The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017481	Pectobacterium polaris strain NIBIO1006 chromosome, complete genome	4826824	2962644	3039696	4826824	transposase,plate,tail,protease,holin,tRNA,integrase	Burkholderia_phage(26.92%)	75	3025117:3025138	3034483:3034504
WP_095699115.1|2962644_2963577_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_095699116.1|2963763_2965176_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_095994248.1|2965168_2966116_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_095994249.1|2966132_2966681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095699119.1|2967079_2967622_+	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_039480132.1|2967682_2968039_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_095994250.1|2968101_2968611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095994251.1|2968760_2969708_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_095994252.1|2969785_2970472_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_095994253.1|2970624_2971395_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_095994254.1|2971429_2973079_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_095994255.1|2973075_2974086_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	4.4e-30
WP_095994256.1|2974164_2975184_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_095994257.1|2975600_2976947_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_095994258.1|2977293_2979600_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_095994259.1|2979700_2980240_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_095994261.1|2980622_2981270_-	LysE family transporter	NA	NA	NA	NA	NA
WP_095994262.1|2981322_2982168_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_095994263.1|2982317_2984417_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.7	3.3e-43
WP_095699128.1|2984928_2986359_+	M10 family metallopeptidase	NA	NA	NA	NA	NA
WP_095994264.1|2986464_2986776_+|protease	protease inhibitor Inh/omp19 family protein	protease	NA	NA	NA	NA
WP_095994265.1|2986793_2988521_+	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	31.6	8.7e-18
WP_095994266.1|2988548_2989877_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_095994267.1|2989879_2991247_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_039273066.1|2991486_2991816_+|holin	putative holin	holin	A4JWP3	Burkholderia_virus	57.4	1.5e-24
WP_039315950.1|2991817_2992429_+	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	58.6	8.8e-58
WP_095994268.1|2992418_2993093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010281034.1|2993082_2993412_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	45.8	1.5e-19
WP_095994269.1|2993404_2993716_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	46.5	1.3e-20
WP_095994270.1|2993978_2994446_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_039273081.1|2994442_2994640_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	58.5	1.9e-09
WP_095994271.1|2994629_2996057_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	72.7	2.6e-201
WP_039273085.1|2996056_2996581_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	66.7	3.6e-68
WP_095994272.1|2996637_2996934_+	ferredoxin	NA	V5UTY8	Synechococcus_phage	55.0	4.8e-17
WP_095994273.1|2997090_2997411_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_108723452.1|2997379_2997499_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_095994274.1|2997716_3000197_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_095699140.1|3000196_3001126_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	43.7	1.8e-46
WP_095994275.1|3001115_3001328_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	58.6	1.5e-17
WP_095994276.1|3001315_3002476_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.8	8.0e-84
WP_095994277.1|3002472_3003054_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	45.6	2.7e-24
WP_039273098.1|3003112_3003460_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	61.1	1.2e-32
WP_095994278.1|3003450_3004554_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	53.8	1.5e-103
WP_095994279.1|3004546_3005128_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	62.8	8.7e-63
WP_095994280.1|3007195_3007816_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	34.4	1.2e-22
WP_157910780.1|3007870_3008014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125460905.1|3009030_3009621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095994283.1|3010364_3011333_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_095994284.1|3011419_3013288_+	peptidase M3	NA	NA	NA	NA	NA
WP_095994285.1|3013338_3014061_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	4.3e-35
WP_005972676.1|3014057_3014717_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_095699150.1|3014743_3015490_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_010294859.1|3015880_3016384_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.9	1.8e-08
WP_095994286.1|3016721_3017273_+	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	37.1	3.7e-15
WP_095994287.1|3017260_3018148_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_039480180.1|3018524_3019040_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.0	1.2e-15
