The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	0	31658	4085488	integrase	Bacillus_phage(88.89%)	42	25927:25946	33170:33189
WP_094246812.1|699_969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045207835.1|1093_1441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246810.1|1502_2021_-	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	90.7	6.3e-89
WP_094246809.1|1998_2526_-	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	80.6	3.5e-71
WP_014471960.1|2522_2681_-	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	62.7	4.2e-12
WP_014471961.1|2685_2889_-	YorP family protein	NA	O64150	Bacillus_phage	74.6	2.5e-25
WP_096034844.1|2900_3608_-	hypothetical protein	NA	A0A1P8CX16	Bacillus_phage	34.8	2.2e-23
WP_096034845.1|3634_7564_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	81.8	0.0e+00
WP_014471964.1|7576_9307_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	90.3	8.0e-306
WP_096034846.1|9306_10443_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	89.4	8.1e-206
WP_096034847.1|10458_11976_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	71.7	2.7e-212
WP_096034848.1|11990_12461_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	87.8	1.4e-79
WP_096034849.1|12500_13472_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	96.0	5.3e-174
WP_096034850.1|13560_14475_-	hypothetical protein	NA	O64140	Bacillus_phage	90.1	1.6e-156
WP_096034851.1|14497_14878_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	78.4	9.1e-53
WP_172645811.1|15134_15302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096034852.1|15407_15785_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	5.8e-52
WP_096034853.1|16124_16649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096034854.1|16762_18505_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	64.1	2.3e-220
WP_186434473.1|18501_19323_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	66.5	1.1e-98
WP_096034855.1|19423_19822_-	hypothetical protein	NA	O64133	Bacillus_phage	63.6	5.2e-43
WP_096034856.1|20006_20342_-	hypothetical protein	NA	A0A2H4J4P5	uncultured_Caudovirales_phage	72.5	7.8e-32
WP_096034857.1|20338_20794_-	hypothetical protein	NA	A0A2P0ZLC1	Lactobacillus_phage	52.6	5.1e-18
WP_096034858.1|20845_21067_-	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	91.7	6.7e-32
WP_096034859.1|21138_21813_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	95.8	2.7e-76
WP_096034860.1|21882_22695_+	hypothetical protein	NA	O64130	Bacillus_phage	86.7	6.7e-138
WP_014470179.1|22999_23164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470178.1|23278_23653_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	63.4	1.7e-35
WP_096034861.1|23666_23888_-	hypothetical protein	NA	O64123	Bacillus_phage	93.0	3.7e-30
WP_014470176.1|24010_24850_-	site-specific DNA-methyltransferase	NA	A0A2H4IZ65	uncultured_Caudovirales_phage	59.1	1.6e-78
WP_014470175.1|24888_25281_-	hypothetical protein	NA	A0A0A8WEI8	Clostridium_phage	46.9	6.3e-25
WP_096034862.1|25359_25557_-	hypothetical protein	NA	NA	NA	NA	NA
25927:25946	attL	TTATTTTATTTTTATTCTAA	NA	NA	NA	NA
WP_020954128.1|25967_26213_-	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
WP_045207904.1|26287_26587_-	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	52.0	2.7e-20
WP_014471994.1|26751_26973_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	78.1	1.4e-26
WP_096034863.1|27194_28178_-|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	78.3	6.7e-140
WP_096034864.1|28198_29548_-	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	74.6	6.5e-186
WP_094246784.1|29624_30683_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	76.0	7.9e-155
WP_021493556.1|30692_30857_-	hypothetical protein	NA	A0A1P8CWX2	Bacillus_phage	52.6	5.1e-05
WP_046559781.1|30895_31126_-	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
WP_014472000.1|31140_31353_-	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
WP_014472001.1|31502_31658_-	hypothetical protein	NA	A0A1P8CWW2	Bacillus_phage	68.6	8.3e-13
33170:33189	attR	TTATTTTATTTTTATTCTAA	NA	NA	NA	NA
>prophage 2
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	35102	35968	4085488		Bacillus_phage(100.0%)	4	NA	NA
WP_014417905.1|35102_35234_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	9.4e-18
WP_094246781.1|35245_35461_-	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	52.1	6.7e-13
WP_094246780.1|35463_35715_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	62.7	3.2e-22
WP_041482308.1|35785_35968_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.7	1.0e-25
>prophage 3
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	39272	39476	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_014470137.1|39272_39476_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	80.3	4.0e-23
>prophage 4
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	42905	64643	4085488		Bacillus_phage(46.15%)	22	NA	NA
WP_096034867.1|42905_43151_-	hypothetical protein	NA	A0A0K2FMQ2	Brevibacillus_phage	50.8	1.5e-08
WP_096034868.1|43150_43378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246769.1|43420_43699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247871.1|43753_44017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096034869.1|44021_44729_-	hypothetical protein	NA	E5DV90	Deep-sea_thermophilic_phage	39.7	7.9e-34
WP_094247870.1|44831_45026_-	hypothetical protein	NA	A0A1B1P8C9	Bacillus_phage	39.3	7.2e-06
WP_094246767.1|45195_45801_-	MmcB family DNA repair protein	NA	NA	NA	NA	NA
WP_096034870.1|45965_47567_-	DUF4942 domain-containing protein	NA	A0A2I7RNS1	Vibrio_phage	33.1	1.4e-14
WP_186434474.1|47617_49480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096034872.1|49788_51021_-	hypothetical protein	NA	O64082	Bacillus_phage	64.5	6.4e-156
WP_096034873.1|51100_51340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057080559.1|52808_53921_-	cell division protein FtsZ	NA	G3MBK4	Bacillus_virus	30.0	1.7e-30
WP_038458716.1|53920_54205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038458718.1|54383_54620_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046559799.1|54739_54919_+	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	71.2	2.0e-18
WP_145979849.1|54959_57476_+	hypothetical protein	NA	O64076	Bacillus_phage	80.9	0.0e+00
WP_096034875.1|57693_57969_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	87.9	3.1e-34
WP_003230977.1|59609_59810_+	YonK family protein	NA	NA	NA	NA	NA
WP_096034878.1|59821_61033_+	metallophosphoesterase	NA	A0A0N9SK37	Staphylococcus_phage	37.2	2.4e-67
WP_096034879.1|61345_61825_+	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	38.7	6.8e-13
WP_096034956.1|61965_62865_+	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	27.3	4.1e-11
WP_096034957.1|63833_64643_+	hypothetical protein	NA	A0A0K2FLD6	Brevibacillus_phage	29.9	6.3e-19
>prophage 5
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	69951	86805	4085488	tail,integrase	Bacillus_phage(100.0%)	16	70496:70510	78226:78240
WP_096034882.1|69951_70617_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	50.5	1.8e-48
70496:70510	attL	TTTTTCTTTCTTTTT	NA	NA	NA	NA
WP_186434475.1|70613_71120_+	hypothetical protein	NA	O64060	Bacillus_phage	69.0	4.0e-64
WP_096034883.1|71116_71827_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	65.5	7.0e-91
WP_096034884.1|71867_72671_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	56.2	5.0e-69
WP_041482518.1|72686_73154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022553073.1|73225_73582_+	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
WP_096034885.1|73581_74916_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	34.4	6.7e-26
WP_076982967.1|75249_75444_+	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	63.0	2.6e-11
WP_014417863.1|75529_76015_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	72.9	4.8e-59
WP_096034886.1|76014_76431_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	65.5	1.8e-46
WP_014472041.1|76444_77446_+|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	86.7	2.2e-170
WP_096034959.1|77490_77706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559818.1|77828_78302_+	hypothetical protein	NA	O64047	Bacillus_phage	43.3	4.5e-25
78226:78240	attR	AAAAAGAAAGAAAAA	NA	NA	NA	NA
WP_046559819.1|78369_79050_+	hypothetical protein	NA	Q37974	Bacillus_phage	68.7	2.8e-76
WP_094246746.1|79108_85999_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	60.1	0.0e+00
WP_094246745.1|86043_86805_+|tail	phage tail family protein	tail	A0A1P8CWP8	Bacillus_phage	78.4	6.1e-109
>prophage 6
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	90136	111093	4085488	holin	Bacillus_phage(91.67%)	20	NA	NA
WP_096034887.1|90136_90955_+	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	70.5	3.5e-110
WP_096034888.1|90996_93555_+	hypothetical protein	NA	D6R401	Bacillus_phage	36.9	4.4e-143
WP_079005041.1|93727_94774_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	54.7	1.1e-87
WP_014472511.1|94880_95252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470077.1|95264_95516_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	85.5	6.9e-33
WP_014472051.1|95872_96160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020954197.1|96311_97472_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.5	1.3e-33
WP_096034890.1|97635_98250_-	DNA polymerase	NA	A0A1P8CWP4	Bacillus_phage	91.3	4.2e-92
WP_096034891.1|98290_100102_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.9	2.0e-28
WP_064778347.1|101356_101689_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	73.6	6.9e-41
WP_096034892.1|101905_102664_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_038458783.1|102791_102995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038458785.1|103013_103355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076982784.1|103556_103646_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_038458787.1|103940_104501_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	57.7	5.1e-52
WP_096034893.1|104500_106255_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	70.2	5.9e-240
WP_096034960.1|106760_107531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096034961.1|107574_108009_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_096034894.1|108271_109252_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	74.7	2.1e-77
WP_038458794.1|109518_111093_-	recombinase family protein	NA	A0A1P8CWN4	Bacillus_phage	83.0	8.2e-241
>prophage 7
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	117271	117718	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_014305226.1|117271_117718_-	GyrI-like domain-containing protein	NA	A0A1P8CX48	Bacillus_phage	73.2	6.9e-60
>prophage 8
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	124115	137734	4085488		Bacillus_phage(88.89%)	15	NA	NA
WP_094247860.1|124115_124292_-	hypothetical protein	NA	O64196	Bacillus_phage	91.4	1.9e-21
WP_032860646.1|124642_124996_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_063636671.1|125419_125656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247859.1|125779_126154_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.0	5.8e-28
WP_094247858.1|126392_126845_-	hypothetical protein	NA	O64117	Bacillus_phage	78.0	5.7e-62
WP_094247857.1|127195_128332_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	76.4	1.1e-165
WP_003153655.1|128321_128504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153654.1|129915_130275_-	hypothetical protein	NA	O64028	Bacillus_phage	60.5	1.3e-32
WP_094247856.1|130487_130946_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_094247855.1|130961_132761_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	61.5	1.4e-151
WP_088412337.1|132797_133232_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_003153650.1|133493_134474_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	75.1	5.5e-78
WP_070081995.1|134612_134933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145956754.1|135453_137121_+	recombinase family protein	NA	O64015	Bacillus_phage	90.4	1.7e-276
WP_032868763.1|137143_137734_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	31.1	1.7e-13
>prophage 9
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	145560	146837	4085488		Bacillus_phage(50.0%)	2	NA	NA
WP_015417676.1|145560_146046_-	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	45.3	3.2e-34
WP_003153622.1|146042_146837_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	67.4	3.5e-107
>prophage 10
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	156151	160122	4085488		Lactococcus_phage(33.33%)	9	NA	NA
WP_003153604.1|156151_156352_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.9	5.5e-17
WP_070082002.1|156403_156586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247851.1|156747_157005_+	DUF2564 family protein	NA	NA	NA	NA	NA
WP_003153581.1|157031_157214_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_024085518.1|157216_157888_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_077722490.1|157969_158650_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.2	9.6e-13
WP_094247939.1|158656_159049_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_003153575.1|159100_159229_+	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
WP_094247850.1|159234_160122_-	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	31.1	2.5e-21
>prophage 11
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	174428	176348	4085488		Streptomyces_phage(100.0%)	1	NA	NA
WP_094247843.1|174428_176348_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	1.8e-11
>prophage 12
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	181526	183773	4085488		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_094247840.1|181526_183773_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.3	9.6e-09
>prophage 13
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	187785	188394	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_094247938.1|187785_188394_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	34.9	4.6e-22
>prophage 14
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	193253	204084	4085488	tRNA	Moumouvirus(25.0%)	10	NA	NA
WP_003153515.1|193253_194546_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.5	7.9e-56
WP_094247835.1|194680_195862_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_094247834.1|195884_196370_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_003153512.1|196379_196550_-	YpmA family protein	NA	NA	NA	NA	NA
WP_094247833.1|196697_199484_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	28.9	1.8e-60
WP_003153510.1|199605_199989_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_058906142.1|199990_200851_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_070082024.1|200854_201688_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	38.3	3.8e-51
WP_094247832.1|201931_202909_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_094247831.1|202893_204084_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	31.3	1.8e-38
>prophage 15
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	207650	208523	4085488		Streptococcus_phage(100.0%)	1	NA	NA
WP_003153493.1|207650_208523_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.5	2.4e-72
>prophage 16
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	213919	214459	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_003153482.1|213919_214459_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	48.6	1.6e-42
>prophage 17
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	218587	224074	4085488		Acinetobacter_phage(66.67%)	6	NA	NA
WP_025649796.1|218587_219670_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	2.0e-20
WP_025649797.1|219681_220479_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_096034896.1|220471_221674_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_021494238.1|221654_222308_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017418037.1|222312_223065_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	40.5	2.9e-42
WP_017418038.1|223057_224074_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.5	7.6e-54
>prophage 18
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	227284	233951	4085488		Pandoravirus(25.0%)	9	NA	NA
WP_003153459.1|227284_228457_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.5	5.0e-41
WP_017418041.1|228528_229299_-	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_003153455.1|229488_229935_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.0	6.3e-29
WP_003153454.1|230055_231018_-	heptaprenyl diphosphate synthase component II	NA	NA	NA	NA	NA
WP_003153453.1|231046_231748_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_007409455.1|231753_232509_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003153449.1|232665_232893_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_003153448.1|232913_233486_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.7	1.3e-50
WP_003153447.1|233672_233951_-	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	75.3	1.1e-28
>prophage 19
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	246200	247070	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_003153416.1|246200_247070_-	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	39.9	5.5e-21
>prophage 20
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	253966	264157	4085488		Bacillus_phage(60.0%)	9	NA	NA
WP_025649802.1|253966_255457_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.0	4.3e-58
WP_017418053.1|255449_256508_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003153403.1|256776_257025_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	56.8	1.6e-18
WP_123117875.1|257160_257793_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_094247828.1|258221_259799_+	phosphoglycerate dehydrogenase	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	32.4	2.5e-27
WP_094247827.1|259845_260907_-	sugar dehydratase	NA	NA	NA	NA	NA
WP_003153399.1|260881_261466_-	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_094247826.1|261656_263438_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	38.1	3.0e-37
WP_045510934.1|263434_264157_-	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	43.0	1.3e-44
>prophage 21
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	269628	280437	4085488		Staphylococcus_phage(50.0%)	15	NA	NA
WP_003153383.1|269628_270780_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.6	6.0e-07
WP_003153380.1|270892_271378_-	DUF3907 family protein	NA	NA	NA	NA	NA
WP_094247824.1|271467_272061_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.0e-14
WP_094247823.1|272050_272806_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
WP_003153376.1|273013_273103_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153375.1|273190_273712_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|273777_274152_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|274268_274733_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_094247822.1|274765_275962_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	3.7e-116
WP_003153370.1|275976_276624_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_014305330.1|276604_277720_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	1.5e-55
WP_003153366.1|278116_278461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032861567.1|278708_279284_-	signal peptidase I	NA	NA	NA	NA	NA
WP_014305331.1|279364_279856_-	DUF1453 family protein	NA	NA	NA	NA	NA
WP_003153363.1|280005_280437_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	36.6	9.4e-14
>prophage 22
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	288161	294208	4085488		Bacillus_phage(25.0%)	7	NA	NA
WP_003153348.1|288161_288929_-	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	60.9	1.3e-71
WP_094247820.1|288940_289384_-	anti-sigma F factor	NA	NA	NA	NA	NA
WP_007409411.1|289380_289734_-	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_003153342.1|289829_290999_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.3	1.6e-36
WP_003153340.1|291135_291954_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	48.0	7.4e-68
WP_071391665.1|291965_293150_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_012117897.1|293317_294208_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.7	1.7e-41
>prophage 23
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	302032	305298	4085488		Bacillus_virus(50.0%)	5	NA	NA
WP_003153320.1|302032_302386_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	36.7	5.3e-07
WP_094247819.1|302396_303560_-	TIGR00375 family protein	NA	NA	NA	NA	NA
WP_003153317.1|303559_304114_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003153315.1|304192_304315_+	Z-ring formation inhibitor MciZ	NA	NA	NA	NA	NA
WP_071391661.1|304377_305298_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	34.4	1.6e-07
>prophage 24
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	309288	313958	4085488		Bacillus_phage(33.33%)	7	NA	NA
WP_094247816.1|309288_310515_+	DNA polymerase IV	NA	O64031	Bacillus_phage	44.3	3.1e-78
WP_071391657.1|310529_310874_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_003153294.1|310973_311180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247815.1|311253_312324_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_024085556.1|312415_312583_+	DUF4083 family protein	NA	NA	NA	NA	NA
