The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023349	Escherichia coli strain ETEC-2264 chromosome, complete genome	4972828	198430	261537	4972828	protease,transposase,tRNA,plate	Emiliania_huxleyi_virus(11.11%)	51	NA	NA
WP_001325807.1|198430_199783_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|199812_202245_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|202366_202852_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|202855_203881_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|203985_204441_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|204444_205233_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|205232_206381_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|206377_206974_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|207010_210493_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055746.1|210505_211465_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|211563_213705_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|213761_214151_+	VOC family protein	NA	NA	NA	NA	NA
WP_000062312.1|215561_215822_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|215808_216009_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|216174_216720_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|216716_217139_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|217152_217863_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|218112_219093_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001346133.1|219296_220121_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260716.1|220173_221892_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|222001_222709_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|222705_223110_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|223227_224043_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|224082_224736_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_001387031.1|224728_225760_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	6.1e-35
WP_001140187.1|225947_226523_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997043.1|232409_233213_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_000648572.1|233209_234124_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234364_235165_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211710.1|235242_236013_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|236060_237419_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|237490_238246_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|238279_239002_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|238998_239466_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|239530_240262_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|240801_241587_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|241723_242203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|242212_243127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|243170_243653_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000377959.1|243676_245029_-	membrane protein	NA	NA	NA	NA	NA
WP_134688340.1|245039_248474_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240543.1|248582_249998_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088873.1|250002_250746_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614336.1|250742_253502_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	8.0e-82
WP_000343293.1|253510_254272_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246416.1|254276_255608_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080144.1|255610_256135_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113703.1|256131_257412_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348806.1|257436_258519_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001356142.1|258482_260045_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001254932.1|260385_261537_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 2
NZ_CP023349	Escherichia coli strain ETEC-2264 chromosome, complete genome	4972828	577627	648133	4972828	capsid,protease,transposase,head,tail,lysis,terminase,portal,tRNA	Enterobacteria_phage(54.24%)	78	NA	NA
WP_000912345.1|577627_579013_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143565.1|579048_579570_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|579677_579890_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|579891_580758_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|581238_581781_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|582000_582693_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001356128.1|582723_585333_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001250424.1|586362_586878_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|586880_587513_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001356151.1|588705_589728_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_001317493.1|589724_590507_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_024168150.1|590550_590862_-	hypothetical protein	NA	A0A088CD23	Shigella_phage	80.2	4.2e-40
WP_000446905.1|590825_591197_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|591168_591447_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|591494_591713_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|591811_592093_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000129285.1|592103_592661_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682319.1|592653_592815_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
WP_000186811.1|592811_593492_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	4.6e-132
WP_000100847.1|593488_594274_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|594279_594576_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001309317.1|594651_594942_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.0e-27
WP_000340376.1|595335_596199_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.1	1.8e-93
WP_000858975.1|596265_596955_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|597059_597290_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182888.1|597359_597899_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	66.5	1.3e-60
WP_001387574.1|597985_598915_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	68.7	1.6e-111
WP_001387575.1|598911_599634_+	replication P family protein	NA	A0A0K2FIT1	Enterobacteria_phage	93.4	3.0e-121
