NA
WP_172859086.1|1203190_1204759_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	2.4e-14
WP_096037193.1|1204782_1205343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026027704.1|1205459_1206491_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_076611649.1|1207069_1208185_+|transposase	ISAs1-like element ISVa13 family transposase	transposase	NA	NA	NA	NA
WP_172859087.1|1208204_1210751_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.3	2.6e-34
WP_013868180.1|1210892_1211411_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_096037195.1|1211701_1213891_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_096037196.1|1214076_1216254_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_013868184.1|1216355_1218809_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	7.5e-15
WP_013868185.1|1219395_1222104_+	HTH-type transcriptional regulator MalT	NA	NA	NA	NA	NA
WP_026027197.1|1222166_1222523_-	YibL family ribosome-associated protein	NA	NA	NA	NA	NA
WP_096037197.1|1222814_1224476_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.3	4.4e-19
WP_038148283.1|1224613_1225096_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	44.2	2.7e-25
WP_096036791.1|1226114_1227587_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.5	4.2e-130
WP_076611988.1|1228165_1229335_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_019283194.1|1230658_1230979_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|1230975_1231329_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096036126.1|1231388_1232921_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_096037198.1|1233341_1234442_-	CZB domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.4	1.5e-10
WP_096037199.1|1234509_1235898_-|transposase	IS4-like element ISVa18 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.8	2.9e-48
>prophage 1
NZ_CP023312	Vibrio anguillarum strain VIB12 isolate Sea bass plasmid p292, complete sequence	292095	3310	53762	292095	transposase	Leptospira_phage(38.46%)	46	NA	NA
WP_096036778.1|3310_4864_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.3	2.8e-68
WP_095661301.1|4977_5559_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_019283123.1|5746_7219_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	1.8e-133
WP_052715040.1|7904_8456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046224416.1|8570_9419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156155679.1|9538_9916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172859095.1|10249_10969_-	hypothetical protein	NA	A0A0N9SHY1	Staphylococcus_phage	34.1	2.0e-29
WP_096036126.1|11100_12633_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_019283195.1|12692_13046_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_019283194.1|13042_13363_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096036990.1|13911_15088_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.5	3.6e-116
WP_011154643.1|16412_17333_+|transposase	IS5-like element ISVa2 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	100.0	1.7e-177
WP_019283194.1|18011_18332_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|18328_18682_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096036126.1|18741_20274_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_019283194.1|20454_20775_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|20771_21125_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096036126.1|21184_22717_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_019283194.1|22897_23218_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|23214_23568_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096036126.1|23627_25160_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_096037248.1|25474_27163_-	hypothetical protein	NA	G9CU58	Helicobacter_phage	30.8	2.9e-10
WP_096037249.1|27174_28404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037250.1|28400_29975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172859096.1|29991_32355_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_096037252.1|32456_32945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037253.1|32956_33358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037254.1|33363_35979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037255.1|36057_37035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037256.1|37043_38120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037257.1|38112_39009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037258.1|39008_40064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037259.1|40072_41860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037260.1|41877_42216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157733301.1|42997_43264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086558351.1|43523_44762_-|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_096037263.1|44802_45180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037264.1|45186_46617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037265.1|46606_47188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037266.1|47197_47764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037267.1|47767_48601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037268.1|48916_49630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037269.1|49671_49950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086558351.1|50291_51530_+|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_019283195.1|51693_52047_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_086558351.1|52523_53762_+|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
>prophage 2
NZ_CP023312	Vibrio anguillarum strain VIB12 isolate Sea bass plasmid p292, complete sequence	292095	62784	145603	292095	transposase,integrase	Mycobacterium_phage(29.41%)	60	64889:64948	125770:127137
WP_096037281.1|62784_63915_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_096037282.1|63981_64533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037283.1|64619_64937_+	hypothetical protein	NA	NA	NA	NA	NA
64889:64948	attL	GGAGCTATTGTCAAATGTGGTGTATGGAGATCATGCAGTAGCCTGTTGATGAGTCTCCAT	NA	NA	NA	NA