WP_025852786.1|312584_312974_-	VOC family protein	NA	V5UQY3	Oenococcus_phage	51.6	9.0e-32
WP_003153290.1|312998_313958_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	36.1	2.6e-32
>prophage 25
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	317536	318379	4085488		Streptococcus_phage(100.0%)	1	NA	NA
WP_094247813.1|317536_318379_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.3	2.9e-27
>prophage 26
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	321750	341859	4085488		Paenibacillus_phage(100.0%)	3	NA	NA
WP_094247812.1|321750_327966_-	zinc-binding dehydrogenase	NA	D0R7J2	Paenibacillus_phage	29.8	3.0e-36
WP_094247811.1|327962_334118_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	27.9	1.6e-34
WP_094247810.1|334140_341859_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	28.6	3.5e-34
>prophage 27
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	363268	382939	4085488		Paenibacillus_phage(66.67%)	3	NA	NA
WP_096034897.1|363268_369565_-	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	27.7	1.1e-30
WP_094247806.1|369583_382162_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.5	1.5e-34
WP_003153268.1|382201_382939_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.6	1.3e-15
>prophage 28
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	394294	397265	4085488		Cyanophage(50.0%)	2	NA	NA
WP_053573216.1|394294_395764_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	38.8	1.6e-81
WP_003153241.1|395855_397265_-	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	34.2	7.5e-36
>prophage 29
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	404862	408822	4085488		Planktothrix_phage(50.0%)	5	NA	NA
WP_070082084.1|404862_405585_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	2.7e-37
WP_003153227.1|405577_406237_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_094247800.1|406298_407066_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003153223.1|407310_407748_-	bacilliredoxin BrxB	NA	NA	NA	NA	NA
WP_014418333.1|407925_408822_+	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	23.9	9.4e-16
>prophage 30
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	426175	427627	4085488		Staphylococcus_phage(50.0%)	2	NA	NA
WP_094247796.1|426175_426913_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	29.2	3.7e-18
WP_003153193.1|427000_427627_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1S5QTQ1	Bacillus_phage	38.8	3.5e-17
>prophage 31
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	432168	460450	4085488	tail,integrase,portal,protease,capsid,holin,plate,terminase	Bacillus_phage(29.17%)	32	438761:438775	466941:466955
WP_094247795.1|432168_433350_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.2	1.8e-27
WP_094247794.1|433706_434768_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	29.7	5.0e-32
WP_094247793.1|434795_435581_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	30.8	2.0e-17
WP_029973246.1|435740_435953_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094247792.1|435998_436334_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.7	4.4e-11
WP_029973247.1|436349_436910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069013261.1|437002_437260_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	56.5	1.6e-21
WP_094247791.1|437280_438219_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.4	2.2e-92
WP_013351581.1|438298_438508_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_014470930.1|438511_438700_-	XkdX family protein	NA	NA	NA	NA	NA
WP_033575347.1|438700_438970_-	hypothetical protein	NA	NA	NA	NA	NA
438761:438775	attL	GATTTCATTCGGAGC	NA	NA	NA	NA
WP_094247934.1|438984_440535_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	54.2	6.1e-55
WP_094247790.1|440580_443145_-	peptidase G2	NA	D6R401	Bacillus_phage	74.2	0.0e+00
WP_094247789.1|443159_444560_-|tail	phage tail protein	tail	A6M966	Geobacillus_virus	32.0	4.0e-37
WP_094247788.1|444571_445996_-|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	43.6	4.0e-61
WP_094247787.1|445999_448225_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.8	4.7e-56
WP_069449005.1|448404_449166_-	hypothetical protein	NA	A0A1W6JL91	Lactococcus_phage	36.5	4.2e-41
WP_014470937.1|449266_449875_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.2	7.0e-31
WP_069473325.1|450207_450579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351570.1|450636_451191_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_033575287.1|451215_451605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247786.1|451611_452019_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	6.1e-31
WP_046341203.1|452015_452351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045208627.1|452351_452738_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	40.7	1.2e-20
WP_046341201.1|452752_452971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045208630.1|453279_454383_-	DUF5309 family protein	NA	A0A2I7S650	Vibrio_phage	27.6	1.7e-30
WP_094247784.1|454394_455066_-|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	44.5	4.6e-15
WP_094247783.1|455158_455983_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	51.6	1.5e-71
WP_046341196.1|455982_457614_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	57.6	1.6e-167
WP_046341194.1|457616_458048_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	6.5e-31
WP_033575279.1|458064_459819_-|terminase	phage terminase large subunit	terminase	A0A2H4J484	uncultured_Caudovirales_phage	71.6	3.4e-251
WP_014470951.1|459901_460450_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	2.4e-38
466941:466955	attR	GATTTCATTCGGAGC	NA	NA	NA	NA
>prophage 32
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	464230	501421	4085488		Bacillus_phage(51.28%)	61	NA	NA
WP_094247781.1|464230_464968_+	DUF2786 domain-containing protein	NA	A0A1U9WR73	Streptococcus_virus	34.5	1.3e-23
WP_094247780.1|464981_465419_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	66.7	1.6e-48
WP_094247779.1|465549_465729_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	79.7	3.0e-22
WP_094247778.1|465743_466187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247777.1|466267_467080_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	61.7	4.4e-97
WP_158649798.1|467119_467281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247776.1|467394_468195_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	53.5	3.8e-69
WP_094247775.1|468282_468825_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	40.8	9.4e-19
WP_096034898.1|468824_469208_-	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	46.7	4.6e-20
WP_094247586.1|469287_469668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247585.1|469640_470789_-	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	75.5	6.6e-139
WP_094247584.1|470785_471358_-	dephospho-CoA kinase	NA	U5PRK9	Bacillus_phage	44.2	5.6e-38
WP_094247583.1|471354_471600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145979850.1|471596_472328_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	46.5	3.9e-28
WP_094247581.1|472599_473166_-	3D domain-containing protein	NA	A0A142F1S8	Bacillus_phage	58.8	8.3e-26
WP_094247580.1|473192_473888_-	FAD-dependent thymidylate synthase	NA	M1IQ81	Bacillus_virus	68.6	6.7e-86
WP_094247579.1|473884_474109_-	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	95.8	1.6e-33
WP_094247578.1|474109_474721_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	53.8	4.3e-44
WP_157670119.1|474717_474864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247577.1|474943_475942_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	75.8	6.5e-143
WP_045208667.1|476026_476209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247576.1|476237_478361_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	78.9	0.0e+00
WP_094247768.1|478357_478882_-	hypothetical protein	NA	A0A2K9VD13	Lactobacillus_phage	47.9	1.0e-22
WP_094247767.1|478827_479226_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	54.4	8.1e-28
WP_157829258.1|479219_479375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247765.1|479418_479604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247764.1|479851_480361_-	hypothetical protein	NA	A0A109ZVT6	Bacillus_phage	29.2	1.5e-10
WP_094247763.1|480361_480727_-	hypothetical protein	NA	A0A140HLL8	Bacillus_phage	36.8	5.2e-13
WP_072588572.1|480726_480978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247571.1|480978_481176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247762.1|481176_481710_-	crossover junction endodeoxyribonuclease RuvC	NA	A0A2H4IZL3	uncultured_Caudovirales_phage	42.9	4.7e-31
WP_094247761.1|481706_482021_-	hypothetical protein	NA	A0A0F6YQ61	Sinorhizobium_phage	60.3	6.6e-17
WP_094247760.1|482020_483079_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.4	1.6e-78
WP_094247759.1|483079_483784_-	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	44.8	4.6e-34
WP_094247758.1|483783_485940_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	52.7	4.8e-207
WP_155759818.1|485974_486130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145956752.1|486126_486306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247757.1|486295_487573_-	hypothetical protein	NA	A0A2H4J459	uncultured_Caudovirales_phage	30.5	6.9e-28
WP_094247756.1|487573_488011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247755.1|488042_488813_-	hypothetical protein	NA	A0A2H4IZK6	uncultured_Caudovirales_phage	51.4	3.5e-51
WP_094247754.1|489050_489617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172424424.1|489613_489775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247753.1|489917_490445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247752.1|490736_491906_-	hypothetical protein	NA	W8CYT9	Bacillus_phage	31.6	3.4e-42
WP_094247751.1|492009_492219_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094247750.1|492272_492512_+	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	41.2	2.1e-07
WP_094247749.1|492528_493524_-	toprim domain-containing protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.6	9.6e-70
WP_094247748.1|493658_495053_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.7	2.6e-129
WP_094247746.1|495270_495798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172424423.1|495794_496166_-	DUF2493 domain-containing protein	NA	A0A0S2MWK3	Cellulophaga_phage	62.7	5.8e-36
WP_094247745.1|496162_496945_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	54.2	8.6e-74
WP_172424417.1|496964_497117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247744.1|497113_497470_-	hypothetical protein	NA	S6B1B0	Bacillus_phage	55.0	2.6e-25
WP_094247743.1|497466_498087_-	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	52.5	2.1e-30
WP_153986733.1|498107_498278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247742.1|498303_498681_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	42.6	2.0e-20
WP_094247741.1|498677_499040_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	37.1	5.7e-12
WP_094247740.1|499254_499578_-	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	40.0	2.0e-08
WP_172424422.1|499567_499732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247739.1|499927_500305_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003153177.1|500620_501421_-	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	35.3	4.2e-07
>prophage 33
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	509469	511791	4085488		Indivirus(50.0%)	2	NA	NA
WP_003153166.1|509469_510816_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.1	2.3e-42
WP_007408350.1|510939_511791_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	43.9	1.7e-43
>prophage 34
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	524585	533590	4085488		Prochlorococcus_phage(50.0%)	8	NA	NA
WP_003153118.1|524585_525461_-	patatin-like phospholipase family protein	NA	A0A1V0SFX9	Hokovirus	27.8	3.2e-16
WP_007408338.1|525575_526004_-	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_003153114.1|526103_526940_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_007408335.1|527133_527514_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_094247737.1|527566_529042_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3ST28	Prochlorococcus_phage	42.0	3.2e-85
WP_077722590.1|529034_530381_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.4	1.9e-57
WP_094247736.1|530395_531496_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_069013074.1|531919_533590_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	31.1	2.8e-61
>prophage 35
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	555364	559748	4085488		Bacillus_virus(66.67%)	5	NA	NA
WP_094247731.1|555364_556147_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.1	1.4e-15
WP_070082116.1|556158_556965_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	7.9e-14
WP_094247730.1|556983_557868_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_007612605.1|557867_558797_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_094247729.1|558845_559748_-	phosphate ABC transporter substrate-binding protein	NA	M1U9L0	Synechococcus_phage	29.0	5.4e-11
>prophage 36
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	563559	564165	4085488		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003153025.1|563559_564165_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.6	9.3e-68
>prophage 37
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	570354	580306	4085488	tRNA	Bodo_saltans_virus(20.0%)	9	NA	NA
WP_094247726.1|570354_571248_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.7	3.2e-24
WP_017418162.1|571259_572576_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.4	1.7e-53
WP_094247725.1|572741_573434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473508.1|573556_574501_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_094247724.1|574522_575644_-	Nif3-like dinuclear metal center hexameric protein	NA	H2ECW0	Moumouvirus	46.9	1.9e-21
WP_094247931.1|575636_576341_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_003152999.1|576466_576829_-	cytochrome c	NA	NA	NA	NA	NA
WP_003152998.1|577180_578302_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.1	5.8e-39
WP_007408290.1|578494_580306_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	30.8	3.1e-50
>prophage 38
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	591452	592412	4085488		Rhizobium_phage(100.0%)	1	NA	NA
WP_003152970.1|591452_592412_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	44.7	1.8e-52
>prophage 39
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	596872	597319	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_094247720.1|596872_597319_-	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	41.2	3.8e-18
>prophage 40
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	601749	609707	4085488		Catovirus(33.33%)	6	NA	NA
WP_003152895.1|601749_602877_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.7	6.7e-27
WP_003152893.1|603062_604901_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.5	4.0e-138
WP_003152892.1|604925_605501_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_017418176.1|605560_606592_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_094247718.1|606672_607812_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_013352938.1|607871_609707_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.2	7.6e-20
>prophage 41
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	614476	617398	4085488		Clostridium_botulinum_C_phage(50.0%)	2	NA	NA
WP_094247717.1|614476_616828_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	33.9	3.5e-38
WP_003152868.1|616828_617398_-	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	56.3	3.7e-34
>prophage 42
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	620685	621255	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_003152860.1|620685_621255_-	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	30.2	6.2e-21
>prophage 43
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	629260	632927	4085488	portal	Bacillus_phage(50.0%)	5	NA	NA
WP_020956104.1|629260_629986_+	RNA polymerase sporulation sigma factor SigK	NA	A0A0A0RV91	Bacillus_phage	27.1	7.4e-11
WP_052586312.1|630333_631032_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_094247930.1|631125_631395_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_082181728.1|631964_632072_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094247713.1|632075_632927_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.7	7.5e-55
>prophage 44
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	639631	640153	4085488		Streptococcus_phage(100.0%)	1	NA	NA
WP_052587356.1|639631_640153_-	streptothricin N-acetyltransferase SatA	NA	A0A1B0RXL7	Streptococcus_phage	51.1	6.6e-46
>prophage 45
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	653348	656510	4085488		Mycobacterium_phage(100.0%)	1	NA	NA
WP_094247710.1|653348_656510_-	bifunctional cytochrome P450/NADPH--P450 reductase	NA	V5UQK0	Mycobacterium_phage	36.7	4.6e-73
>prophage 46
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	664142	667786	4085488	transposase	Staphylococcus_phage(33.33%)	4	NA	NA
WP_094246999.1|664142_665293_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
WP_013353003.1|665404_665635_-	YrhC family protein	NA	NA	NA	NA	NA
WP_003152778.1|665718_666861_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	29.2	2.8e-20
WP_014305481.1|666862_667786_-	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	43.4	6.4e-60
>prophage 47
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	672931	674842	4085488		Catovirus(50.0%)	2	NA	NA
WP_003152763.1|672931_673567_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	4.1e-34
WP_003152759.1|673573_674842_-	U32 family peptidase	NA	Q6DW11	Phage_TP	32.1	7.3e-38
>prophage 48
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	678872	683849	4085488	tRNA	Tupanvirus(50.0%)	3	NA	NA
WP_094247707.1|678872_681509_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.1	4.1e-67
WP_014305488.1|681840_682902_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_094247706.1|683120_683849_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	7.3e-35
>prophage 49
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	687048	689427	4085488		Brevibacillus_phage(100.0%)	1	NA	NA
WP_094247704.1|687048_689427_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.9	3.4e-81
>prophage 50
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	693074	709813	4085488	tRNA	Bacillus_phage(25.0%)	13	NA	NA
WP_003152729.1|693074_694343_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.6	1.5e-112
WP_094247701.1|694418_695183_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	32.0	4.1e-20
WP_007408199.1|695509_697288_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	6.6e-13
WP_094247700.1|697302_698577_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_094247699.1|698933_699104_-	YrzK family protein	NA	NA	NA	NA	NA
WP_094247698.1|699234_700797_+	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	2.0e-13
WP_007408194.1|700822_701266_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_060674703.1|701278_703483_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_003152714.1|703640_704153_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_094247697.1|704158_706519_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	1.4e-90
WP_003152709.1|706574_706901_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_012118088.1|706964_707462_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_070082161.1|707593_709813_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	2.0e-27
>prophage 51
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	713086	716802	4085488	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_003152695.1|713086_713347_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_007408186.1|713377_714523_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_003152692.1|714550_715579_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003152687.1|715604_715805_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152685.1|715797_716802_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
>prophage 52
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	724126	725278	4085488		Faustovirus(100.0%)	1	NA	NA
WP_094247693.1|724126_725278_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	26.8	3.5e-31
>prophage 53
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	741175	743818	4085488	tRNA	Catovirus(100.0%)	1	NA	NA
WP_094247689.1|741175_743818_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.2	3.7e-161
>prophage 54
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	755093	760689	4085488	protease	Moraxella_phage(33.33%)	3	NA	NA
WP_052827698.1|755093_757418_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.4e-183
WP_003152622.1|757617_759276_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_003152620.1|759426_760689_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
>prophage 55