WP_134688352.1|599678_599885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001702985.1|599979_600948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001702986.1|601181_602969_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_077629860.1|603393_603495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053043.1|603491_603947_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.0	1.0e-58
WP_000224915.1|603946_604117_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774476.1|604109_604400_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	3.0e-48
WP_001099698.1|604396_604759_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.6	1.5e-60
WP_000971095.1|604755_604896_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001204791.1|604981_605365_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|605554_606652_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|607224_607440_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|607439_607937_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228695.1|608153_608336_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|608426_608720_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_032083248.1|609082_609277_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	2.2e-26
WP_000453581.1|609665_610211_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.0e-94
WP_001714056.1|610185_612111_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198153.1|612107_612314_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001356148.1|612310_613912_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123235.1|613892_615224_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.3	2.7e-229
WP_000201478.1|615233_615566_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_000118191.1|615621_616647_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.9	2.4e-185
WP_000158855.1|616688_617087_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	82.6	2.0e-50
WP_000753006.1|617098_617452_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
WP_000975083.1|617463_618042_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.7e-79
WP_000683145.1|618038_618434_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001766691.1|618441_619182_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	7.0e-126
WP_000479153.1|619197_619620_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|619601_620036_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001703004.1|620028_622590_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.1	0.0e+00
WP_000847345.1|622586_622916_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152502.1|622915_623614_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000194784.1|623619_624363_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	5.0e-148
WP_000090891.1|624299_624932_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000993921.1|625067_625718_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	42.7	6.8e-16
WP_000624622.1|625717_626065_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_095892491.1|626084_627656_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	2.9e-169
WP_095892492.1|627704_631103_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001230362.1|631169_631769_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	3.7e-109
WP_001356157.1|631833_635061_+	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
WP_001704483.1|635060_635645_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	5.0e-103
WP_122985473.1|635699_636368_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000386784.1|637230_637980_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389524.1|638229_639183_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|639696_640458_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224567.1|640640_641531_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|641531_644504_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383945.1|644490_646728_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000394594.1|646996_648133_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP023349	Escherichia coli strain ETEC-2264 chromosome, complete genome	4972828	996055	1006535	4972828	protease	Vibrio_phage(33.33%)	6	NA	NA
WP_000188180.1|996055_998002_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|998074_998299_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000241204.1|998621_998942_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934053.1|998972_1001249_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097888.1|1002321_1003305_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	2.9e-42
WP_001101569.1|1003301_1006535_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.8	2.8e-62
>prophage 4
NZ_CP023349	Escherichia coli strain ETEC-2264 chromosome, complete genome	4972828	1260480	1315197	4972828	capsid,holin,head,integrase,tail,lysis,terminase,portal,tRNA	Escherichia_phage(41.67%)	62	1259092:1259107	1277045:1277060
1259092:1259107	attL	ATCCACCGCATCACCG	NA	NA	NA	NA
WP_000074983.1|1260480_1261599_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|1261567_1261837_-	excisionase	NA	NA	NA	NA	NA
WP_000048273.1|1261898_1264370_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001356104.1|1264463_1264655_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001358566.1|1264651_1264840_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001387733.1|1265240_1265678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001387734.1|1265646_1265976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001387735.1|1265987_1266140_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_001420344.1|1266432_1266771_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|1267162_1267405_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|1267388_1267814_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024167863.1|1267885_1268956_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.1	2.2e-51
WP_001151150.1|1268996_1269419_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000403785.1|1269476_1269833_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224664.1|1269926_1270109_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	1.5e-26
WP_000813254.1|1271199_1271355_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_023141427.1|1271522_1271795_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_001387739.1|1271796_1272855_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.2e-89
