The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014137	Brenneria goodwinii strain FRB141 chromosome, complete genome	5360730	227	11106	5360730		Salmonella_phage(57.14%)	11	NA	NA
WP_095833209.1|227_740_+	hypothetical protein	NA	A0A0A0RVZ2	Escherichia_phage	44.2	5.3e-24
WP_095833210.1|764_971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095833211.1|973_1177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957947.1|1193_1415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095833213.1|1592_2189_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	62.9	8.0e-72
WP_095833214.1|2188_2773_+	hypothetical protein	NA	S4TND4	Salmonella_phage	69.6	1.1e-76
WP_095833215.1|2780_3179_+	hypothetical protein	NA	S4TR39	Salmonella_phage	61.8	2.6e-42
WP_095833216.1|3178_7015_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	56.1	1.0e-220
WP_095833218.1|7531_8281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095833219.1|8320_9943_+	hypothetical protein	NA	K7PHF0	Enterobacteria_phage	30.7	1.7e-47
WP_145957948.1|9876_11106_-	hypothetical protein	NA	A0A1I9SF20	Klebsiella_phage	44.4	2.5e-27
>prophage 2
NZ_CP014137	Brenneria goodwinii strain FRB141 chromosome, complete genome	5360730	333983	341300	5360730		Mycobacterium_phage(33.33%)	8	NA	NA
WP_183096798.1|333983_334553_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.5	2.2e-50
WP_048637781.1|334506_335244_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.8	8.5e-39
WP_095833381.1|335787_336708_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_095835697.1|336878_337370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048637784.1|337531_338494_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.6	1.4e-137
WP_095833382.1|338518_340669_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	50.6	8.1e-207
WP_048637786.1|340647_341055_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A217ER62	Bacillus_phage	33.6	1.6e-10
WP_048637787.1|341063_341300_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	56.6	1.0e-17
>prophage 3
NZ_CP014137	Brenneria goodwinii strain FRB141 chromosome, complete genome	5360730	1117741	1185464	5360730	capsid,protease,lysis,head,tail,holin,integrase,portal,terminase	Salmonella_phage(25.53%)	80	1117565:1117615	1165336:1165386
1117565:1117615	attL	ATTTGGTCGGCACGAGAGGATTTGAACCTCCGACCCCCGACACCCCATGAC	NA	NA	NA	NA
WP_095833774.1|1117741_1118923_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2D1GN00	Marinobacter_phage	29.0	1.4e-30
WP_095833775.1|1118924_1119167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095833776.1|1119260_1120358_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	54.0	1.7e-104
WP_183096792.1|1120368_1123176_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	51.1	8.1e-231
WP_095833778.1|1123322_1123604_-	DNA breaking-rejoining protein	NA	H6WRX2	Salmonella_phage	47.8	3.3e-20
WP_095833779.1|1124263_1124452_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_095833780.1|1124572_1124878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095833781.1|1125160_1125565_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	32.3	1.4e-06
WP_183096793.1|1125694_1126738_-	AAA family ATPase	NA	H2BD62	Pseudomonas_phage	37.9	3.0e-58
WP_095833783.1|1127322_1127706_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	59.0	3.3e-34
WP_095833784.1|1127808_1128039_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	62.2	5.5e-21
WP_095833785.1|1128039_1128609_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	38.7	8.3e-26
WP_095833786.1|1128997_1129975_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	58.5	9.1e-73
WP_095835733.1|1129958_1130429_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	66.0	6.6e-61
WP_183096791.1|1130461_1130719_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095833788.1|1130715_1131195_+	hypothetical protein	NA	H9C168	Pectobacterium_phage	50.6	5.7e-12
WP_095833789.1|1131187_1131940_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	83.1	2.0e-75
WP_095833790.1|1131936_1133919_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	62.0	1.9e-247
WP_095835734.1|1134013_1134256_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	69.1	3.4e-21
WP_095833791.1|1134393_1134843_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	52.1	5.2e-39
WP_095833792.1|1134835_1135462_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	43.9	2.4e-42