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	766770	774725	4085488		Micromonas_sp._RCC1109_virus(33.33%)	8	NA	NA
WP_094247684.1|766770_768327_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	34.1	1.3e-09
WP_007408142.1|768313_769342_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003152598.1|769364_769883_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_060387298.1|769879_771604_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	29.7	2.4e-60
WP_020954258.1|772397_772748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007408136.1|772787_772973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038459402.1|773603_774113_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_088005422.1|774128_774725_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	31.7	1.1e-09
>prophage 56
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	778227	778452	4085488		Caldibacillus_phage(100.0%)	1	NA	NA
WP_003152579.1|778227_778452_-	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	77.0	1.5e-15
>prophage 57
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	786534	786849	4085488		Indivirus(100.0%)	1	NA	NA
WP_003152560.1|786534_786849_-	thioredoxin	NA	A0A1V0SD63	Indivirus	43.0	3.5e-10
>prophage 58
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	791962	799084	4085488		Staphylococcus_phage(33.33%)	5	NA	NA
WP_094247678.1|791962_793651_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.9	2.4e-36
WP_094247677.1|793756_794434_+	DUF2711 family protein	NA	NA	NA	NA	NA
WP_003152541.1|794572_794977_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_071391528.1|794993_797351_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	43.4	2.9e-16
WP_077723170.1|797371_799084_-	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	23.9	1.9e-12
>prophage 59
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	803527	804562	4085488	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003152530.1|803527_804562_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	32.4	5.0e-29
>prophage 60
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	826360	839524	4085488	holin,tRNA	Agrobacterium_phage(20.0%)	13	NA	NA
WP_071543361.1|826360_826882_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.5	9.3e-16
WP_094247672.1|827252_827936_-|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_003152485.1|827948_828389_-|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_058906272.1|828518_829253_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_031379151.1|829230_831012_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.8	1.6e-75
WP_014418604.1|831196_831991_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_015417978.1|832045_833977_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.3	4.9e-110
WP_003152478.1|834386_835217_-	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_070082726.1|835282_835924_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_007408085.1|835955_836891_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	30.4	5.7e-32
WP_094247671.1|836915_838325_-	replication initiation and membrane attachment family protein	NA	NA	NA	NA	NA
WP_003152473.1|838436_838895_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_003152471.1|839143_839524_-	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	2.1e-17
>prophage 61
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	842820	853743	4085488		Bacillus_phage(50.0%)	9	NA	NA
WP_003152464.1|842820_843663_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	51.5	3.9e-80
WP_031379146.1|843701_844295_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_014305562.1|844310_844943_-	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_003152460.1|845079_845910_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	31.2	5.6e-23
WP_094247670.1|845934_848574_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	28.8	1.6e-42
WP_094247669.1|848820_850560_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	42.4	6.9e-47
WP_003152457.1|850552_851272_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.3	5.0e-44
WP_003152455.1|851487_852426_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003152454.1|852471_853743_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	4.0e-12
>prophage 62
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	865586	868925	4085488		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_094247665.1|865586_868925_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	34.8	2.9e-179
>prophage 63
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	883159	888743	4085488		Klebsiella_phage(33.33%)	5	NA	NA
WP_003152419.1|883159_884167_-	signal peptide peptidase SppA	NA	Q6UAX7	Klebsiella_phage	27.8	1.2e-16
WP_003152418.1|884348_885155_+	NAD kinase	NA	NA	NA	NA	NA
WP_094247659.1|885171_886767_-	amidohydrolase	NA	NA	NA	NA	NA
WP_094247658.1|886790_888377_-	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.4	5.4e-75
WP_003152415.1|888524_888743_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	82.8	8.9e-21
>prophage 64
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	896780	900407	4085488		Bacillus_phage(100.0%)	4	NA	NA
WP_094247654.1|896780_898529_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.5	1.1e-20
WP_003152406.1|898819_899422_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_162886258.1|899566_899716_-	PhrK family phosphatase-inhibitory pheromone	NA	Q9ZXD2	Bacillus_phage	86.5	7.0e-09
WP_070082214.1|899849_900407_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	53.3	1.6e-45
>prophage 65
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	909165	909918	4085488		Staphylococcus_phage(100.0%)	1	NA	NA
WP_029973317.1|909165_909918_-	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	44.4	1.1e-54
>prophage 66
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	913921	917242	4085488	tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_007613147.1|913921_915187_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.8	6.5e-79
WP_014418650.1|915523_917242_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	72.1	9.4e-206
>prophage 67
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	926950	931151	4085488	tRNA	Mycobacterium_phage(50.0%)	3	NA	NA
WP_094247646.1|926950_929554_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.3	9.2e-88
WP_003152375.1|929721_930327_-|tRNA	DUF4479 domain-containing tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_012118213.1|930341_931151_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	51.5	9.0e-34
>prophage 68
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	941577	947271	4085488		Streptococcus_phage(33.33%)	5	NA	NA
WP_094247644.1|941577_942549_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.1	6.9e-81
WP_094247643.1|942585_943977_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_070082232.1|944072_945377_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.2	2.7e-48
WP_094247642.1|945409_946570_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014418670.1|946566_947271_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.6	1.3e-20
>prophage 69
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	950519	953496	4085488		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003152311.1|950519_951785_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.0	3.4e-27
WP_094247641.1|951960_953496_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	4.7e-23
>prophage 70
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	960335	969616	4085488	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_015418037.1|960335_962750_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.2	0.0e+00
WP_015418038.1|963175_963511_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_070082239.1|963900_964686_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_094247637.1|964726_965911_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	52.9	1.9e-101
WP_015387829.1|966106_966817_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_003152291.1|966923_968864_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003152289.1|968860_969616_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	35.8	1.7e-18
>prophage 71
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	972774	973470	4085488		Planktothrix_phage(100.0%)	1	NA	NA
WP_003152281.1|972774_973470_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	1.2e-39
>prophage 72
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	976487	980154	4085488		Staphylococcus_phage(100.0%)	5	NA	NA
WP_003152276.1|976487_977366_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	1.4e-19
WP_003152275.1|977358_977751_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003152272.1|978097_978370_-	YtzC family protein	NA	NA	NA	NA	NA
WP_096034901.1|978607_979576_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	74.5	3.2e-54
WP_014305624.1|979572_980154_+	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	53.2	3.1e-44
>prophage 73
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	985628	998098	4085488	holin	Staphylococcus_phage(57.14%)	15	NA	NA
WP_003152255.1|985628_987527_-	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	28.3	1.3e-30
WP_003152253.1|987670_988873_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	74.4	9.6e-165
WP_094247632.1|989379_990963_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.0	4.0e-195
WP_003152249.1|991005_991248_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_015418056.1|991305_992079_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	38.3	9.2e-36
WP_094247631.1|992218_993223_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003152246.1|993234_994017_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	1.6e-32
WP_014418698.1|993991_994804_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003152244.1|994839_995319_-	nucleoside triphosphatase YtkD	NA	NA	NA	NA	NA
WP_003152243.1|995451_995856_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003152242.1|996007_996445_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	6.5e-47
WP_003152241.1|996569_996719_+	YtzI protein	NA	NA	NA	NA	NA
WP_094247630.1|996715_997159_-	FixH family protein	NA	NA	NA	NA	NA
WP_003152237.1|997273_997747_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003152235.1|997870_998098_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	66.2	6.9e-24
>prophage 74
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1002212	1004788	4085488		Oenococcus_phage(50.0%)	2	NA	NA
WP_003152223.1|1002212_1003328_-	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	21.9	2.4e-13
WP_094247628.1|1003324_1004788_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.9	5.9e-76
>prophage 75
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1019358	1020888	4085488		Orpheovirus(100.0%)	1	NA	NA
WP_094247624.1|1019358_1020888_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	2.1e-07
>prophage 76
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1027744	1028590	4085488		Brevibacillus_phage(100.0%)	1	NA	NA
WP_070082259.1|1027744_1028590_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	1.1e-26
>prophage 77
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1032297	1033428	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_070082263.1|1032297_1033428_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.6	1.8e-64
>prophage 78
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1037891	1046875	4085488		uncultured_Caudovirales_phage(80.0%)	5	NA	NA
WP_003152143.1|1037891_1038416_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	35.4	2.6e-18
WP_070082266.1|1038481_1040488_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.0	2.1e-15
WP_094247551.1|1040603_1042589_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.9	1.4e-14
WP_077722748.1|1042716_1044705_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.4	1.1e-16
WP_071392228.1|1044889_1046875_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.3	6.7e-14
>prophage 79
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1077958	1079491	4085488		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_096034903.1|1077958_1079491_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.0	1.8e-11
>prophage 80
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1094770	1096237	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_014418767.1|1094770_1096237_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.9	2.4e-117
>prophage 81
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1104676	1109152	4085488		Mycobacterium_phage(100.0%)	1	NA	NA
WP_025650214.1|1104676_1109152_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.9	1.3e-33
>prophage 82
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1114968	1122096	4085488		Tupanvirus(100.0%)	1	NA	NA
WP_094247537.1|1114968_1122096_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.1	1.7e-96
>prophage 83
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1130682	1139694	4085488		Mycoplasma_phage(20.0%)	12	NA	NA
WP_094247533.1|1130682_1132173_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.3	1.1e-56
WP_003151991.1|1132320_1132797_+	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_050556585.1|1132825_1133443_-	3D domain-containing protein	NA	A0A127AW72	Bacillus_phage	43.2	2.7e-14
WP_003151989.1|1133567_1133888_-	YuiB family protein	NA	NA	NA	NA	NA
WP_007408708.1|1133956_1134082_-	YuiA family protein	NA	NA	NA	NA	NA
WP_007408709.1|1134255_1135476_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_031378399.1|1135787_1136783_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	51.6	2.3e-31
WP_003151982.1|1136823_1136967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247532.1|1137184_1138165_+	GMP reductase	NA	G3MBI2	Bacillus_virus	82.8	4.6e-157
WP_003151978.1|1138227_1138449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247531.1|1138465_1138993_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_003151975.1|1138989_1139694_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.5	1.5e-29
>prophage 84
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1144480	1149599	4085488		Lake_Baikal_phage(33.33%)	7	NA	NA
WP_003151967.1|1144480_1144843_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	44.9	1.4e-18
WP_012118345.1|1144920_1145775_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_024085753.1|1145898_1147116_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	23.2	2.0e-13
WP_007408721.1|1147250_1147487_-	YuzB family protein	NA	NA	NA	NA	NA
WP_060657594.1|1147753_1148821_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044052935.1|1148857_1149184_-	YuzD family protein	NA	NA	NA	NA	NA
WP_169510385.1|1149263_1149599_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	42.4	3.7e-10
>prophage 85
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1156377	1160738	4085488		Bacillus_virus(50.0%)	6	NA	NA
WP_003151934.1|1156377_1156878_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.4	6.8e-40
WP_094247528.1|1156904_1157675_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_017419457.1|1157708_1158143_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003151928.1|1158168_1158444_-	YutD family protein	NA	NA	NA	NA	NA
WP_003151923.1|1158661_1159558_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_017419458.1|1159760_1160738_+	M23 family metallopeptidase	NA	A0A1J0MFP9	Staphylococcus_phage	36.9	3.5e-08
>prophage 86
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1169751	1172838	4085488		Bacillus_phage(50.0%)	3	NA	NA
WP_094247524.1|1169751_1170498_-	hypothetical protein	NA	D2XR29	Bacillus_phage	37.9	5.8e-35
WP_094247523.1|1171360_1171609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007410110.1|1171641_1172838_-	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	20.5	5.8e-05
>prophage 87
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1176610	1177717	4085488		Mycoplasma_phage(100.0%)	1	NA	NA
WP_043867399.1|1176610_1177717_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	46.1	7.3e-18
>prophage 88
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1182635	1183622	4085488		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_071392250.1|1182635_1183622_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-11
>prophage 89
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1188862	1202424	4085488		Leuconostoc_phage(14.29%)	19	NA	NA
WP_094247516.1|1188862_1189564_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	27.5	7.9e-10
WP_058906334.1|1189641_1190103_+	DUF2691 family protein	NA	NA	NA	NA	NA
WP_003151879.1|1190238_1191075_+	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.4	3.4e-20
WP_003151878.1|1191110_1192508_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003151877.1|1192527_1192971_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
WP_007410089.1|1192960_1194181_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.6	6.8e-118
WP_003151874.1|1194180_1195494_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003151872.1|1195511_1196297_-	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	23.6	6.5e-05
WP_003151857.1|1196473_1196626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032864325.1|1196818_1197196_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_012118382.1|1197290_1198106_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003151851.1|1198119_1198788_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003151850.1|1198780_1199806_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	2.2e-32
WP_003151848.1|1200128_1200479_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003151847.1|1200575_1200896_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_094247515.1|1200898_1201264_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_003151845.1|1201333_1201570_-	YusG family protein	NA	NA	NA	NA	NA
WP_003151844.1|1201624_1202008_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_094247514.1|1202067_1202424_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	51.9	2.9e-21
>prophage 90
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1215448	1216273	4085488		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_014418835.1|1215448_1216273_-	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	28.6	2.4e-10
>prophage 91
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1219829	1222657	4085488	protease	Clostridium_phage(33.33%)	3	NA	NA
WP_007410071.1|1219829_1220294_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	48.6	4.1e-31
WP_017418949.1|1220340_1221702_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	5.6e-20
WP_014418841.1|1221979_1222657_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.8	1.6e-28
>prophage 92
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1237377	1238604	4085488		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003151786.1|1237377_1238604_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.0	1.2e-13
>prophage 93
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1242525	1244984	4085488		Hokovirus(50.0%)	2	NA	NA
WP_053285168.1|1242525_1244268_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.7	9.7e-17
WP_003151779.1|1244264_1244984_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	2.3e-33
>prophage 94
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1248125	1248932	4085488		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_063637067.1|1248125_1248932_-	ABC transporter ATP-binding protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	27.5	3.1e-10
>prophage 95
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1255447	1255930	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_014305800.1|1255447_1255930_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.9	6.4e-11
>prophage 96
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1262332	1266396	4085488		Staphylococcus_phage(100.0%)	4	NA	NA
WP_014418872.1|1262332_1263268_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.7e-24
WP_094247505.1|1263291_1264386_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_094247504.1|1264387_1265533_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_094247503.1|1265565_1266396_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	54.9	4.7e-78
>prophage 97
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1273227	1275543	4085488		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_094247501.1|1273227_1275543_-	UvrD-helicase domain-containing protein	NA	A0A1S5V1I8	Saudi_moumouvirus	27.7	9.3e-07
>prophage 98
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1278579	1283270	4085488		Streptococcus_phage(50.0%)	2	NA	NA
WP_071543372.1|1278579_1280691_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.4	6.9e-118
WP_094247500.1|1280840_1283270_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	4.8e-115
>prophage 99
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1288622	1289402	4085488		Planktothrix_phage(100.0%)	1	NA	NA
WP_094247496.1|1288622_1289402_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	7.1e-36
>prophage 100
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1298658	1304081	4085488		Thermus_phage(50.0%)	7	NA	NA
WP_029973572.1|1298658_1299129_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	9.2e-47