WP_000140024.1|1272855_1273221_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640017.1|1273229_1273772_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.9e-72
WP_000917767.1|1274003_1274201_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611206.1|1274351_1275401_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.1	2.8e-184
WP_000907693.1|1275722_1275947_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	75.4	1.1e-21
WP_000833651.1|1275943_1276096_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001297664.1|1276184_1276577_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	78.5	3.4e-47
WP_001297670.1|1276566_1276842_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	1.6e-43
WP_001117825.1|1276844_1277222_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	5.6e-63
1277045:1277060	attR	CGGTGATGCGGTGGAT	NA	NA	NA	NA
WP_001297666.1|1277354_1277468_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	86.5	5.6e-11
WP_000415817.1|1277826_1278219_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.9	3.7e-49
WP_001387741.1|1278803_1279349_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.3	2.8e-79
WP_095892498.1|1279323_1281249_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|1281245_1281452_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_095892499.1|1281448_1283050_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	4.9e-310
WP_001713237.1|1283030_1284350_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	97.7	2.9e-231
WP_001299443.1|1284359_1284692_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063240.1|1284747_1285773_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.1e-188
WP_000158875.1|1285814_1286210_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|1286221_1286575_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_001709668.1|1286586_1287165_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	2.9e-79
WP_001566190.1|1287161_1287557_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	1.7e-70
WP_095892529.1|1287564_1288305_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	2.0e-128
WP_000479153.1|1288320_1288743_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|1288724_1289159_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001703004.1|1289151_1291713_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.1	0.0e+00
WP_000847345.1|1291709_1292039_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152502.1|1292038_1292737_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000194784.1|1292742_1293486_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	5.0e-148
WP_000090891.1|1293422_1294055_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_095892500.1|1294115_1297595_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_001228219.1|1297662_1298262_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	6.5e-106
WP_095892501.1|1298326_1301212_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	85.5	1.1e-209
WP_001164127.1|1301215_1301743_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	94.9	7.5e-90
WP_000972153.1|1301771_1302305_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	96.6	1.1e-93
WP_000239881.1|1303713_1304382_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000799406.1|1304936_1305800_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1305783_1306920_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359461.1|1307169_1308399_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1308544_1309666_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001265481.1|1311200_1311872_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423750.1|1312039_1313410_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	5.5e-108
WP_001297479.1|1313413_1314055_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1314090_1315197_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP023349	Escherichia coli strain ETEC-2264 chromosome, complete genome	4972828	1760278	1781371	4972828	tail,transposase	Enterobacteria_phage(64.71%)	18	NA	NA
WP_000527756.1|1760278_1761739_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	8.6e-43
WP_000347482.1|1761827_1763111_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1763715_1763829_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1763897_1764131_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1764447_1765038_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885601.1|1765135_1765711_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	97.4	4.1e-105
WP_024171883.1|1765710_1769109_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233090.1|1769173_1769773_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_095892505.1|1769843_1773341_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.1	0.0e+00
WP_000090895.1|1773401_1774034_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_000194783.1|1773970_1774714_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152639.1|1774719_1775418_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847373.1|1775417_1775747_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.1e-58
WP_033561711.1|1775743_1778323_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.3	0.0e+00
WP_000459457.1|1778315_1778750_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479142.1|1778731_1779154_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_029380384.1|1779169_1779862_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.8	5.4e-120
WP_001254932.1|1780219_1781371_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 6
NZ_CP023349	Escherichia coli strain ETEC-2264 chromosome, complete genome	4972828	2082435	2158983	4972828	capsid,holin,transposase,plate,head,integrase,tail,terminase,portal,tRNA	Enterobacteria_phage(73.08%)	88	2121243:2121302	2159926:2160049