WP_086558351.1|64918_66157_-|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_157733305.1|66528_66756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037285.1|67615_68008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037492.1|68387_71936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096036147.1|72263_72584_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096036148.1|72580_72934_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_076611502.1|72993_74526_+|transposase	IS66-like element ISVa12 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.3e-69
WP_096037286.1|75074_76514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037287.1|76510_81418_-	AAA family ATPase	NA	A0A076FFX0	Aureococcus_anophage	19.9	4.0e-07
WP_096037288.1|81995_82316_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096037289.1|83839_84994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037290.1|84996_85335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172859098.1|85891_86245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037293.1|86407_87724_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_096037294.1|87787_90223_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	24.1	5.3e-45
WP_096037295.1|90400_90901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037296.1|90908_91880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037297.1|92059_92779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037298.1|93075_93360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037299.1|93511_95107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037300.1|95210_96860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037301.1|96914_99011_+	strawberry notch family protein	NA	NA	NA	NA	NA
WP_019283194.1|99062_99383_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|99379_99733_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096036126.1|99792_101325_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_096037302.1|101293_104896_+	strawberry notch C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096037303.1|104915_105227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037304.1|105242_107867_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	32.8	5.3e-75
WP_096037305.1|107942_108950_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	57.9	2.1e-109
WP_096037306.1|109005_109518_-	PadR family transcriptional regulator	NA	A0A2I7RSZ7	Vibrio_phage	33.6	4.1e-08
WP_096037308.1|110083_110368_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_086558351.1|111588_112827_-|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_096037309.1|113403_114405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037310.1|114404_115139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157733307.1|115141_116077_-	recombination-associated protein RdgC	NA	NA	NA	NA	NA
WP_096037312.1|116200_117715_+	ATP-dependent DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	32.3	7.1e-40
WP_096037313.1|117836_118583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037314.1|118579_118987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037315.1|118979_119576_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_096037316.1|119707_119962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037317.1|119972_120455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037318.1|120454_121261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037319.1|121270_121969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037320.1|121958_122879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019283123.1|123559_125032_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	1.8e-133
WP_086558351.1|125799_127038_-|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_088720970.1|127554_128731_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	65.1	5.6e-117
125770:127137	attR	GGAGCTATTGTCAAATGTGGTGTATGGAGATCATGCAGTAGCCTGTTGATGAGTCTCCATTTCTTTCACTCCATTAATGAAGCGAACATCTTTCACAACATCCGCGAGGAGTGCAAAACCTCGTAGACGACGCCACTTCGTCTCTGCACTGCGCATTAACTTGTAGGCCATCATCAACGTAGTCTTTCTGTTTCCACAGTTCTTTGTCTTGTTCGTGCGTAAACGTACTGTGGCGAACATCGATTCTATTGGGTTGGTTGTTCTGATATGAACCCAATGCTCTGCTGGGTAATCGTAGAACGCCAGCATTTCAGCTTTATCTTTCACCAAGCAGTCGGTTGCCTTTGGATACTTGGCTTCAAAGCGCTTCTGGAAGGTTGAGACGGCGTGATAAGCATCATCTCGAGTTTCTGCCATCCAGATATCTTGCAGGGCTTCCTTCATTCGTGGTTGTACGCTTTTGGGCACCTTGTTCAGCACATTAGCCGTCTTATGTACCCAGCACCGTTGCTGAGTCGTTTGAGGCCAGCACTTAGCAACCGCTTTCCAGAAGCCAAGCGCGCCATCTCCGATGGCGAGCTTCGGTGCTAACTGTAATCCCTGCGCTCGTAACTGCTCAATGAGTTCCGTCCAACTTGCTTCTGACTCTCTATGACCATCCAGAACGCCAAGGACTTCTTTGCGTCCAGTGTCATCGACCCCAATGATGACGAGTAAGCAGAGCTTATCGTCCATCCTAACGTGACAGTAAACACCGTCAGCCCAAACGTAAACATAGCGACGCCTACCGAGCTCACGCTTACGCCACTGTTCGTACTCAGCATACCAGCGCTCTTTGAGGCGACAGATGCTGTTGGCTGACAGGCCTTTCGCATCCTTACCAAGCAGAGACTCCAGAGCAGGCAGCATATCGCCCGTAGATATCCCCTTGAGATAGAGTAACGGGAGCAGTGTTGCTACGCTCTTTGTTCGCTTGAGATACGGTGGTATCAAGTTGCTATTAAATTTGACGCCATTCCCTGAGCGATCTCGTACCTTAGGAATTTGCACTTCGACATCACCGACACCTGTTTGCAAGGTTCGCTCAGGTAAGAAACCGTTGCGAACGATGGCTTGCTTGCCGTCAACCATTACATTCTGGTGTTGTGCAAGTAACTGTTGAAGCTCAGCTTCAACAGCTTGTGCAATCAAATCTCTAGCCCCTTGACGTATCAGTTCTGTAAGCGGGTCTTGTGGTGTATTCAGTGAAACAACAGTATTATCAGTCATGCGGTGTACCTTTCTGTTAATCGTTCTGGCGAGAACTACATCAACAGATTACACCGCAACTTCCTTTCTCTTCCATACACCAGAAATCAGCATAGCTCT	NA	NA	NA	NA
WP_096036132.1|128874_129612_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	50.9	1.0e-55
WP_096037321.1|131018_131276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037322.1|132135_133164_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096037324.1|134046_134451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086558351.1|134687_135926_-|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_076612072.1|136635_137904_+|transposase	IS4-like element ISVa14 family transposase	transposase	NA	NA	NA	NA
WP_157733308.1|138346_140311_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_086558351.1|141337_142576_+|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_096037326.1|143088_143490_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096036381.1|144453_145603_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.1	1.8e-51
>prophage 3
NZ_CP023312	Vibrio anguillarum strain VIB12 isolate Sea bass plasmid p292, complete sequence	292095	161501	197471	292095	transposase	Leptospira_phage(28.57%)	48	NA	NA