WP_017418905.1|1299268_1301602_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.3	1.1e-92
WP_007409986.1|1301620_1302361_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003151681.1|1302479_1302710_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_087920807.1|1302833_1303019_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003151677.1|1303214_1303625_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.0	7.8e-18
WP_003151674.1|1303649_1304081_+	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	64.2	6.5e-15
>prophage 101
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1308151	1312419	4085488	holin	Staphylococcus_phage(50.0%)	5	NA	NA
WP_017418901.1|1308151_1308865_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.1	3.3e-56
WP_017418900.1|1308975_1309653_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017418899.1|1309671_1310589_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017418898.1|1310603_1311257_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017418897.1|1311273_1312419_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	9.5e-13
>prophage 102
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1315570	1316710	4085488	holin	Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_094247493.1|1315570_1316710_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	9.5e-13
>prophage 103
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1323923	1329565	4085488		Stenotrophomonas_phage(33.33%)	6	NA	NA
WP_077722860.1|1323923_1324601_-	PIG-L family deacetylase	NA	A0A2D2W2P2	Stenotrophomonas_phage	28.2	1.9e-13
WP_076851287.1|1324563_1325322_-	WbqC family protein	NA	NA	NA	NA	NA
WP_015387692.1|1325294_1326176_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_094247490.1|1326187_1327444_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_094247489.1|1327409_1328339_-	NAD(P)-dependent oxidoreductase	NA	M4QPK0	Synechococcus_phage	28.5	4.5e-21
WP_142385910.1|1328335_1329565_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	31.0	1.4e-38
>prophage 104
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1332567	1333860	4085488		Streptococcus_phage(100.0%)	1	NA	NA
WP_007409956.1|1332567_1333860_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	71.0	1.9e-174
>prophage 105
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1366580	1367753	4085488		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_094247479.1|1366580_1367753_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.6	2.7e-10
>prophage 106
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1372632	1383582	4085488		Catovirus(25.0%)	10	NA	NA
WP_013353687.1|1372632_1373670_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	43.5	6.0e-14
WP_094247476.1|1373688_1374792_-	EpsG family protein	NA	NA	NA	NA	NA
WP_094247475.1|1374795_1375932_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_013353690.1|1375924_1376767_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.7	7.0e-05
WP_094247474.1|1376763_1377903_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014472284.1|1377918_1379736_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	29.3	5.9e-25
WP_003151543.1|1379958_1380639_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_071347564.1|1380644_1381352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007407395.1|1381597_1382053_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094247473.1|1382133_1383582_+	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	33.8	5.0e-35
>prophage 107
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1396832	1397429	4085488		Agrobacterium_phage(100.0%)	1	NA	NA
WP_003151513.1|1396832_1397429_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	7.5e-54
>prophage 108
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1401264	1403910	4085488		Catovirus(33.33%)	3	NA	NA
WP_015387658.1|1401264_1401840_-	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	26.4	1.5e-11
WP_003151506.1|1401955_1402276_+	MazG-like family protein	NA	G3MBI9	Bacillus_virus	43.3	2.3e-17
WP_025649327.1|1402320_1403910_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.6	2.2e-44
>prophage 109
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1407567	1419395	4085488		Bacillus_phage(50.0%)	10	NA	NA
WP_017418846.1|1407567_1408518_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	8.6e-52
WP_007407422.1|1408544_1409498_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	39.9	2.6e-64
WP_012118535.1|1409494_1410382_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.8	5.1e-06
WP_003151491.1|1410407_1410875_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_007407423.1|1411148_1412099_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.9	3.7e-87
WP_025649330.1|1412305_1413721_-	C40 family peptidase	NA	A0A0A0RVE6	Bacillus_phage	51.7	3.5e-25
WP_025649331.1|1414117_1415572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025649332.1|1415664_1416750_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	39.1	1.2e-62
WP_012118540.1|1416746_1417424_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	56.6	9.8e-66
WP_014418969.1|1417625_1419395_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	60.2	1.1e-164
>prophage 110
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1440127	1448208	4085488		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_071543379.1|1440127_1443001_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	0.0e+00
WP_015387640.1|1443008_1444994_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_003151438.1|1445169_1445406_-	CsbA family protein	NA	NA	NA	NA	NA
WP_025853529.1|1445706_1448208_+	phosphotransferase	NA	A0A1V0SGR7	Hokovirus	30.7	3.6e-33
>prophage 111
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1453692	1458286	4085488		Moraxella_phage(50.0%)	4	NA	NA
WP_094247455.1|1453692_1455096_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.8	2.5e-23
WP_071392356.1|1455263_1456670_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_013353766.1|1456716_1457607_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003151418.1|1457599_1458286_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.8	3.8e-25
>prophage 112
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1468581	1468806	4085488		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003151402.1|1468581_1468806_-	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	49.0	6.4e-06
>prophage 113
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1474745	1479984	4085488		Streptococcus_phage(66.67%)	5	NA	NA
WP_094247454.1|1474745_1476131_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.2	5.1e-61
WP_003151387.1|1476238_1477087_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	7.5e-15
WP_003219701.1|1477184_1477874_-	two-component system response regulator DegU	NA	NA	NA	NA	NA
WP_003151385.1|1477950_1479114_-	two-component sensor histidine kinase DegS	NA	NA	NA	NA	NA
WP_060657503.1|1479336_1479984_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.1	9.7e-39
>prophage 114
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1486692	1488033	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_094247449.1|1486692_1488033_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.4	5.6e-89
>prophage 115
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1491593	1498960	4085488		Bacillus_phage(50.0%)	6	NA	NA
WP_015387619.1|1491593_1493084_-	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	31.3	4.6e-15
WP_003151371.1|1493105_1495226_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	28.8	5.3e-17
WP_003151370.1|1495258_1495576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151369.1|1495757_1496675_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015387618.1|1496707_1497847_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.7	2.4e-24
WP_003151367.1|1498075_1498960_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.7	6.7e-83
>prophage 116
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1503801	1510898	4085488		Catovirus(33.33%)	5	NA	NA
WP_025853548.1|1503801_1505340_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.7	7.8e-10
WP_025853549.1|1505477_1505867_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	43.4	1.1e-18
WP_025853550.1|1506222_1506993_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_025853551.1|1507025_1508192_+	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_094247447.1|1508252_1510898_-	N-acetylglucosaminidase	NA	A0A1W6JQU5	Staphylococcus_phage	44.3	1.7e-36
>prophage 117
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1517404	1518781	4085488		Aichi_virus(100.0%)	1	NA	NA
WP_094247445.1|1517404_1518781_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	30.5	8.1e-35
>prophage 118
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1521957	1523193	4085488		Clostridioides_phage(100.0%)	1	NA	NA
WP_077722947.1|1521957_1523193_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.7	1.8e-17
>prophage 119
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1533095	1534589	4085488		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_094247441.1|1533095_1534589_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	4.3e-13
>prophage 120
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1540523	1542958	4085488		Lactobacillus_phage(50.0%)	2	NA	NA
WP_003151316.1|1540523_1541432_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	1.2e-10
WP_025853570.1|1541626_1542958_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	30.2	1.8e-55
>prophage 121
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1553114	1553831	4085488		Klosneuvirus(100.0%)	1	NA	NA
WP_094247434.1|1553114_1553831_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.2	3.8e-20
>prophage 122
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1558779	1569747	4085488		Bacillus_phage(25.0%)	9	NA	NA
WP_071182032.1|1558779_1560105_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.0	8.8e-87
WP_025649368.1|1560304_1561069_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_014305982.1|1561114_1561804_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	35.9	7.0e-27
WP_070082498.1|1561790_1562537_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_003151259.1|1562752_1562896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151257.1|1563099_1564710_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_094247431.1|1564696_1567471_+	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	26.3	1.6e-37
WP_003151250.1|1568413_1569196_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003151249.1|1569405_1569747_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	63.2	3.2e-33
>prophage 123
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1575966	1576248	4085488		Clostridium_phage(100.0%)	1	NA	NA
WP_003151236.1|1575966_1576248_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	50.7	9.4e-15
>prophage 124
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1586111	1586981	4085488		Clostridium_phage(100.0%)	1	NA	NA
WP_017418752.1|1586111_1586981_-	M23 family metallopeptidase	NA	I3PV24	Clostridium_phage	38.3	1.1e-05
>prophage 125
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1596318	1597449	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_017418744.1|1596318_1597449_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	41.4	3.4e-79
>prophage 126
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1601757	1602789	4085488		Pseudomonas_phage(100.0%)	1	NA	NA
WP_014306003.1|1601757_1602789_-	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	37.1	5.0e-37
>prophage 127
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1614228	1618957	4085488		Aeromonas_phage(50.0%)	6	NA	NA
WP_094247426.1|1614228_1615476_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.8	6.6e-100
WP_007407598.1|1615623_1616166_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_003151149.1|1616179_1616629_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_029325731.1|1616762_1617218_-	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_003151147.1|1617291_1617849_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_070082510.1|1617916_1618957_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	43.0	4.2e-60
>prophage 128
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1622040	1623111	4085488		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003151139.1|1622040_1623111_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	3.1e-05
>prophage 129
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1627330	1627921	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_014306007.1|1627330_1627921_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	45.9	5.9e-35
>prophage 130
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1632618	1637124	4085488		Cyanophage(33.33%)	5	NA	NA
WP_007407613.1|1632618_1633257_-	fructose-6-phosphate aldolase	NA	A0A1D7SX77	Cyanophage	50.0	4.3e-47
WP_003151102.1|1633375_1634233_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_012118670.1|1634408_1634783_-	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	36.5	1.3e-11
WP_017418727.1|1634947_1635469_+	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_014419113.1|1635516_1637124_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	3.6e-151
>prophage 131
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1641578	1644676	4085488		Bacillus_phage(100.0%)	3	NA	NA
WP_017418723.1|1641578_1642541_+	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	35.3	9.1e-41
WP_003151087.1|1642609_1642882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017418722.1|1642948_1644676_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	1.1e-57
>prophage 132
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1648374	1649838	4085488		Escherichia_phage(100.0%)	1	NA	NA
WP_094247423.1|1648374_1649838_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.7	7.1e-21
>prophage 133
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1659585	1660731	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_094247421.1|1659585_1660731_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	42.9	3.2e-77
>prophage 134
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1677840	1682656	4085488		Cafeteria_roenbergensis_virus(50.0%)	6	NA	NA
WP_094247418.1|1677840_1679142_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.4e-23
WP_003151034.1|1679302_1679527_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_025649388.1|1679730_1680507_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_014306027.1|1680768_1681083_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151028.1|1681083_1681638_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_003151027.1|1681735_1682656_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	8.4e-36
>prophage 135
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1687402	1688302	4085488		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_007407666.1|1687402_1688302_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
>prophage 136
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1696172	1701071	4085488		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_038460243.1|1696172_1696934_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	1.3e-21
WP_003151000.1|1696930_1697641_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003150997.1|1697630_1698245_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_096034908.1|1698406_1699645_-	MFS transporter	NA	NA	NA	NA	NA
WP_094247411.1|1699868_1701071_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	5.5e-27
>prophage 137
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1708644	1711201	4085488		Escherichia_phage(33.33%)	3	NA	NA
WP_024085934.1|1708644_1709493_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
WP_094247409.1|1709513_1710461_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.6	1.3e-68
WP_003150981.1|1710463_1711201_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
>prophage 138
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1717572	1718343	4085488		uncultured_marine_virus(100.0%)	1	NA	NA
WP_003150972.1|1717572_1718343_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
>prophage 139
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1721470	1722154	4085488		Canid_alphaherpesvirus(100.0%)	1	NA	NA
WP_012118732.1|1721470_1722154_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
>prophage 140
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1725929	1727369	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_094247399.1|1725929_1727369_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.8	7.7e-20
>prophage 141
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1730658	1733070	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_096034909.1|1730658_1733070_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.8	3.8e-19
>prophage 142
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1755238	1766349	4085488		Streptococcus_phage(20.0%)	10	NA	NA
WP_070082561.1|1755238_1756426_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	43.9	2.2e-76
WP_014419203.1|1756520_1756904_+	VOC family protein	NA	NA	NA	NA	NA
WP_094247389.1|1756933_1758268_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_094247916.1|1758429_1760175_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	41.3	7.9e-43
WP_003150888.1|1760232_1761093_-	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.5	3.2e-05
WP_007407732.1|1761352_1761985_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003150884.1|1762115_1763051_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_003150882.1|1763494_1763644_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_094247388.1|1763659_1765171_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2H4PQU7	Staphylococcus_phage	24.7	7.1e-16
WP_094247387.1|1765167_1766349_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	25.4	9.2e-19
>prophage 143
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1778686	1783913	4085488		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_014306081.1|1778686_1779037_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.3	9.3e-12
WP_017418621.1|1779050_1780349_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	65.6	3.3e-155
WP_003150849.1|1780827_1781145_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_025650060.1|1781163_1782483_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_025650059.1|1782512_1783913_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.0	6.1e-46
>prophage 144
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1786934	1806073	4085488		Tupanvirus(25.0%)	15	NA	NA
WP_077723034.1|1786934_1788548_+	catalase	NA	A0A2K9L572	Tupanvirus	45.1	1.8e-97
WP_025853653.1|1788587_1789574_-	choloylglycine hydrolase family protein	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	30.0	6.7e-31
WP_014306090.1|1789890_1791249_+	cytosine permease	NA	NA	NA	NA	NA
WP_003150837.1|1791262_1792093_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_077723035.1|1792183_1793914_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	22.3	2.1e-16
WP_070082577.1|1793910_1795614_-	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	31.9	1.9e-17
WP_003150830.1|1795613_1796630_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003150828.1|1796613_1798020_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_014306094.1|1798522_1799866_+	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	25.7	2.3e-05
WP_094247381.1|1799900_1800743_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014306096.1|1800842_1801943_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	1.6e-20
WP_094247380.1|1802060_1802954_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096034910.1|1803120_1803957_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.7	4.6e-41
WP_119834765.1|1804470_1805010_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_065180333.1|1805056_1806073_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	50.2	6.8e-95
>prophage 145
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1809087	1810224	4085488		uncultured_virus(100.0%)	1	NA	NA
WP_079004947.1|1809087_1810224_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.5	1.8e-88
>prophage 146
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1814991	1817043	4085488		Tupanvirus(100.0%)	1	NA	NA
WP_094247377.1|1814991_1817043_-	catalase	NA	A0A2K9L0T1	Tupanvirus	52.9	5.8e-154
>prophage 147
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1821828	1823268	4085488		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_007407785.1|1821828_1823268_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	34.8	4.5e-60
>prophage 148
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1841348	1843035	4085488		Oenococcus_phage(50.0%)	2	NA	NA
WP_024085991.1|1841348_1841759_-	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	37.8	2.1e-15
WP_032875608.1|1841928_1843035_+	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	31.9	1.6e-33
>prophage 149
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1847634	1849173	4085488		Catovirus(100.0%)	1	NA	NA
WP_094247366.1|1847634_1849173_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	9.6e-93