WP_000564745.1|2082435_2083407_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000399648.1|2083600_2084581_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001387992.1|2084850_2087280_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|2087304_2088405_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|2088792_2089539_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001356134.1|2089552_2090119_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025342.1|2090334_2092068_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001297434.1|2092244_2092733_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|2092852_2093245_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001390342.1|2093244_2095323_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|2095315_2096464_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|2096665_2097310_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2097320_2097710_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|2097724_2098774_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|2098776_2099637_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483220.1|2099655_2101257_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001387998.1|2101302_2102964_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.2	9.9e-11
WP_000147302.1|2103108_2103612_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001387999.1|2103632_2105597_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795622.1|2105601_2106528_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|2106524_2107412_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2107538_2108117_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2108119_2108470_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|2109249_2109678_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2109684_2111109_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001388000.1|2111083_2111884_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|2112050_2113037_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|2113051_2114566_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|2114635_2115625_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|2116421_2116925_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2117003_2117255_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2117369_2117456_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|2117718_2118042_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|2118212_2118710_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377225.1|2118747_2118987_-	YecH family protein	NA	NA	NA	NA	NA
WP_001388915.1|2119177_2120389_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|2120450_2121116_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2121243:2121302	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|2121472_2122474_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000490856.1|2122479_2122785_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290347.1|2122855_2123506_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|2123521_2123926_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|2124015_2124153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014505.1|2124224_2124428_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739032.1|2124449_2124800_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	84.5	2.7e-51
WP_000158971.1|2124810_2125098_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|2125109_2125352_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|2125348_2125462_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985161.1|2125548_2125752_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153674.1|2125748_2125994_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_001274214.1|2125990_2126290_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.8	8.2e-41
WP_000013453.1|2126612_2126843_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	92.1	4.2e-29
WP_000599410.1|2126915_2127281_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	8.7e-61
WP_001388917.1|2127287_2130095_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	95.6	0.0e+00
WP_000686494.1|2130171_2131131_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	1.2e-178
WP_000211268.1|2131135_2131447_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.3	8.5e-41
WP_000236493.1|2132641_2133166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|2133180_2134227_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613768.1|2134226_2135978_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	99.8	0.0e+00
WP_001262673.1|2136132_2136969_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055118.1|2136991_2138044_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_000632347.1|2138089_2138890_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_001388919.1|2138993_2139488_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	3.5e-89
WP_000864901.1|2139487_2139688_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2139690_2140014_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_001387672.1|2140010_2140403_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	3.8e-70
WP_000780562.1|2140399_2140807_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	3.2e-64
WP_001388920.1|2140944_2141079_+	hypothetical protein	NA	A0A0A7NPU6	Enterobacteria_phage	100.0	1.1e-18
WP_001703370.1|2141088_2141412_+|tail	phage tail completion protein R	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	2.2e-55
WP_001388922.1|2141404_2142040_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_001271945.1|2142036_2142618_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	9.5e-102
WP_000213447.1|2142614_2142965_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111964.1|2142968_2143865_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	1.8e-155
WP_000071720.1|2143857_2144388_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_095892509.1|2144390_2146805_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	70.6	8.4e-277
WP_001164128.1|2146808_2147336_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	93.7	3.7e-89
WP_000972151.1|2147364_2147898_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	97.2	3.9e-94
WP_000905056.1|2148925_2149513_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.5	6.0e-104
WP_000979956.1|2149548_2150037_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.6e-86
WP_001356151.1|2150172_2151195_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_001317493.1|2151191_2151974_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001390346.1|2152017_2154816_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.9	0.0e+00
WP_000763327.1|2154802_2154931_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|2154966_2155332_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|2155386_2155899_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005413.1|2155898_2157083_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.5	5.6e-226