WP_095994288.1|3019385_3020555_+	MFS transporter	NA	NA	NA	NA	NA
WP_095994289.1|3020599_3022000_-	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_095994290.1|3022405_3022942_+	rhodanese family protein	NA	NA	NA	NA	NA
WP_014914981.1|3023013_3023343_+	DHCW motif cupin fold protein	NA	NA	NA	NA	NA
WP_095994291.1|3023594_3024317_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_095994292.1|3024465_3024837_-	VOC family protein	NA	NA	NA	NA	NA
3025117:3025138	attL	ATTTGGTCGGCACGAGAGGATT	NA	NA	NA	NA
WP_095994293.1|3025405_3026260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095994294.1|3026383_3026548_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_095994295.1|3026863_3027445_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_095994296.1|3027445_3028258_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014699424.1|3028797_3029283_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_095994297.1|3029619_3031767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095994299.1|3032135_3032777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095994300.1|3033039_3034269_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	48.5	1.3e-105
WP_095994301.1|3034640_3036386_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
3034483:3034504	attR	ATTTGGTCGGCACGAGAGGATT	NA	NA	NA	NA
WP_005967239.1|3036400_3036631_-	YejL family protein	NA	NA	NA	NA	NA
WP_095699169.1|3036851_3037862_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	2.2e-85
WP_095994302.1|3037944_3039093_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_107332875.1|3039237_3039696_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.0e-14
>prophage 3
NZ_CP017481	Pectobacterium polaris strain NIBIO1006 chromosome, complete genome	4826824	3346053	3355718	4826824	tRNA	Tupanvirus(33.33%)	10	NA	NA
WP_039480511.1|3346053_3347982_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	1.4e-128
WP_095699351.1|3347984_3348527_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.5	2.8e-15
WP_010275699.1|3348622_3348820_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005968887.1|3348863_3349220_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_106120997.1|3349309_3349354_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_014915263.1|3349536_3350520_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	4.5e-35
WP_095994461.1|3350534_3352922_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.9	5.1e-08
WP_009112984.1|3352926_3353223_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.1e-13
WP_095994462.1|3353284_3353710_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_095994463.1|3353999_3355718_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	1.5e-57
>prophage 4
NZ_CP017481	Pectobacterium polaris strain NIBIO1006 chromosome, complete genome	4826824	4440427	4449863	4826824	integrase	Morganella_phage(42.86%)	15	4433161:4433175	4455259:4455273
4433161:4433175	attL	TGGCCGGGCGGAAAA	NA	NA	NA	NA
WP_095995414.1|4440427_4441642_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	58.5	8.8e-134
WP_095995091.1|4441785_4442505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094432810.1|4442726_4442924_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	47.2	1.7e-07
WP_095995092.1|4442920_4443367_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.8	5.0e-26
WP_095995093.1|4443381_4443984_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	50.8	2.1e-48
WP_005971433.1|4444071_4444245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095995094.1|4444437_4444629_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_095995095.1|4444618_4444810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095995096.1|4444799_4445036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052201314.1|4445028_4445238_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	50.9	3.4e-09
WP_094432821.1|4445234_4445462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095995097.1|4445461_4448155_+	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	2.6e-295
WP_095995098.1|4448324_4448762_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_095995099.1|4448773_4449226_+	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_125460912.1|4449293_4449863_-	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	32.4	1.2e-19
4455259:4455273	attR	TGGCCGGGCGGAAAA	NA	NA	NA	NA
>prophage 5
NZ_CP017481	Pectobacterium polaris strain NIBIO1006 chromosome, complete genome	4826824	4741282	4746726	4826824		Mycobacterium_phage(33.33%)	6	NA	NA
WP_014916295.1|4741282_4741522_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	59.5	9.1e-19
WP_010280810.1|4741532_4741940_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A220BYR7	Staphylococcus_phage	26.5	1.1e-06
WP_095995260.1|4741936_4744099_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	3.5e-202
WP_014916297.1|4744123_4745086_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.6	3.0e-137
WP_039486522.1|4745467_4746205_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	37.1	1.4e-38
WP_039486519.1|4746261_4746726_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.1	1.8e-47