>prophage 150
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1854572	1855874	4085488		Geobacillus_virus(100.0%)	1	NA	NA
WP_094247365.1|1854572_1855874_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	60.5	2.7e-133
>prophage 151
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1865561	1866335	4085488		Planktothrix_phage(100.0%)	1	NA	NA
WP_094247360.1|1865561_1866335_-	ABC transporter ATP-binding protein YxdL	NA	G9BWD6	Planktothrix_phage	36.8	7.6e-30
>prophage 152
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1879971	1885167	4085488		Escherichia_phage(50.0%)	4	NA	NA
WP_004393223.1|1879971_1880727_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.5	1.4e-20
WP_070082618.1|1880804_1881737_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_004393218.1|1881855_1883244_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_007614881.1|1883286_1885167_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	33.1	1.3e-83
>prophage 153
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1897979	1899509	4085488		Lactococcus_phage(100.0%)	1	NA	NA
WP_007614902.1|1897979_1899509_+	alkyl hydroperoxide reductase subunit F	NA	V9VEY6	Lactococcus_phage	29.4	3.7e-20
>prophage 154
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1914799	1915792	4085488		Lactococcus_phage(100.0%)	1	NA	NA
WP_020958089.1|1914799_1915792_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	29.0	5.7e-14
>prophage 155
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1924419	1934597	4085488		Klosneuvirus(40.0%)	9	NA	NA
WP_046560175.1|1924419_1925535_-	aspartate phosphatase	NA	D6R410	Bacillus_phage	30.5	6.4e-38
WP_014306158.1|1925665_1926556_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	9.9e-26
WP_004393132.1|1926629_1928030_-	amino acid permease	NA	NA	NA	NA	NA
WP_094247336.1|1928253_1929459_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	3.4e-29
WP_058906480.1|1929688_1930324_-	SdpI family protein	NA	NA	NA	NA	NA
WP_058906481.1|1930320_1930608_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	6.3e-06
WP_094247909.1|1930811_1932197_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_048367869.1|1932238_1932958_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_094247335.1|1932971_1934597_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.5	5.4e-46
>prophage 156
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1938391	1951734	4085488	protease	Bacillus_phage(42.86%)	11	NA	NA
WP_094247332.1|1938391_1939810_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	3.9e-32
WP_004393115.1|1939806_1940019_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094247331.1|1940527_1941724_-|protease	serine protease	protease	W5SAB9	Pithovirus	31.7	7.1e-11
WP_007407895.1|1941810_1942605_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	34.1	4.1e-39
WP_017418497.1|1942619_1943459_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_014419341.1|1943445_1944804_-	regulatory protein	NA	NA	NA	NA	NA
WP_004393106.1|1944793_1946629_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.5	3.4e-36
WP_004393104.1|1946635_1947343_-	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	42.3	1.2e-45
WP_004393102.1|1948307_1949600_-	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.9	1.4e-68
WP_017418495.1|1949838_1950252_-	VOC family protein	NA	NA	NA	NA	NA
WP_004393100.1|1950369_1951734_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.1	3.6e-128
>prophage 157
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1968177	1969734	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_094247908.1|1968177_1969734_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	38.2	4.2e-88
>prophage 158
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1973082	1975185	4085488		Clostridioides_phage(50.0%)	3	NA	NA
WP_004393039.1|1973082_1973721_-	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	49.0	3.1e-05
WP_032875377.1|1973734_1974169_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014306188.1|1974306_1975185_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.2	5.7e-34
>prophage 159
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1979907	1981335	4085488		Lactococcus_phage(100.0%)	1	NA	NA
WP_094247319.1|1979907_1981335_+	SIR2 family protein	NA	Q38324	Lactococcus_phage	27.7	1.0e-16
>prophage 160
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1987703	1990584	4085488		Cafeteria_roenbergensis_virus(33.33%)	5	NA	NA
WP_094247317.1|1987703_1988462_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	45.5	6.6e-63
WP_048367907.1|1988488_1989016_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.1	2.6e-18
WP_025854038.1|1989012_1989594_-	methylphosphotriester-DNA--protein-cysteine methyltransferase family protein	NA	NA	NA	NA	NA
WP_004392983.1|1989782_1990022_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_004392979.1|1990065_1990584_-	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	70.9	2.1e-52
>prophage 161
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	1996426	1999825	4085488	protease	Bacillus_virus(25.0%)	4	NA	NA
WP_004392969.1|1996426_1997041_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	42.3	2.4e-18
WP_004392966.1|1997069_1997921_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	38.2	2.3e-19
WP_007409899.1|1997913_1998675_-	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	30.6	5.0e-26
WP_007409900.1|1998973_1999825_-	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	35.7	2.8e-17
>prophage 162
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2008585	2016114	4085488		Bacillus_virus(66.67%)	6	NA	NA
WP_094247315.1|2008585_2009722_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	32.9	1.1e-16
WP_004392910.1|2009856_2010072_+	ribosome maturation protein RlbA	NA	NA	NA	NA	NA
WP_094247314.1|2010087_2011200_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004392908.1|2011217_2011463_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_004392900.1|2011522_2013439_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.1	3.5e-153
WP_004392898.1|2013654_2016114_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.7	6.0e-113
>prophage 163
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2022523	2031636	4085488	tRNA	Klosneuvirus(16.67%)	8	NA	NA
WP_003150717.1|2022523_2023990_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	4.2e-98
WP_077721682.1|2024142_2025474_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.8	5.5e-20
WP_003150714.1|2025671_2026556_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_007615126.1|2026577_2027168_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_003150709.1|2027487_2028765_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.5	1.7e-98
WP_094247313.1|2028776_2029922_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.7	5.7e-50
WP_015388792.1|2030362_2031016_-	deoxynucleoside kinase	NA	A0A127AVX2	Bacillus_phage	35.7	3.6e-25
WP_094247312.1|2031012_2031636_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	33.5	3.1e-18
>prophage 164
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2034685	2036377	4085488		Clostridium_phage(100.0%)	1	NA	NA
WP_096034914.1|2034685_2036377_+	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	36.6	1.3e-53
>prophage 165
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2044294	2057681	4085488	tRNA	Streptococcus_phage(37.5%)	15	NA	NA
WP_094247310.1|2044294_2045413_+	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	29.0	8.6e-35
WP_094247309.1|2045490_2046924_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004264737.1|2046920_2047559_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	56.4	1.4e-58
WP_004264734.1|2047629_2047959_+	cyclic di-AMP receptor DarA	NA	NA	NA	NA	NA
WP_004264730.1|2047971_2048412_+	DUF327 family protein	NA	NA	NA	NA	NA
WP_094247308.1|2048423_2049413_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.1	5.5e-33
WP_004264723.1|2049415_2050243_+	competence/sporulation regulator complex protein RicT	NA	NA	NA	NA	NA
WP_004264720.1|2050257_2050617_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_004264717.1|2050677_2051421_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_007409921.1|2051407_2051707_+	GIY-YIG nuclease family protein	NA	A0A068LKN9	Peridroma_alphabaculovirus	40.3	9.4e-05
WP_094247307.1|2051681_2052563_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.8	2.3e-67
WP_169510469.1|2052613_2052904_-	transition state genes transcriptional regulator AbrB	NA	A0A2I7SC16	Paenibacillus_phage	71.4	1.0e-16
WP_025854082.1|2053386_2055378_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.6	1.2e-100
WP_032868379.1|2055453_2056221_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_094247906.1|2056355_2057681_+	G5 and 3D domain-containing protein	NA	A0A0E3D983	Bacillus_phage	73.0	5.3e-23
>prophage 166
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2064103	2066449	4085488		Tupanvirus(50.0%)	2	NA	NA
WP_094247305.1|2064103_2065474_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	34.8	7.1e-31
WP_004264656.1|2065495_2066449_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.1	1.7e-44
>prophage 167
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2071824	2072361	4085488		Paenibacillus_phage(100.0%)	1	NA	NA
WP_015416660.1|2071824_2072361_+	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 168
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2084016	2092505	4085488	protease	Hokovirus(20.0%)	8	NA	NA
WP_004264611.1|2084016_2084556_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	24.3	1.0e-04
WP_004264608.1|2084653_2086573_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.0	8.5e-115
WP_025650393.1|2086721_2087498_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_004264606.1|2087508_2088384_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_025650394.1|2088429_2089320_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032872203.1|2089395_2090322_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.5	2.6e-109
WP_094247905.1|2090489_2091911_+	aminodeoxychorismate synthase, component I	NA	A0A0B5J984	Pandoravirus	30.7	1.9e-34
WP_003150674.1|2091917_2092505_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	57.0	8.8e-63
>prophage 169
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2096353	2097853	4085488	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_014304211.1|2096353_2097853_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.2	1.2e-95
>prophage 170
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2111237	2113670	4085488	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_007410388.1|2111237_2113670_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	35.4	4.4e-132
>prophage 171
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2121126	2122527	4085488	tRNA	Catovirus(100.0%)	1	NA	NA
WP_003156411.1|2121126_2122527_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.4	4.4e-60
>prophage 172
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2125545	2126079	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_003156423.1|2125545_2126079_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.8	5.4e-11
>prophage 173
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2129574	2140411	4085488		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_003156440.1|2129574_2133156_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.4	4.0e-49
WP_007410398.1|2133218_2136818_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.1	8.9e-65
WP_003156443.1|2136986_2137235_+	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_003156445.1|2137350_2137767_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003156447.1|2137809_2138280_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_007410399.1|2138332_2140411_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	2.4e-62
>prophage 174
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2158133	2159824	4085488		Planktothrix_phage(50.0%)	2	NA	NA
WP_007615256.1|2158133_2158979_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	1.0e-19
WP_014416754.1|2158954_2159824_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	3.6e-12
>prophage 175
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2180901	2185803	4085488		Klosneuvirus(33.33%)	4	NA	NA
WP_039252950.1|2180901_2182170_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	30.0	5.6e-22
WP_094247296.1|2182166_2183117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003156784.1|2183091_2184138_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	27.0	8.7e-13
WP_094247295.1|2184369_2185803_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.9	5.9e-137
>prophage 176
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2195668	2196952	4085488		Mycobacterium_phage(100.0%)	1	NA	NA
WP_094247289.1|2195668_2196952_-	penicillin binding protein PBP4B	NA	A0A088FA76	Mycobacterium_phage	24.8	2.8e-05
>prophage 177
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2206679	2209986	4085488		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_003156758.1|2206679_2208482_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	40.4	8.3e-104
WP_094247287.1|2209113_2209986_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	6.5e-22
>prophage 178
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2221992	2222928	4085488		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_094247282.1|2221992_2222928_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.1	9.5e-27
>prophage 179
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2229686	2234831	4085488		Catovirus(50.0%)	4	NA	NA
WP_025650165.1|2229686_2231576_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	30.3	1.2e-07
WP_025650166.1|2232237_2233440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014720665.1|2233513_2233762_+	DUF2651 family protein	NA	NA	NA	NA	NA
WP_017419318.1|2233943_2234831_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	40.5	1.7e-41
>prophage 180
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2268958	2273006	4085488		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_094247271.1|2268958_2269687_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	27.0	3.9e-20
WP_094247270.1|2269683_2270331_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_094247269.1|2270402_2271530_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_007609218.1|2271566_2273006_-	lincomycin efflux MFS transporter Lmr(B)	NA	A0A0M3UL24	Mycobacterium_phage	23.9	6.3e-14
>prophage 181
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2282134	2293154	4085488		Bacillus_phage(37.5%)	12	NA	NA
WP_077721755.1|2282134_2282638_-	M15 family metallopeptidase	NA	A0A127AWA8	Bacillus_phage	58.6	6.6e-35
WP_003156660.1|2282747_2283869_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	36.9	1.4e-64
WP_094247267.1|2283984_2284764_+	glucose 1-dehydrogenase	NA	A0A0G2Y8L6	Acanthamoeba_polyphaga_mimivirus	31.2	1.5e-06
WP_094247266.1|2284847_2286527_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_094247903.1|2286713_2287664_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003156655.1|2287718_2288414_+	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.2e-15
WP_003156653.1|2288371_2289211_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_094247265.1|2289257_2290253_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003156649.1|2290528_2291125_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	32.4	1.5e-25
WP_003156648.1|2291148_2291730_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.4	4.3e-30
WP_003156645.1|2291763_2292342_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.1	1.1e-28
WP_003156644.1|2292380_2293154_+	TerC family protein	NA	S5MAL1	Bacillus_phage	63.9	9.4e-81
>prophage 182
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2299111	2300368	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_094247260.1|2299111_2300368_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.3	1.1e-33
>prophage 183
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2315675	2316494	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_007409061.1|2315675_2316494_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.7	2.9e-96
>prophage 184
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2321807	2323692	4085488		Pseudomonas_phage(50.0%)	2	NA	NA
WP_025650333.1|2321807_2322593_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	42.7	1.9e-41
WP_088037528.1|2322780_2323692_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	40.6	1.8e-62
>prophage 185
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2328393	2329404	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_094247252.1|2328393_2329404_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	27.0	1.1e-17
>prophage 186
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2338253	2366831	4085488		Tupanvirus(75.0%)	7	NA	NA
WP_003156588.1|2338253_2338691_-	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	62.6	1.2e-37
WP_014304318.1|2339051_2339609_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_014304319.1|2339605_2340241_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_014304320.1|2340472_2340835_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094247248.1|2341423_2352178_+	surfactin non-ribosomal peptide synthetase SrfAA	NA	A0A2K9KZV5	Tupanvirus	27.5	3.3e-163
WP_094247247.1|2352199_2362960_+	surfactin non-ribosomal peptide synthetase SrfAB	NA	A0A2K9KZV5	Tupanvirus	27.6	9.8e-168
WP_071543290.1|2362994_2366831_+	surfactin non-ribosomal peptide synthetase SrfAC	NA	A0A2K9KZV5	Tupanvirus	26.9	3.0e-87
>prophage 187
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2370551	2371295	4085488		Planktothrix_phage(100.0%)	1	NA	NA
WP_077721779.1|2370551_2371295_-	cystine ABC transporter ATP-binding protein TcyC	NA	G9BWD6	Planktothrix_phage	38.1	1.8e-33
>prophage 188
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2376675	2380178	4085488		Acinetobacter_phage(50.0%)	2	NA	NA
WP_003156366.1|2376675_2378154_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	39.4	5.6e-82
WP_094247245.1|2378432_2380178_+	right-handed parallel beta-helix repeat-containing protein	NA	U5PSS0	Bacillus_phage	42.8	5.5e-113
>prophage 189
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2388139	2388889	4085488		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_025853765.1|2388139_2388889_+	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	3.3e-14
>prophage 190
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2393851	2402120	4085488		Bacillus_phage(60.0%)	9	NA	NA
WP_094247243.1|2393851_2394535_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.2	1.9e-45
WP_161941456.1|2394521_2395955_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.6	1.7e-38
WP_003156336.1|2396107_2397256_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	44.6	2.7e-84
WP_003156334.1|2397239_2397359_+	PhrC/PhrF family phosphatase-inhibitory pheromone	NA	NA	NA	NA	NA
WP_012116800.1|2397508_2397604_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_070081361.1|2397698_2399063_-	aspartate kinase	NA	NA	NA	NA	NA
WP_003156332.1|2399477_2400431_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	52.7	1.0e-92
WP_014416905.1|2400420_2401368_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_022552588.1|2401361_2402120_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	29.8	4.5e-19
>prophage 191
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2407139	2408549	4085488		Streptococcus_phage(100.0%)	1	NA	NA
WP_017419268.1|2407139_2408549_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.6	5.2e-21
>prophage 192
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2412496	2413282	4085488		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_070081367.1|2412496_2413282_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.1e-23
>prophage 193
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2430668	2436709	4085488		Indivirus(33.33%)	4	NA	NA
WP_017419253.1|2430668_2431571_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	26.1	2.7e-10
WP_094247230.1|2431870_2433955_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_063174392.1|2434176_2435691_+	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	26.3	3.9e-38
WP_094247229.1|2435848_2436709_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	37.7	2.0e-47
>prophage 194
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2440673	2442860	4085488		Streptococcus_phage(100.0%)	1	NA	NA
WP_029326219.1|2440673_2442860_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.3	4.6e-40
>prophage 195
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2452402	2456143	4085488		Bacillus_phage(50.0%)	6	NA	NA
WP_017419242.1|2452402_2452849_+	NUDIX hydrolase	NA	Q56BL2	Escherichia_virus	42.9	2.8e-05
WP_039252713.1|2452906_2454628_+	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	26.1	4.1e-36
WP_094247226.1|2454753_2455191_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025853744.1|2455319_2455715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247225.1|2455776_2455938_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JIA8	Bacillus_phage	68.4	1.7e-05
WP_094247899.1|2455957_2456143_+	peptidoglycan-binding protein	NA	F8WPX5	Bacillus_phage	60.0	1.2e-13