WP_000132785.1|2157240_2158350_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_000488107.1|2158392_2158653_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|2158842_2158983_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
2159926:2160049	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 7
NZ_CP023349	Escherichia coli strain ETEC-2264 chromosome, complete genome	4972828	2320180	2348872	4972828	capsid,protease,head,tail,terminase,portal,tRNA	uncultured_Caudovirales_phage(58.33%)	30	NA	NA
WP_001390387.1|2320180_2321542_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	4.2e-217
WP_000716757.1|2321871_2322189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2322603_2323503_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2323584_2324364_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844200.1|2324463_2325504_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490689.1|2325551_2326907_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823282.1|2326910_2327195_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182881.1|2327225_2327678_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001356057.1|2328973_2329828_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2330125_2331178_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858500.1|2331434_2332712_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|2332708_2333713_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011951.1|2333709_2334675_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2334648_2335395_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351455.1|2335446_2336265_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000822270.1|2336329_2337130_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195588.1|2337126_2337915_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000197705.1|2338704_2338995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127869.1|2338991_2340653_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.3	4.9e-276
WP_001353110.1|2340636_2340993_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_001145897.1|2341281_2341722_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001287546.1|2341721_2342024_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
WP_122991688.1|2342016_2343189_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	88.8	2.1e-204
WP_000798773.1|2343232_2343793_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	2.6e-88
WP_000733253.1|2343847_2345017_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.3	1.8e-163
WP_001053662.1|2345303_2345810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024167808.1|2345845_2346094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000126652.1|2346110_2346536_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001353108.1|2346532_2346733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710150.1|2347054_2348872_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	1.5e-129
>prophage 8
NZ_CP023349	Escherichia coli strain ETEC-2264 chromosome, complete genome	4972828	2376642	2386083	4972828		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001356046.1|2376642_2377779_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.7e-161
WP_001356047.1|2377775_2379776_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001295429.1|2379900_2380362_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2380401_2380872_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2380918_2381638_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2381634_2383320_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001388061.1|2383541_2384273_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	1.4e-110
WP_001216961.1|2384332_2384440_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2384420_2385152_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|2385156_2386083_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 9
NZ_CP023349	Escherichia coli strain ETEC-2264 chromosome, complete genome	4972828	2585597	2664535	4972828	holin,transposase,head,integrase,coat,lysis,terminase,portal,tRNA	Enterobacteria_phage(50.0%)	91	2582802:2582818	2637255:2637271
2582802:2582818	attL	ATGCGCGACATCAAAAA	NA	NA	NA	NA
WP_001283590.1|2585597_2586410_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|2586409_2587423_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699104.1|2587488_2588625_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.5e-23
WP_000615821.1|2588723_2589719_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|2589715_2590894_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2591158_2592379_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683799.1|2592537_2594544_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2594664_2594943_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2594976_2595525_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2595524_2596334_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043820.1|2596333_2597158_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2597161_2598247_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2598281_2599214_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2599379_2599931_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000698675.1|2600003_2600858_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844745.1|2600859_2601399_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714140.1|2601395_2601884_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|2601880_2602390_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482747.1|2602405_2603158_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001356050.1|2603177_2605823_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033329.1|2605904_2606468_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2607142_2607628_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425058.1|2607830_2609975_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2609974_2611285_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|2611464_2611749_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2612120_2613461_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937836.1|2613826_2614885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2615066_2615822_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2616115_2617048_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_001388105.1|2617359_2618511_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	9.0e-221