WP_086558351.1|161501_162740_-|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_096037346.1|162836_163199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037347.1|163326_164778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037348.1|164786_165824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037349.1|165866_166526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037350.1|166664_167723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037351.1|167751_168258_-	Fe3+-citrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_076611988.1|168519_169689_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_096037352.1|169915_170188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172859101.1|170168_170477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037355.1|170967_172062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037356.1|172066_172573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037357.1|172598_173675_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_096037358.1|173839_174949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157733309.1|175338_175674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037360.1|175981_176230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037361.1|176241_176637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037362.1|176858_177287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037363.1|177403_177829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037364.1|177938_178322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037365.1|178334_178514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036126.1|178973_180506_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_019283195.1|180565_180919_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_019283194.1|180915_181236_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_157733311.1|181993_182476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037368.1|183042_183417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037369.1|183472_183742_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096037370.1|183867_184179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037371.1|184175_185198_-	virulence protein RhuM/Fic/DOC family protein	NA	Q9JMN3	Wolbachia_phage	39.1	7.2e-20
WP_172859102.1|185481_186405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037373.1|187016_187205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037374.1|187234_187561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037375.1|187599_187881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172859103.1|187888_188245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157733315.1|188548_188725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037377.1|188711_189176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611502.1|189245_190778_-|transposase	IS66-like element ISVa12 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.3e-69
WP_096036148.1|190837_191191_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096036147.1|191187_191508_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096037378.1|191584_191944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037379.1|191996_193531_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	24.8	2.1e-07
WP_096037380.1|193577_193823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037381.1|193851_194166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037382.1|194241_194532_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096037383.1|194605_194914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172859104.1|194931_195114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037385.1|195504_196158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096036072.1|196293_197471_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.8	1.9e-117
>prophage 4
NZ_CP023312	Vibrio anguillarum strain VIB12 isolate Sea bass plasmid p292, complete sequence	292095	208793	227985	292095	transposase,integrase	Leptospira_phage(20.0%)	29	200605:200618	217294:217307
200605:200618	attL	TCTTCAGGATTTTC	NA	NA	NA	NA
WP_096037394.1|208793_210113_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_096037395.1|210244_210523_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_096037396.1|210576_210768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094125949.1|210822_211041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037397.1|211054_211258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157733317.1|211351_211528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037398.1|211517_211754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037399.1|211768_211963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037400.1|211973_212159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037401.1|212172_212544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157733318.1|212562_212760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157733319.1|212770_213094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037403.1|213104_213290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157733320.1|213306_213558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037405.1|213568_213958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157733321.1|214095_214248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283194.1|214689_215010_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|215006_215360_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096036126.1|215419_216952_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.2e-71
WP_096037406.1|217126_217693_-	hypothetical protein	NA	NA	NA	NA	NA
217294:217307	attR	TCTTCAGGATTTTC	NA	NA	NA	NA
WP_096037407.1|217709_218327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037408.1|218494_220126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037409.1|220139_220817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037410.1|220906_221734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086558351.1|221820_223059_+|transposase	IS256-like element ISVa19 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.4e-89
WP_096037411.1|223189_224884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096037412.1|224887_226045_+	toprim domain-containing protein	NA	B8Q5B5	Abalone_shriveling_syndrome-associated_virus	37.2	2.3e-14
WP_096037413.1|226357_227500_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	68.5	2.3e-131
WP_096037414.1|227556_227985_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	48.5	2.4e-25