>prophage 196
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2474700	2475627	4085488		Staphylococcus_phage(100.0%)	1	NA	NA
WP_094247222.1|2474700_2475627_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.0	2.6e-37
>prophage 197
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2479519	2479837	4085488		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003156200.1|2479519_2479837_-	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	32.0	1.8e-06
>prophage 198
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2482853	2484338	4085488		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_025853729.1|2482853_2484338_+	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.8	1.4e-61
>prophage 199
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2488731	2490658	4085488		Yellowstone_lake_mimivirus(50.0%)	3	NA	NA
WP_077721837.1|2488731_2489901_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	34.7	7.6e-34
WP_003156188.1|2490020_2490302_+	type II toxin-antitoxin system antitoxin EndoAI	NA	NA	NA	NA	NA
WP_003156187.1|2490307_2490658_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	5.8e-14
>prophage 200
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2494227	2495016	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_003156171.1|2494227_2495016_+	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	35.1	2.6e-25
>prophage 201
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2498072	2498522	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_015416877.1|2498072_2498522_+	SprT family protein	NA	U5J9G1	Bacillus_phage	25.7	4.0e-07
>prophage 202
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2502820	2505732	4085488		Burkholderia_virus(50.0%)	2	NA	NA
WP_029974209.1|2502820_2504224_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.3	5.9e-57
WP_094247215.1|2504784_2505732_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	40.8	2.6e-64
>prophage 203
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2509354	2509558	4085488		Lactococcus_phage(100.0%)	1	NA	NA
WP_003156143.1|2509354_2509558_+	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	75.4	2.2e-21
>prophage 204
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2519409	2530026	4085488		uncultured_Caudovirales_phage(20.0%)	12	NA	NA
WP_094247205.1|2519409_2520447_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	26.2	2.2e-16
WP_070081417.1|2520795_2521329_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	68.4	4.7e-55
WP_094247896.1|2521585_2522083_-	DinB family protein	NA	NA	NA	NA	NA
WP_094247897.1|2522313_2522754_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_031378624.1|2522812_2523193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032866832.1|2523461_2523926_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_020955392.1|2523922_2524933_+	thymidylate synthase	NA	A0A0K0N6Z8	Gordonia_phage	37.6	1.4e-12
WP_039062681.1|2524929_2525688_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_039062682.1|2525702_2526521_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_039062683.1|2526529_2527768_+	HAD-IIA family hydrolase	NA	A0A192YCC8	Morganella_phage	42.9	9.3e-06
WP_039062684.1|2527955_2528918_+	arsenic resistance protein	NA	NA	NA	NA	NA
WP_007609682.1|2528976_2530026_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	41.2	1.6e-67
>prophage 205
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2535449	2537206	4085488		Bacillus_phage(100.0%)	2	NA	NA
WP_039062690.1|2535449_2536136_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.5	9.6e-45
WP_039062691.1|2536132_2537206_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.8	1.9e-23
>prophage 206
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2540866	2545542	4085488	coat	Synechococcus_phage(50.0%)	6	NA	NA
WP_039062696.1|2540866_2542003_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.3	5.9e-15
WP_039062697.1|2542021_2542390_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_032866792.1|2542407_2542653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155641731.1|2542825_2543020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022552672.1|2543053_2543776_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_094247200.1|2543913_2545542_-	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	27.8	4.8e-50
>prophage 207
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2559466	2562969	4085488		Epiphyas_postvittana_nucleopolyhedrovirus(50.0%)	4	NA	NA
WP_012116955.1|2559466_2560660_+	UDP-glucosyltransferase	NA	O89808	Epiphyas_postvittana_nucleopolyhedrovirus	27.1	5.1e-09
WP_014417054.1|2560717_2560972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409303.1|2561203_2561473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063636949.1|2561610_2562969_+	serine hydrolase	NA	A0A0A0RQ62	Mycobacterium_phage	24.7	6.9e-10
>prophage 208
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2574182	2575332	4085488	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_094246999.1|2574182_2575332_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
>prophage 209
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2585615	2588807	4085488	tRNA	Moraxella_phage(50.0%)	2	NA	NA
WP_025649875.1|2585615_2586656_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	1.2e-62
WP_017418987.1|2586878_2588807_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.1	3.3e-58
>prophage 210
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2592257	2599546	4085488	tRNA	uncultured_virus(50.0%)	5	NA	NA
WP_003155970.1|2592257_2592542_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
WP_003155941.1|2592583_2594218_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
WP_017418988.1|2595436_2596666_+	5-aminolevulinate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	30.1	1.2e-40
WP_017418989.1|2596662_2597583_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017418990.1|2598094_2599546_-|tRNA	class I tRNA ligase family protein	tRNA	A0A2H4PQS0	Staphylococcus_phage	27.1	4.9e-06
>prophage 211
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2630796	2651353	4085488	transposase	Synechococcus_phage(33.33%)	20	NA	NA
WP_094247895.1|2630796_2632338_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.0	1.2e-21
WP_094246999.1|2632406_2633557_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
WP_025649887.1|2633731_2634265_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_094247188.1|2634246_2635689_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_007408891.1|2636045_2637368_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.0	4.1e-36
WP_014304542.1|2637565_2638348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076983297.1|2638486_2638660_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_014469850.1|2638778_2639333_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_007609843.1|2639329_2639527_+	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_003155768.1|2639839_2640328_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.6	7.4e-23
WP_050586600.1|2640281_2641463_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_025649890.1|2641462_2642755_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_007609852.1|2642830_2643550_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	44.7	1.3e-47
WP_003155758.1|2643549_2643804_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_007609853.1|2643800_2644484_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_025649892.1|2644467_2646696_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	5.5e-158
WP_007408900.1|2646671_2648102_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_025649893.1|2648193_2649234_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	2.4e-63
WP_025649894.1|2649230_2649818_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.7	4.2e-25
WP_025649895.1|2649814_2651353_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	8.7e-78
>prophage 212
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2658782	2666207	4085488		Bacillus_phage(33.33%)	5	NA	NA
WP_071391407.1|2658782_2661002_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.3	1.3e-135
WP_029326170.1|2661026_2663033_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	39.8	7.7e-127
WP_094247184.1|2663048_2664245_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_017419036.1|2664481_2665477_+	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
WP_014417117.1|2665514_2666207_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.9	2.0e-18
>prophage 213
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2672473	2688048	4085488	coat	Leptospira_phage(16.67%)	11	NA	NA
WP_025649899.1|2672473_2675617_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	1.9e-63
WP_025649900.1|2675769_2676681_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.3	5.8e-21
WP_096034917.1|2676828_2678205_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	45.5	3.1e-111
WP_071391413.1|2678385_2680338_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_071391414.1|2680757_2681711_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.1e-17
WP_071391415.1|2681711_2682587_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_071391416.1|2683008_2683479_-	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_094247893.1|2683483_2685487_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	51.9	4.0e-131
WP_071181621.1|2685785_2686505_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_094247182.1|2686684_2686987_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_096034918.1|2687178_2688048_+	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	58.7	1.3e-94
>prophage 214
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2695886	2696957	4085488		Planktothrix_phage(100.0%)	1	NA	NA
WP_094247179.1|2695886_2696957_+	TOBE-like domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.5	3.6e-30
>prophage 215
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2701409	2708904	4085488		Mycobacterium_phage(33.33%)	4	NA	NA
WP_094247175.1|2701409_2704595_+	bifunctional cytochrome P450/NADPH--P450 reductase	NA	V5UQK0	Mycobacterium_phage	36.8	5.6e-79
WP_003155677.1|2705020_2706949_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.5	1.1e-130
WP_094247174.1|2707164_2707929_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_032865771.1|2707935_2708904_+	GDP-mannose 4,6-dehydratase	NA	A0A2K9L0I7	Tupanvirus	29.2	3.6e-29
>prophage 216
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2716461	2726272	4085488		Tupanvirus(40.0%)	8	NA	NA
WP_003155664.1|2716461_2717316_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.6	3.6e-09
WP_014304589.1|2717447_2718347_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	50.0	8.1e-68
WP_014304590.1|2718393_2719461_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_094247170.1|2719619_2721509_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	4.1e-53
WP_003155658.1|2721699_2722122_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094247169.1|2722185_2723370_+	MFS transporter	NA	NA	NA	NA	NA
WP_012117051.1|2723413_2724970_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	8.9e-54
WP_017419086.1|2725141_2726272_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	32.5	9.3e-45
>prophage 217
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2740495	2743693	4085488		Cedratvirus(100.0%)	1	NA	NA
WP_094247163.1|2740495_2743693_+	hypothetical protein	NA	A0A1M7XUW2	Cedratvirus	63.1	5.5e-42
>prophage 218
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2751718	2751853	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_003155609.1|2751718_2751853_-	YflJ family protein	NA	G3MBD1	Bacillus_virus	61.0	1.9e-05
>prophage 219
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2755545	2757483	4085488		Streptococcus_phage(100.0%)	1	NA	NA
WP_017419102.1|2755545_2757483_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.1	2.7e-137
>prophage 220
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2770719	2771235	4085488		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_003155578.1|2770719_2771235_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.9	1.3e-09
>prophage 221
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2788115	2789516	4085488		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_094247153.1|2788115_2789516_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.9	1.8e-85
>prophage 222
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2804202	2807734	4085488		Bacillus_phage(100.0%)	2	NA	NA
WP_070081512.1|2804202_2805936_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	1.5e-46
WP_094247147.1|2805916_2807734_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	7.2e-55
>prophage 223
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2816008	2818103	4085488		Paenibacillus_phage(50.0%)	2	NA	NA
WP_094247143.1|2816008_2816551_+	bacillithiol transferase BstA	NA	D0R7I3	Paenibacillus_phage	44.0	3.6e-18
WP_094247142.1|2816510_2818103_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.1	2.3e-20
>prophage 224
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2830046	2832098	4085488		Mycobacterium_phage(50.0%)	2	NA	NA
WP_070081525.1|2830046_2830907_+	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	26.4	2.2e-06
WP_003155484.1|2831117_2832098_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.3	1.5e-59
>prophage 225
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2839496	2841239	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_145956745.1|2839496_2841239_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	3.1e-47
>prophage 226
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2857021	2858377	4085488		Pandoravirus(100.0%)	1	NA	NA
WP_069473670.1|2857021_2858377_-	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	40.2	9.5e-44
>prophage 227
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2862479	2868118	4085488		Planktothrix_phage(33.33%)	5	NA	NA
WP_094247131.1|2862479_2863466_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.8	8.8e-15
WP_094247130.1|2863458_2864424_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_070081535.1|2864495_2865941_-	catalase	NA	A0A2K9L0T1	Tupanvirus	41.5	3.1e-109
WP_058906660.1|2866197_2867127_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003155413.1|2867350_2868118_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	3.6e-32
>prophage 228
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2878528	2881799	4085488		Thermus_phage(50.0%)	2	NA	NA
WP_069473222.1|2878528_2880424_+	serine/threonine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.1	8.1e-102
WP_094247122.1|2880614_2881799_+	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	44.0	3.0e-25
>prophage 229
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2886980	2892156	4085488		Staphylococcus_phage(50.0%)	6	NA	NA
WP_094247120.1|2886980_2887697_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	4.7e-18
WP_071392066.1|2887697_2888615_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.6	1.4e-38
WP_094247119.1|2888607_2889555_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003155376.1|2889646_2889847_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	62.1	3.2e-17
WP_094247118.1|2890229_2891060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247117.1|2891076_2892156_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.7e-16
>prophage 230
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2899539	2902323	4085488		Bodo_saltans_virus(33.33%)	4	NA	NA
WP_094247113.1|2899539_2900448_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.7	7.3e-08
WP_007408448.1|2900557_2900953_+	DUF5365 family protein	NA	NA	NA	NA	NA
WP_007408449.1|2901083_2901506_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.2	2.3e-12
WP_003155347.1|2901633_2902323_+	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	5.2e-06
>prophage 231
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2906215	2907043	4085488		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_077721989.1|2906215_2907043_+	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	34.4	9.5e-31
>prophage 232
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2910495	2912238	4085488		Streptococcus_phage(100.0%)	1	NA	NA
WP_071392057.1|2910495_2912238_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	50.9	3.4e-163
>prophage 233
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2915501	2916947	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_077721993.1|2915501_2916947_-	peptidoglycan endopeptidase	NA	M1HNA7	Bacillus_virus	34.0	1.7e-11
>prophage 234
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2922660	2926589	4085488		Bacillus_virus(50.0%)	4	NA	NA
WP_014417294.1|2922660_2923485_+	C40 family peptidase	NA	U5PW24	Bacillus_virus	44.9	7.8e-17
WP_094247110.1|2923549_2924428_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024085068.1|2924537_2925641_+	citrate synthase/methylcitrate synthase	NA	NA	NA	NA	NA
WP_094247109.1|2925719_2926589_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.2	4.3e-50
>prophage 235
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2939001	2942462	4085488		Staphylococcus_phage(66.67%)	5	NA	NA
WP_070081569.1|2939001_2939397_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	39.7	5.8e-10
WP_077722000.1|2939398_2940115_-	hypothetical protein	NA	A0A220BY94	Staphylococcus_phage	34.7	2.2e-31
WP_003155299.1|2940284_2940389_+	YhdX family protein	NA	NA	NA	NA	NA
WP_003155296.1|2940551_2941667_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_070081571.1|2941718_2942462_+	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	30.5	3.6e-21
>prophage 236
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2946698	2951597	4085488		Bacillus_phage(100.0%)	4	NA	NA
WP_094247103.1|2946698_2948456_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.3	2.2e-48
WP_070081573.1|2948452_2950474_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	6.3e-44
WP_003155285.1|2950514_2951135_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003155280.1|2951390_2951597_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	80.6	4.6e-19
>prophage 237
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2965194	2966091	4085488		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003155257.1|2965194_2966091_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	2.0e-26
>prophage 238
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	2977829	2980718	4085488		Streptococcus_phage(33.33%)	3	NA	NA
WP_065180669.1|2977829_2978909_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.7	5.9e-81
WP_065180668.1|2979045_2979483_-	HIT family protein	NA	X4YER2	Lactococcus_phage	33.0	6.2e-05
WP_003155231.1|2979974_2980718_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	5.4e-25
>prophage 239
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3002015	3006598	4085488		Staphylococcus_phage(50.0%)	4	NA	NA
WP_094247097.1|3002015_3003557_+	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.7	3.1e-43
WP_063174170.1|3003604_3004000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155197.1|3004154_3005405_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_077722018.1|3005449_3006598_-	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	46.0	1.5e-50
>prophage 240
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3009683	3015740	4085488		Staphylococcus_phage(33.33%)	5	NA	NA
WP_094247095.1|3009683_3011120_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.3	1.0e-24
WP_094247094.1|3011131_3011689_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_024085090.1|3011819_3013112_-	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.2	1.5e-09
WP_094247093.1|3013234_3014758_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007610477.1|3014882_3015740_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.2	1.4e-53
>prophage 241
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3033527	3041858	4085488		Bacillus_virus(100.0%)	3	NA	NA
WP_094247891.1|3033527_3037232_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	26.3	1.3e-15
WP_094247088.1|3037296_3038469_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_094247087.1|3038465_3041858_+	SMC family ATPase	NA	G3MAB6	Bacillus_virus	23.8	1.1e-05
>prophage 242
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3047102	3048944	4085488		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_070081604.1|3047102_3048944_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	28.0	1.6e-33
>prophage 243
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3052194	3053220	4085488		Enterobacteria_phage(100.0%)	1	NA	NA
WP_025649569.1|3052194_3053220_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.2	2.7e-35
>prophage 244
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3062440	3067114	4085488		Lactobacillus_phage(25.0%)	5	NA	NA
WP_025649574.1|3062440_3063418_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	29.6	2.7e-32
WP_071181691.1|3063414_3065064_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.3	3.3e-14
WP_003155105.1|3065124_3065247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014304769.1|3065295_3066147_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.9	2.1e-12