WP_001703470.1|2618925_2620251_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_001386201.1|2620307_2622347_-|head	head-binding family protein	head	S4TU85	Salmonella_phage	50.4	5.1e-158
WP_001386203.1|2622447_2623326_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.5	4.0e-96
WP_001386205.1|2623588_2623729_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	59.1	4.4e-05
WP_021514397.1|2623834_2624083_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	95.1	3.2e-35
WP_000132668.1|2624085_2624364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001703472.1|2624554_2624932_+	hypothetical protein	NA	K7P6H4	Enterobacteria_phage	36.9	4.2e-10
WP_000816058.1|2624960_2625188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224776.1|2625184_2627308_-	hypothetical protein	NA	A0A0A0P1R1	Enterobacteria_phage	29.3	3.6e-50
WP_001386090.1|2627292_2628633_-	acyltransferase	NA	A0A0M5M1J8	Salmonella_phage	70.5	1.9e-158
WP_001708097.1|2628642_2629323_-	hypothetical protein	NA	G5DA80	Enterobacteria_phage	73.7	2.5e-53
WP_001386092.1|2629309_2629777_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	2.8e-64
WP_001388949.1|2629776_2630625_-	hypothetical protein	NA	Q716G6	Shigella_phage	93.3	3.6e-102
WP_001386094.1|2630624_2632043_-	phage stabilization family protein	NA	Q716G7	Shigella_phage	98.7	2.3e-274
WP_001054834.1|2632042_2632543_-	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
WP_001386095.1|2632520_2632769_-	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	92.0	2.3e-25
WP_001388950.1|2632813_2634109_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	1.2e-242
WP_000373006.1|2634108_2635020_-	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_001386097.1|2635033_2637199_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.9	0.0e+00
WP_000417851.1|2637199_2638699_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
2637255:2637271	attR	TTTTTGATGTCGCGCAT	NA	NA	NA	NA
WP_024167798.1|2638676_2639165_-	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	98.8	4.1e-90
WP_000807785.1|2639200_2639443_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_000191869.1|2640214_2640694_-	DUF2829 domain-containing protein	NA	A0A1Y0T2L3	Pseudomonas_phage	60.4	1.1e-55
WP_001385991.1|2640772_2641210_-|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	98.6	8.5e-71
WP_000229392.1|2641206_2641683_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|2641666_2641990_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001385993.1|2642478_2642967_-	phage antitermination Q family protein	NA	M1FPN0	Enterobacteria_phage	99.4	3.5e-89
WP_000994516.1|2642963_2643152_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008200.1|2643148_2643511_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_001385994.1|2643797_2644325_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	8.0e-100
WP_001385995.1|2644321_2644768_-	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	98.6	3.5e-80
WP_001281772.1|2644724_2644961_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|2644971_2645187_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001317493.1|2645875_2646658_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001356151.1|2646654_2647677_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_001036029.1|2647896_2648166_-	hypothetical protein	NA	G9L682	Escherichia_phage	98.9	1.9e-44
WP_001388106.1|2648165_2649602_-	AAA family ATPase	NA	K7PGR8	Enterobacteria_phage	99.8	6.7e-274
WP_001554884.1|2649591_2650482_-	hypothetical protein	NA	K7PH45	Enterobacterial_phage	98.3	5.4e-157
WP_001388108.1|2650662_2650959_-	bacteriophage CII family protein	NA	K7PKU6	Enterobacteria_phage	98.0	5.2e-48
WP_000276885.1|2651074_2651260_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|2651340_2651991_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|2652305_2652611_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930322.1|2652613_2652952_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	100.0	2.0e-59
WP_000167581.1|2653085_2653556_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	3.1e-87
WP_032243332.1|2653645_2653921_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	97.8	2.9e-45
WP_000365280.1|2654175_2654883_+	recombinase	NA	K7PKU3	Enterobacteria_phage	100.0	7.6e-138
WP_000018646.1|2654883_2655351_+	hypothetical protein	NA	A0A2I7QWC6	Vibrio_phage	62.0	1.2e-46
WP_000098523.1|2655347_2655854_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
WP_001016186.1|2655862_2656411_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.9	9.5e-104
WP_001388110.1|2656427_2656721_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
WP_001388111.1|2656731_2657022_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	94.8	1.5e-44
WP_001388112.1|2657018_2657186_+	DUF2737 family protein	NA	K7PJY9	Enterobacterial_phage	98.2	3.0e-24
WP_032243331.1|2657331_2658060_+	site-specific DNA-methyltransferase	NA	A0A2I7QM56	Vibrio_phage	58.2	3.5e-77
WP_001388115.1|2658078_2658465_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	88.5	5.4e-29
WP_001707223.1|2658418_2659261_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	53.5	1.0e-59
WP_001388117.1|2659260_2659539_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	100.0	1.9e-47
WP_032243330.1|2659697_2659865_+	hypothetical protein	NA	A0A2D1GM11	Escherichia_phage	92.7	5.4e-26
WP_001163428.1|2659922_2660123_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197023.1|2660652_2661900_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|2661971_2662886_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|2663101_2664535_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 10
NZ_CP023349	Escherichia coli strain ETEC-2264 chromosome, complete genome	4972828	2874032	2912638	4972828	holin,tail,terminase	Salmonella_phage(53.66%)	48	NA	NA
WP_001386857.1|2874032_2874587_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.4	2.8e-87
WP_001106829.1|2875026_2875467_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.3	2.5e-54
WP_001386003.1|2875438_2876041_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	1.4e-95
WP_000049948.1|2876913_2877594_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.3	4.5e-103
WP_001197068.1|2877590_2878790_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.6	2.2e-185