WP_003155101.1|3066271_3067114_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	26.7	2.2e-27
>prophage 245
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3070240	3072441	4085488		Bacillus_phage(50.0%)	2	NA	NA
WP_172424427.1|3070240_3070684_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	66.7	1.2e-40
WP_017417437.1|3071004_3072441_+	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	30.0	1.0e-48
>prophage 246
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3076211	3078498	4085488		Klosneuvirus(50.0%)	2	NA	NA
WP_025649577.1|3076211_3077369_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.9	7.3e-29
WP_007409132.1|3077439_3078498_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.6	5.3e-58
>prophage 247
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3081573	3082545	4085488		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_094247080.1|3081573_3082545_+	ornithine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	27.7	2.6e-19
>prophage 248
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3089570	3091543	4085488		Planktothrix_phage(50.0%)	2	NA	NA
WP_031378493.1|3089570_3090557_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.3	2.7e-24
WP_003155053.1|3090553_3091543_+	dipeptide ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	24.6	5.7e-06
>prophage 249
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3095347	3136461	4085488	protease,tRNA,coat	Bacillus_phage(33.33%)	48	NA	NA
WP_014304784.1|3095347_3096100_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	1.9e-49
WP_014304785.1|3096132_3097125_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_039062894.1|3097868_3099503_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003155043.1|3099609_3100545_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003155041.1|3100548_3101466_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_094247078.1|3101478_3102555_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	2.3e-16
WP_070081625.1|3102547_3103465_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_094247077.1|3103571_3104759_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_003155035.1|3104876_3105455_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155034.1|3105633_3106029_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003155033.1|3106086_3106743_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	40.4	3.8e-30
WP_003155032.1|3107018_3107675_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_094247076.1|3107825_3108986_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_003155028.1|3109213_3111043_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155026.1|3111080_3111248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085126.1|3111533_3112436_-|protease	protease adaptor protein SpxH	protease	NA	NA	NA	NA
WP_003155023.1|3112432_3112831_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_017417458.1|3113059_3113746_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.8e-38
WP_003155021.1|3113750_3114326_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003155020.1|3114450_3114816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155019.1|3114843_3115479_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155018.1|3115496_3116297_+	NAD kinase	NA	NA	NA	NA	NA
WP_070081631.1|3116311_3117205_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.0e-06
WP_094247075.1|3117237_3117987_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.8	9.0e-12
WP_007610641.1|3118213_3120058_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_015417218.1|3120307_3121015_+	thiaminase II	NA	NA	NA	NA	NA
WP_012117296.1|3120992_3121610_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_094247074.1|3121593_3122703_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_007409096.1|3122699_3122903_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_007610655.1|3122899_3123670_+	thiazole synthase	NA	NA	NA	NA	NA
WP_063636847.1|3123666_3124677_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_014417432.1|3124699_3125512_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003155001.1|3125642_3126419_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_162988631.1|3126510_3127125_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154997.1|3127183_3127627_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_094247072.1|3127772_3128255_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_044802820.1|3128405_3128906_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154993.1|3128998_3129313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154992.1|3129350_3129737_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015388440.1|3129907_3130264_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_077722067.1|3130551_3130749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070081640.1|3130840_3130999_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154986.1|3131165_3131420_+	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_094247071.1|3131488_3133774_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.2	5.4e-84
WP_070081642.1|3133894_3134149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247070.1|3134217_3134967_+	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_077722070.1|3135008_3135731_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077722071.1|3135723_3136461_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.2	6.7e-28
>prophage 250
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3142837	3148087	4085488		Streptococcus_phage(50.0%)	5	NA	NA
WP_096034923.1|3142837_3143803_-	hypothetical protein	NA	A0A1S5SBK8	Streptococcus_phage	27.2	2.4e-17
WP_014417475.1|3145210_3145510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017417555.1|3145562_3145871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021494070.1|3145904_3146297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096034962.1|3146308_3148087_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	55.1	3.9e-114
>prophage 251
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3152043	3153882	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_096034928.1|3152043_3153882_-	EndoU domain-containing protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	5.4e-127
>prophage 252
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3157062	3161050	4085488		Bacillus_phage(50.0%)	3	NA	NA
WP_094247047.1|3157062_3158946_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	1.5e-127
WP_094247046.1|3159465_3159828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247045.1|3160129_3161050_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	48.2	1.1e-59
>prophage 253
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3166521	3167514	4085488		Tupanvirus(100.0%)	1	NA	NA
WP_094247041.1|3166521_3167514_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.3	5.1e-47
>prophage 254
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3174888	3175524	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_007407316.1|3174888_3175524_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	50.4	6.2e-22
>prophage 255
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3182188	3186117	4085488		Bacillus_phage(66.67%)	5	NA	NA
WP_094247035.1|3182188_3183373_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	30.2	7.3e-08
WP_003154919.1|3183411_3183597_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	75.9	2.6e-21
WP_094247034.1|3183772_3184591_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_094247033.1|3184616_3185378_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_077722089.1|3185379_3186117_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.9	3.1e-17
>prophage 256
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3198472	3230358	4085488	tail,portal,capsid,holin,plate,terminase	Bacillus_phage(32.26%)	43	NA	NA
WP_087920760.1|3198472_3199609_+	S9 family peptidase	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|3199598_3199733_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003154880.1|3199874_3200828_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_007610770.1|3200859_3201237_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_094247028.1|3201345_3201951_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.8	2.0e-41
WP_003154873.1|3202104_3202695_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|3202843_3203182_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_033574556.1|3203373_3203553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247027.1|3203542_3204370_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	1.3e-19
WP_032861409.1|3204269_3205070_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.9	1.0e-58
WP_094247026.1|3205069_3205237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025851823.1|3205334_3205676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|3205665_3205869_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_017417605.1|3205982_3206495_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	2.9e-22
WP_025851819.1|3206607_3207405_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.8	7.2e-60
WP_025851817.1|3207401_3208700_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	4.2e-150
WP_088005490.1|3208748_3210140_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.6	3.0e-138
WP_015417286.1|3210159_3211005_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	57.6	4.3e-55
WP_007407274.1|3211031_3211967_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_094247025.1|3211983_3212367_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007610806.1|3212363_3212720_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_069473356.1|3212716_3213220_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.0	3.2e-37
WP_069473357.1|3213216_3213663_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003154839.1|3213659_3213869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044053125.1|3213868_3215266_+|tail	phage tail sheath family protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_003154837.1|3215267_3215711_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|3215785_3216232_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|3216273_3216426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247024.1|3216413_3221537_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	2.0e-41
WP_094247023.1|3221529_3222189_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	44.2	3.1e-08
WP_039251762.1|3222202_3223180_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	2.9e-34
WP_094247022.1|3223179_3223446_+	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	1.5e-06
WP_003154825.1|3223549_3223975_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_003154824.1|3223967_3225014_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	7.7e-70
WP_003154823.1|3224997_3225576_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	2.4e-12
WP_003154822.1|3225572_3225845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247021.1|3225847_3227470_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	3.1e-41
WP_070081681.1|3227482_3227854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071391956.1|3227858_3228056_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	62.5	3.3e-14
WP_094247020.1|3228112_3228874_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003154815.1|3228925_3229189_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|3229202_3229466_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_024085195.1|3229479_3230358_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	4.8e-81
>prophage 257
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3238473	3241158	4085488		Salmonella_phage(50.0%)	3	NA	NA
WP_003154790.1|3238473_3239445_+	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.6	5.0e-63
WP_172424414.1|3239531_3239708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152036128.1|3239808_3241158_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	33.3	1.6e-22
>prophage 258
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3245884	3246913	4085488		Planktothrix_phage(100.0%)	1	NA	NA
WP_025851774.1|3245884_3246913_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	5.7e-17
>prophage 259
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3250652	3252527	4085488		Clostridium_phage(50.0%)	2	NA	NA
WP_094247012.1|3250652_3251552_+	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	44.0	2.7e-18
WP_096034931.1|3251555_3252527_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.0	8.9e-20
>prophage 260
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3256799	3260428	4085488		Streptococcus_phage(66.67%)	3	NA	NA
WP_017417625.1|3256799_3257702_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	36.2	1.2e-15
WP_044053138.1|3258071_3259184_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.2	3.2e-74
WP_094247009.1|3259180_3260428_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.4	6.1e-98
>prophage 261
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3270135	3274567	4085488		Bacillus_phage(50.0%)	4	NA	NA
WP_025851741.1|3270135_3271095_-	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	50.9	1.5e-72
WP_094032380.1|3271314_3272148_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_094032381.1|3272193_3272955_-	CbiQ family ECF transporter T component	NA	NA	NA	NA	NA
WP_094247002.1|3272929_3274567_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	4.5e-16
>prophage 262
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3283123	3288655	4085488		Bacillus_phage(66.67%)	6	NA	NA
WP_070081710.1|3283123_3284005_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	37.5	8.0e-44
WP_094247000.1|3284648_3285218_+	DedA family protein	NA	NA	NA	NA	NA
WP_025851720.1|3285464_3286247_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	43.1	1.2e-30
WP_003154719.1|3286523_3287279_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_003154718.1|3287275_3288454_+	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_003154717.1|3288460_3288655_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	65.5	3.6e-13
>prophage 263
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3296521	3300649	4085488		Acanthamoeba_polyphaga_mimivirus(50.0%)	4	NA	NA
WP_094246998.1|3296521_3297019_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	47.5	1.5e-18
WP_003154704.1|3297260_3298322_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_094246997.1|3298328_3299513_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_094246996.1|3299869_3300649_-	carbon-nitrogen family hydrolase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	26.9	4.6e-11
>prophage 264
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3309901	3317242	4085488	protease	Pneumococcus_phage(50.0%)	7	NA	NA
WP_070081723.1|3309901_3311998_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	42.6	3.9e-129
WP_094246992.1|3312399_3313437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246991.1|3313534_3314656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154679.1|3314905_3315565_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.4	6.6e-67
WP_003154678.1|3315565_3316006_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003154676.1|3315998_3316730_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.6	2.6e-56
WP_003154673.1|3316747_3317242_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	73.2	1.1e-55
>prophage 265
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3324125	3328918	4085488		Bacillus_phage(50.0%)	4	NA	NA
WP_003154665.1|3324125_3324749_+	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	54.5	1.7e-27
WP_057079972.1|3324864_3326205_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_094246989.1|3326267_3326762_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_044053151.1|3327004_3328918_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.0	7.4e-111
>prophage 266
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3332524	3334621	4085488		Vibrio_phage(100.0%)	1	NA	NA
WP_070081734.1|3332524_3334621_+	PTS transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	45.8	3.4e-08
>prophage 267
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3338268	3350418	4085488		uncultured_Caudovirales_phage(25.0%)	10	NA	NA
WP_044053153.1|3338268_3340236_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.6	3.1e-11
WP_094246986.1|3340316_3341183_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_088462211.1|3341738_3342128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096034932.1|3342342_3342513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057079978.1|3342513_3343290_-	hypothetical protein	NA	U5Q0C0	Bacillus_phage	62.6	6.2e-40
WP_021493760.1|3343630_3345763_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003154628.1|3345940_3347761_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.6	1.3e-08
WP_007611083.1|3347786_3348956_-	aminotransferase A	NA	NA	NA	NA	NA
WP_007409608.1|3349156_3349318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014304917.1|3349506_3350418_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.8	1.0e-46
>prophage 268
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3353991	3354756	4085488		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003154618.1|3353991_3354756_+	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	39.4	6.7e-39
>prophage 269
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3360158	3361997	4085488		Bacillus_phage(100.0%)	3	NA	NA
WP_070081741.1|3360158_3360632_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	35.7	2.3e-13
WP_094246984.1|3360621_3361515_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_094246983.1|3361541_3361997_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	31.9	3.1e-15
>prophage 270
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3365416	3365875	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_094246981.1|3365416_3365875_+	redoxin domain-containing protein	NA	A0A127AW88	Bacillus_phage	49.3	7.9e-35
>prophage 271
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3374408	3375101	4085488		Planktothrix_phage(100.0%)	1	NA	NA
WP_070081750.1|3374408_3375101_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.0e-33
>prophage 272
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3381336	3382956	4085488		Tupanvirus(100.0%)	1	NA	NA
WP_003154562.1|3381336_3382956_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.5	4.9e-47
>prophage 273
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3386823	3387108	4085488		Paenibacillus_phage(100.0%)	1	NA	NA
WP_024085249.1|3386823_3387108_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	50.0	1.5e-12
>prophage 274
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3395078	3395633	4085488		Synechococcus_phage(100.0%)	1	NA	NA
WP_071391889.1|3395078_3395633_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.7	6.0e-13
>prophage 275
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3399581	3411839	4085488		Paenibacillus_phage(100.0%)	1	NA	NA
WP_094246975.1|3399581_3411839_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.9	9.5e-34
>prophage 276
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3416652	3432355	4085488		Paenibacillus_phage(100.0%)	2	NA	NA
WP_094246973.1|3416652_3425361_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	28.8	6.1e-35
WP_094246972.1|3425353_3432355_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.2	2.8e-38
>prophage 277
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3438089	3445472	4085488		Paenibacillus_phage(100.0%)	1	NA	NA
WP_094246970.1|3438089_3445472_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	33.8	3.7e-41
>prophage 278
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3449403	3450495	4085488		Mycobacterium_phage(100.0%)	1	NA	NA
WP_094246968.1|3449403_3450495_+	serine hydrolase	NA	G1BNF7	Mycobacterium_phage	25.5	6.7e-08
>prophage 279
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3454520	3455933	4085488		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_033574600.1|3454520_3455933_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.6	7.5e-44
>prophage 280
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3468270	3472945	4085488		Streptococcus_phage(50.0%)	5	NA	NA
WP_003154502.1|3468270_3470109_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	38.8	3.8e-19
WP_014304952.1|3470165_3470486_+	YlaH-like family protein	NA	NA	NA	NA	NA
WP_003154499.1|3470527_3470737_-	YlaI family protein	NA	NA	NA	NA	NA
WP_003154498.1|3470838_3471462_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_003154497.1|3471616_3472945_+	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	33.6	7.6e-54
>prophage 281
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3487648	3494442	4085488		Macacine_betaherpesvirus(25.0%)	11	NA	NA
WP_003154478.1|3487648_3488092_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.7	1.8e-12
WP_003154477.1|3488176_3489217_+	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.0	3.4e-17
WP_070081781.1|3489380_3489791_+	YlbD family protein	NA	NA	NA	NA	NA
WP_003154475.1|3489806_3490046_+	YlbE-like family protein	NA	NA	NA	NA	NA