WP_001270636.1|2878789_2879143_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	2.0e-54
WP_001387924.1|2879142_2879895_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	65.9	2.9e-87
WP_000044735.1|2880131_2880686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000832850.1|2880693_2881041_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.1	6.0e-27
WP_095892510.1|2881043_2882108_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	80.6	3.6e-155
WP_000155118.1|2882110_2882413_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	1.8e-48
WP_001349561.1|2882412_2883000_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	89.1	3.1e-84
WP_001386171.1|2882999_2884988_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.2	3.3e-271
WP_000393964.1|2885165_2885618_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.0	2.2e-58
WP_000109249.1|2885621_2886062_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_001386172.1|2886072_2887218_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	8.8e-160
WP_001349562.1|2887221_2887785_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_001142484.1|2887759_2888149_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_001704607.1|2888135_2888690_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.7	1.5e-80
WP_001125665.1|2888686_2889094_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	8.7e-70
WP_001386174.1|2889063_2889282_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.6e-12
WP_001386175.1|2889323_2890265_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	1.1e-155
WP_001066731.1|2890276_2890783_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	1.7e-70
WP_000873174.1|2890786_2892007_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	1.1e-200
WP_000184962.1|2892021_2892756_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	85.6	2.3e-97
WP_001386179.1|2892646_2894113_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	1.0e-261
WP_001130777.1|2894112_2895735_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.7	0.0e+00
WP_000162796.1|2895737_2896310_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_000779566.1|2896371_2896896_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_001157004.1|2896879_2897356_-	glycoside hydrolase family 104 protein	NA	Q8SBE0	Shigella_phage	94.9	5.0e-85
WP_000781777.1|2897359_2897701_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	92.8	7.3e-54
WP_001174014.1|2898146_2898488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244506.1|2898519_2898942_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001703553.1|2899230_2901417_-	virulence-associated E family protein	NA	B6SCY1	Bacteriophage	72.4	5.4e-174
WP_000170998.1|2901420_2901633_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_000049986.1|2901753_2902377_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_000051352.1|2903156_2904059_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001386185.1|2904061_2905363_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.7	2.3e-132
WP_001386187.1|2905378_2905927_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.4	1.3e-65
WP_000551021.1|2905979_2906609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065471.1|2906655_2908719_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.7	1.5e-274
WP_000008820.1|2908724_2908940_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000637724.1|2908936_2909236_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	63.2	2.7e-28
WP_000312947.1|2909225_2909495_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	65.9	5.1e-26
WP_001707248.1|2909499_2910069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000559954.1|2910022_2910271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000199789.1|2910294_2911173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000384174.1|2911240_2912638_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.3	3.2e-212
>prophage 11
NZ_CP023349	Escherichia coli strain ETEC-2264 chromosome, complete genome	4972828	2969424	2977188	4972828	integrase,transposase	Escherichia_phage(66.67%)	6	2967212:2967225	2974325:2974338
2967212:2967225	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|2969424_2969907_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|2970649_2971879_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2971917_2972334_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|2972405_2974154_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_001703571.1|2974155_2975874_-	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	NA	A0A1B5FPD5	Escherichia_phage	95.3	2.0e-304
2974325:2974338	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_085947771.1|2976025_2977188_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 12
NZ_CP023349	Escherichia coli strain ETEC-2264 chromosome, complete genome	4972828	3048301	3055441	4972828		Escherichia_phage(83.33%)	6	NA	NA
WP_001272897.1|3048301_3050863_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001388213.1|3050968_3051625_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	1.2e-49
WP_001297141.1|3051675_3052443_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001388215.1|3052638_3053547_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_000590397.1|3053543_3054806_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3054802_3055441_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP023350	Escherichia coli strain ETEC-2264 plasmid unnamed1, complete sequence	112045	3861	57700	112045	transposase,integrase	Escherichia_phage(30.0%)	50	8464:8479	40663:40678
WP_001385964.1|3861_5586_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.1	6.4e-170
WP_000618110.1|6611_6860_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109061.1|6856_7294_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	1.4e-25
WP_000457531.1|7293_8565_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	1.4e-142
8464:8479	attL	TTTGCGGGGCGAGGAA	NA	NA	NA	NA
WP_000340829.1|8569_8962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103690.1|8966_9938_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000633910.1|10166_10811_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	5.1e-40
WP_000239529.1|10804_11080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016491.1|11217_12009_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	2.5e-52