WP_003154472.1|3490116_3490566_+	YlbF family regulator	NA	NA	NA	NA	NA
WP_003154470.1|3490624_3490897_+	YlbG family protein	NA	NA	NA	NA	NA
WP_094246961.1|3490987_3491197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077722171.1|3491196_3491751_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003154467.1|3491755_3492238_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.9	5.4e-26
WP_003154466.1|3492256_3493483_-	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
WP_014304961.1|3493662_3494442_+	patatin family protein	NA	A0A1V0SCG0	Catovirus	26.9	9.7e-09
>prophage 282
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3497822	3498398	4085488		Bacillus_phage(100.0%)	1	NA	NA
WP_003154450.1|3497822_3498398_+	sporulation-specific transcriptional regulator GerR	NA	A0A1D6X8E5	Bacillus_phage	29.5	2.8e-05
>prophage 283
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3519459	3527527	4085488		Bacillus_phage(50.0%)	5	NA	NA
WP_094246957.1|3519459_3523755_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	33.6	4.5e-23
WP_094246956.1|3523971_3524901_+	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_007409714.1|3524958_3525678_+	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	41.4	8.1e-18
WP_003154420.1|3525818_3526601_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.1	2.2e-45
WP_015417427.1|3526729_3527527_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	2.5e-12
>prophage 284
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3533492	3543877	4085488	tRNA	Moumouvirus(25.0%)	9	NA	NA
WP_094246953.1|3533492_3536258_+|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	26.5	3.0e-81
WP_096034934.1|3536407_3536779_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003154398.1|3536880_3537342_+	signal peptidase II	NA	NA	NA	NA	NA
WP_013352191.1|3537343_3538258_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003154392.1|3538446_3538992_+	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013352192.1|3539147_3540458_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.5	1.3e-58
WP_014471818.1|3540601_3541516_+	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	36.4	1.1e-35
WP_013352194.1|3541499_3542786_+	dihydroorotase	NA	NA	NA	NA	NA
WP_013352195.1|3542782_3543877_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	38.5	9.0e-61
>prophage 285
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3552256	3554012	4085488		Tupanvirus(100.0%)	2	NA	NA
WP_094246952.1|3552256_3553405_+	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	29.5	8.3e-41
WP_013352204.1|3553418_3554012_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	42.0	1.7e-26
>prophage 286
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3559734	3569723	4085488	tRNA	Paramecium_bursaria_Chlorella_virus(20.0%)	9	NA	NA
WP_014470417.1|3559734_3562407_+	calcium-translocating P-type ATPase, SERCA-type	NA	A7IUR5	Paramecium_bursaria_Chlorella_virus	29.7	1.6e-90
WP_014470416.1|3562488_3563364_+	YicC family protein	NA	NA	NA	NA	NA
WP_003154355.1|3563440_3563710_+	extracellular matrix/biofilm regulator RemA	NA	NA	NA	NA	NA
WP_013352212.1|3563717_3564332_+	guanylate kinase	NA	S4W1R9	Pandoravirus	33.1	3.7e-11
WP_003154346.1|3564335_3564539_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_014470413.1|3564629_3565850_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.4	1.8e-41
WP_094246951.1|3565846_3568258_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_003154343.1|3568282_3568765_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	45.0	4.9e-19
WP_094246950.1|3568769_3569723_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.8	8.2e-10
>prophage 287
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3572908	3574852	4085488		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_077722187.1|3572908_3574852_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	36.1	2.0e-23
>prophage 288
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3586262	3588209	4085488		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_094246944.1|3586262_3587003_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	2.0e-19
WP_003154310.1|3587087_3587321_+	acyl carrier protein	NA	M4M9G2	Vibrio_phage	44.9	7.1e-08
WP_003154303.1|3587459_3588209_+	ribonuclease III	NA	M1PMQ4	Moumouvirus	32.4	1.9e-25
>prophage 289
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3599448	3600216	4085488		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_094246942.1|3599448_3600216_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.6	6.1e-24
>prophage 290
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3605623	3612039	4085488	protease,tRNA	Tupanvirus(33.33%)	5	NA	NA
WP_025649465.1|3605623_3607699_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.7	1.5e-104
WP_012117550.1|3607763_3609071_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_007409774.1|3609140_3610058_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.7	9.0e-30
WP_003154267.1|3610073_3610619_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_014305002.1|3610635_3612039_+	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	28.3	1.8e-42
>prophage 291
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3638282	3639047	4085488		Salisaeta_icosahedral_phage(100.0%)	1	NA	NA
WP_003154217.1|3638282_3639047_+	RNA polymerase sigma-28 factor SigD	NA	I1ZBD5	Salisaeta_icosahedral_phage	27.4	1.0e-07
>prophage 292
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3642966	3643749	4085488		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003154211.1|3642966_3643749_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	40.7	4.3e-25
>prophage 293
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3648869	3660433	4085488	tRNA	Clostridium_phage(33.33%)	10	NA	NA
WP_024085302.1|3648869_3653183_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	31.8	6.3e-25
WP_007409801.1|3653422_3653893_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003154195.1|3653932_3655054_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003154193.1|3655067_3655343_+	glucose-induced regulator RulR	NA	NA	NA	NA	NA
WP_003154192.1|3655344_3655647_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_015388229.1|3655666_3657814_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	1.3e-23
WP_003154188.1|3657810_3658089_+	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_003154185.1|3658105_3658459_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_069013689.1|3658542_3659472_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_007611467.1|3659491_3660433_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	29.8	6.9e-09
>prophage 294
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3664277	3665513	4085488		Bacillus_virus(100.0%)	1	NA	NA
WP_003154178.1|3664277_3665513_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	31.6	2.3e-49
>prophage 295
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3673906	3676267	4085488		Mycobacterium_phage(100.0%)	1	NA	NA
WP_145956744.1|3673906_3676267_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	50.0	7.1e-87
>prophage 296
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3682285	3684849	4085488		Streptococcus_phage(50.0%)	2	NA	NA
WP_094246928.1|3682285_3683566_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	27.8	2.8e-45
WP_070081837.1|3683562_3684849_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	26.3	1.1e-06
>prophage 297
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3689900	3697955	4085488		Bacillus_phage(40.0%)	7	NA	NA
WP_003154145.1|3689900_3690944_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	72.9	6.0e-139
WP_003154142.1|3691110_3692292_+	serine hydrolase	NA	A0A076YK70	Mycobacterium_phage	27.7	3.2e-11
WP_003154140.1|3692584_3694144_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_003154137.1|3694204_3694999_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_003154135.1|3695198_3695459_+	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	42.5	1.2e-08
WP_043867101.1|3695717_3696764_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	62.0	1.1e-10
WP_029325912.1|3696776_3697955_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	32.8	2.7e-47
>prophage 298
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3700978	3707779	4085488		Catovirus(33.33%)	3	NA	NA
WP_094246926.1|3700978_3703564_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.2	5.1e-38
WP_038463888.1|3703579_3705457_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.4	2.0e-68
WP_003154103.1|3707101_3707779_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	26.3	1.4e-11
>prophage 299
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3715512	3784391	4085488		Paenibacillus_phage(62.5%)	12	NA	NA
WP_094246923.1|3715512_3730464_+	non-ribosomal peptide synthetase	NA	D0R7J2	Paenibacillus_phage	59.6	5.8e-126
WP_172424413.1|3730447_3743893_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.0	5.9e-37
WP_094246921.1|3743910_3754452_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.0	2.2e-39
WP_094246920.1|3754441_3770743_+	non-ribosomal peptide synthetase	NA	D0R7J2	Paenibacillus_phage	58.3	1.2e-121
WP_094246919.1|3770756_3778214_+	polyketide synthase dehydratase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	31.0	6.6e-38
WP_094247884.1|3778348_3779560_-	cytochrome P450	NA	NA	NA	NA	NA
WP_007611576.1|3779848_3780283_+	sporulation protein	NA	F8WPS9	Bacillus_phage	55.7	5.5e-38
WP_094246918.1|3780343_3781099_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_007410383.1|3781132_3781495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246917.1|3781687_3783016_-	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	34.2	3.8e-29
WP_041481863.1|3783194_3783428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154076.1|3783683_3784391_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	54.1	2.1e-50
>prophage 300
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3788784	3794998	4085488		Bacillus_phage(50.0%)	6	NA	NA
WP_003154061.1|3788784_3789177_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
WP_003154060.1|3789136_3791239_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
WP_024085331.1|3791256_3792246_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.3	2.5e-155
WP_044053225.1|3792294_3792915_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	1.2e-46
WP_094246916.1|3792964_3793723_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	4.8e-53
WP_070081863.1|3794029_3794998_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	41.2	2.1e-53
>prophage 301
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3809415	3815939	4085488		Hokovirus(33.33%)	6	NA	NA
WP_094246908.1|3809415_3812013_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.9	1.1e-45
WP_003154037.1|3812565_3812664_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154035.1|3813475_3813661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246906.1|3813891_3814908_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.4	3.6e-32
WP_172424412.1|3815220_3815364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247883.1|3815522_3815939_+	UPF0715 family protein	NA	O64087	Bacillus_phage	68.8	3.4e-21
>prophage 302
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3820298	3830526	4085488		Bacillus_phage(66.67%)	12	NA	NA
WP_003154023.1|3820298_3820919_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	36.9	1.3e-19
WP_003154022.1|3821083_3821182_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_017417867.1|3821970_3822507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172424401.1|3822792_3822948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246901.1|3823116_3825534_-	peptidase G2	NA	D6R401	Bacillus_phage	50.6	2.1e-219
WP_003154017.1|3825911_3826346_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	85.9	2.3e-68
WP_094246900.1|3826622_3827444_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	42.7	2.4e-50
WP_003154013.1|3827552_3827702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154011.1|3827688_3828519_+	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	72.7	3.8e-104
WP_003154009.1|3828546_3828996_-	YndM family protein	NA	NA	NA	NA	NA
WP_070081879.1|3829137_3829566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154004.1|3829905_3830526_-	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
>prophage 303
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3845685	3850079	4085488		Bacillus_virus(50.0%)	2	NA	NA
WP_025650141.1|3845685_3847653_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	2.4e-125
WP_025650140.1|3847655_3850079_+	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	33.1	1.5e-100
>prophage 304
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3857290	3858292	4085488		Enterobacteria_phage(100.0%)	1	NA	NA
WP_025650135.1|3857290_3858292_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	27.6	1.4e-23
>prophage 305
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3867441	3867750	4085488		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_094246893.1|3867441_3867750_+	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	41.7	2.6e-10
>prophage 306
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3871940	3907968	4085488		Tupanvirus(100.0%)	3	NA	NA
WP_094246891.1|3871940_3879800_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.1	3.2e-91
WP_094246890.1|3879883_3895975_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.2	1.5e-92
WP_094246889.1|3896019_3907968_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.2	3.9e-117
>prophage 307
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3916618	3921469	4085488		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_094246884.1|3916618_3917779_-	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	26.0	4.6e-31
WP_094246883.1|3917768_3919115_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.7	1.0e-13
WP_094246882.1|3919111_3919882_-	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_094246881.1|3920161_3920569_+	GtrA family protein	NA	NA	NA	NA	NA
WP_094246880.1|3920575_3921469_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.3	2.0e-82
>prophage 308
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3927023	3928664	4085488		Hepacivirus(100.0%)	1	NA	NA
WP_094246876.1|3927023_3928664_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.7	1.0e-47
>prophage 309
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3932107	3969777	4085488		Tupanvirus(100.0%)	5	NA	NA
WP_094246874.1|3932107_3935911_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.4	1.1e-84
WP_094246873.1|3935929_3946705_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.8	1.7e-159
WP_094246872.1|3946730_3954380_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.0	5.7e-77
WP_094246871.1|3954395_3962093_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.9	7.0e-160
WP_094246870.1|3962118_3969777_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.5	1.8e-78
>prophage 310
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3975253	3975799	4085488	integrase	Bacillus_phage(100.0%)	1	3962730:3962745	3978755:3978770
3962730:3962745	attL	CATGAAGCGCCATTCC	NA	NA	NA	NA
WP_003153850.1|3975253_3975799_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
WP_003153850.1|3975253_3975799_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
3978755:3978770	attR	CATGAAGCGCCATTCC	NA	NA	NA	NA
>prophage 311
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3980069	3981998	4085488	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_094246865.1|3980069_3981998_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.4	5.1e-136
>prophage 312
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3991894	3995432	4085488		Streptococcus_phage(50.0%)	4	NA	NA
WP_014305177.1|3991894_3993013_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.2	1.1e-69
WP_014418088.1|3993037_3993886_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	30.2	8.9e-24
WP_003153833.1|3994062_3994431_-	replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.0	9.2e-18
WP_003153828.1|3994715_3995432_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	77.2	2.8e-47
>prophage 313
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	3999478	4000495	4085488		Streptococcus_phage(100.0%)	1	NA	NA
WP_094247881.1|3999478_4000495_-	2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	31.1	2.0e-22
>prophage 314
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	4004684	4005431	4085488		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_070081958.1|4004684_4005431_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.8e-16
>prophage 315
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	4010303	4010969	4085488		Streptococcus_phage(100.0%)	1	NA	NA
WP_003153802.1|4010303_4010969_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	32.6	3.3e-18
>prophage 316
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	4014815	4017702	4085488		Bacillus_phage(50.0%)	2	NA	NA
WP_003153795.1|4014815_4015688_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A217EQJ4	Bacillus_phage	70.8	4.0e-27
WP_070081962.1|4015923_4017702_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.8	2.6e-81
>prophage 317
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	4026044	4026890	4085488		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_070081967.1|4026044_4026890_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.3	2.9e-35
>prophage 318
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	4036538	4040952	4085488		Halovirus(33.33%)	4	NA	NA
WP_003153758.1|4036538_4037429_-	MoxR family ATPase	NA	R4TG24	Halovirus	26.7	4.6e-07
WP_057080768.1|4037506_4038097_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_014305202.1|4038179_4039421_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	42.1	2.6e-16
WP_024085478.1|4039740_4040952_-	glycosyl transferase family 1	NA	G4WEM5	Phthorimaea_operculella_granulovirus	30.1	1.6e-05
>prophage 319
NZ_CP023320	Bacillus velezensis strain SCGB 1 chromosome, complete genome	4085488	4066568	4084647	4085488		Bacillus_phage(95.0%)	34	NA	NA
WP_172424411.1|4066568_4066715_-	hypothetical protein	NA	A0A1P8CX58	Bacillus_phage	83.3	7.5e-16
WP_094246829.1|4066711_4067299_-	Holliday junction resolvase RecU	NA	A0A1P8CX67	Bacillus_phage	86.7	9.6e-94
WP_014470254.1|4067396_4067636_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_014471919.1|4068029_4068200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041915546.1|4068196_4068367_-	hypothetical protein	NA	O64190	Bacillus_phage	57.9	2.3e-08
WP_096034937.1|4068367_4068916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064778454.1|4068896_4069442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095836066.1|4069431_4069587_-	hypothetical protein	NA	A0A1P8CX49	Bacillus_phage	85.4	1.3e-13
WP_014471921.1|4069619_4069874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096034938.1|4069923_4070154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038458497.1|4070254_4070467_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	98.6	9.2e-31
WP_042976083.1|4070539_4070800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096034940.1|4071018_4071750_-	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	62.7	1.3e-71
WP_096034941.1|4071767_4072094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096034942.1|4072153_4072519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096034943.1|4072647_4073154_-	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	40.9	7.4e-34
WP_096034944.1|4073153_4073993_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	90.0	5.5e-151
WP_174243299.1|4074063_4074672_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_096034946.1|4075125_4075425_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	57.5	1.9e-21
WP_172424409.1|4075542_4075707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077722340.1|4075816_4076431_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	42.2	2.1e-43
WP_094246819.1|4076672_4076912_-	thioredoxin family protein	NA	A0A1P8CX24	Bacillus_phage	76.2	2.4e-27
WP_096034947.1|4076908_4077898_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	81.4	8.4e-151
WP_096034948.1|4078128_4080228_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	60.7	0.0e+00
WP_145979853.1|4080190_4080586_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	85.5	1.3e-57
WP_096034949.1|4080582_4080933_-	hypothetical protein	NA	O64171	Bacillus_phage	45.8	1.4e-20
WP_154066726.1|4080951_4081101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246817.1|4081131_4081455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246816.1|4081597_4081891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246815.1|4081926_4082349_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	62.4	3.0e-41
WP_077722325.1|4082411_4082765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096034950.1|4082903_4083377_-	hypothetical protein	NA	O64162	Bacillus_phage	67.3	1.2e-59
WP_154019766.1|4083475_4083649_-	hypothetical protein	NA	A0A1P8CX41	Bacillus_phage	94.7	5.2e-24
WP_186434472.1|4084419_4084647_-	hypothetical protein	NA	O64155	Bacillus_phage	60.3	2.2e-14