WP_000796228.1|12005_12695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493398.1|12738_13089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371891.1|13642_13900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194553.1|13899_14490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142439.1|14509_14857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762577.1|14975_15296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000588735.1|16268_17129_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001386351.1|17444_18557_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_024172958.1|18745_19114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000346361.1|20683_21487_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071595697.1|21697_21901_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001385800.1|22571_23765_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.5	2.0e-29
WP_095892533.1|25341_26124_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	9.4e-137
WP_001356151.1|26120_27143_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_095892534.1|27328_28490_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.4e-51
WP_001387713.1|29924_30329_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001106584.1|31588_32803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000124145.1|33664_33904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095892534.1|33931_35094_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.4e-51
WP_000620425.1|36737_37364_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.2	3.7e-19
WP_000775193.1|37344_38130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673444.1|38086_39292_-	TolC family protein	NA	NA	NA	NA	NA
WP_000465104.1|39288_40425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421259.1|41208_41484_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
40663:40678	attR	TTCCTCGCCCCGCAAA	NA	NA	NA	NA
WP_001178087.1|41483_41768_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_003964539.1|42674_43706_-	replication initiation protein	NA	NA	NA	NA	NA
WP_024167927.1|44677_44941_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
WP_000483804.1|44909_45146_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_001712498.1|45587_46121_+	transcription termination factor nusG family protein	NA	NA	NA	NA	NA
WP_000213855.1|46374_47058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001136187.1|47229_47484_+	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_085949617.1|47517_47814_+	pilJ	NA	NA	NA	NA	NA
WP_001492935.1|48434_49502_+	type IV pilus biogenesis lipoprotein PilL	NA	NA	NA	NA	NA
WP_000539807.1|49501_49939_+	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_001388809.1|49952_51398_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_001317493.1|51448_52231_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001356151.1|52227_53250_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_001378495.1|54252_55029_+	heat-labile enterotoxin LT subunit A	NA	A0A023W6A1	Vibrio_virus	80.2	6.5e-122
WP_024167121.1|55025_55400_+	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	79.8	1.4e-50
WP_032272301.1|55720_56521_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.1	2.7e-62
WP_095892535.1|56486_57700_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	1.3e-166
>prophage 1
NZ_CP023351	Escherichia coli strain ETEC-2264 plasmid unnamed2, complete sequence	77345	39521	52118	77345	transposase	Stx2-converting_phage(30.0%)	21	NA	NA
WP_074516242.1|39521_40343_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.6	8.8e-45
WP_001272251.1|40453_40750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032228906.1|40975_41167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071606928.1|41217_41466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540588.1|41731_41974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533253.1|42032_42356_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.9	2.8e-26
WP_001415592.1|42577_42772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993931.1|42890_43541_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	43.1	1.4e-16
WP_000624622.1|43540_43888_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_024190699.1|43907_45479_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.1	5.2e-171
WP_095892540.1|45479_45677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000775237.1|45914_46076_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000870669.1|46284_46599_-	hypothetical protein	NA	I3UM57	Rhodobacter_phage	38.4	9.9e-13
WP_000994097.1|46595_47315_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845966.1|47311_47746_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145496.1|47800_49759_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	1.8e-19
WP_000005975.1|49817_50051_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.3	3.3e-05
WP_000290816.1|50106_50634_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	54.3	3.9e-46
WP_032144808.1|50861_51056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077694982.1|51106_51403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311069.1|51554_52118_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	38.0	2.7e-21
>prophage 2
NZ_CP023351	Escherichia coli strain ETEC-2264 plasmid unnamed2, complete sequence	77345	63104	72237	77345	transposase	Escherichia_phage(37.5%)	13	NA	NA
WP_000959884.1|63104_64067_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_001414994.1|64069_64420_+	plasmid stability family protein	NA	NA	NA	NA	NA
WP_024181414.1|64528_64948_+	hypothetical protein	NA	E5AGG6	Erwinia_phage	50.0	1.6e-18
WP_000005461.1|64882_65764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095892541.1|66236_66941_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_000144779.1|66977_67634_-	hypothetical protein	NA	A0A2H4P756	Pseudomonas_phage	43.7	7.0e-45
WP_000571065.1|67630_68140_-	trimethoprim-resistant dihydrofolate reductase DfrA8	NA	A0A1Y0SUI9	Pseudomonas_phage	38.8	6.5e-14
WP_001067855.1|68235_68940_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|69061_69922_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001415369.1|70108_70438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251694.1|70672_70894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131876.1|70884_71088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|71421_72237_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