WP_095833793.1|1135458_1136070_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	43.8	1.7e-40
WP_095833794.1|1136214_1136472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095833795.1|1136500_1136911_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_095833796.1|1136973_1137162_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_095833797.1|1137381_1137636_+|holin	phage holin family protein	holin	K7P6H9	Enterobacteria_phage	66.7	2.3e-20
WP_183096794.1|1137632_1138136_+	glycoside hydrolase family protein	NA	I6PBN2	Cronobacter_phage	62.4	4.3e-50
WP_095835735.1|1138132_1138618_+	hypothetical protein	NA	H9C186	Pectobacterium_phage	80.7	8.3e-59
WP_095833799.1|1138590_1139121_+|lysis	lysis protein	lysis	S4TTP1	Salmonella_phage	44.3	7.2e-24
WP_095833800.1|1139134_1139458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095833802.1|1140113_1140368_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	79.8	5.9e-32
WP_095833804.1|1140762_1140996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095833806.1|1141465_1141930_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	5.7e-49
WP_095833807.1|1141883_1143620_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.9	4.0e-140
WP_095833808.1|1143626_1144946_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	57.6	2.2e-138
WP_095833809.1|1144921_1145629_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	8.3e-68
WP_095833810.1|1145638_1146853_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	61.3	5.9e-130
WP_095833811.1|1146902_1147160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095835736.1|1147189_1147495_+|head,tail	phage gp6-like head-tail connector protein	head,tail	G3ENA1	Psychrobacter_phage	29.5	1.5e-05
WP_095833812.1|1147501_1147843_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.9	8.2e-37
WP_095833813.1|1147835_1148285_+	HK97 gp10 family phage protein	NA	K7PH04	Enterobacteria_phage	87.9	1.1e-65
WP_095833814.1|1148281_1148629_+	DUF3168 domain-containing protein	NA	K7P7Q9	Enterobacteria_phage	55.4	9.8e-30
WP_095833815.1|1148689_1149130_+|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	77.8	4.6e-56
WP_095833816.1|1149179_1149566_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	49.2	1.1e-24
WP_095833817.1|1149589_1149859_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	62.9	1.0e-21
WP_145957962.1|1149938_1150541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095833819.1|1150604_1153916_+	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	28.5	3.8e-62
WP_095833820.1|1153950_1154157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095833211.1|1154159_1154363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957947.1|1154379_1154601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095833213.1|1154778_1155375_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	62.9	8.0e-72
WP_095833214.1|1155374_1155959_+	hypothetical protein	NA	S4TND4	Salmonella_phage	69.6	1.1e-76
WP_095833821.1|1155966_1156365_+	hypothetical protein	NA	S4TR39	Salmonella_phage	62.6	4.0e-43
WP_095833822.1|1156364_1160201_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	56.1	1.0e-220
WP_095833218.1|1160717_1161467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095833824.1|1161506_1163129_+	hypothetical protein	NA	K7PHF0	Enterobacteria_phage	29.8	3.8e-47
WP_145957963.1|1163062_1164277_-	hypothetical protein	NA	A0A1I9SF20	Klebsiella_phage	44.4	5.0e-28
WP_095833825.1|1164301_1164853_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	81.8	9.7e-80
WP_095835737.1|1165003_1165225_-	hypothetical protein	NA	H9C151	Pectobacterium_phage	79.5	5.5e-26
WP_095833826.1|1165493_1167245_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
1165336:1165386	attR	ATTTGGTCGGCACGAGAGGATTTGAACCTCCGACCCCCGACACCCCATGAC	NA	NA	NA	NA
WP_048638486.1|1167259_1167490_-	YejL family protein	NA	NA	NA	NA	NA
WP_048638487.1|1167666_1168677_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.3	1.6e-83
WP_095833827.1|1169136_1169775_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_095833828.1|1170026_1170680_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_048638490.1|1170755_1171274_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_048638491.1|1171365_1173093_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_048638492.1|1173302_1173761_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_048638493.1|1173836_1174913_-	porin OmpA	NA	NA	NA	NA	NA
WP_095833829.1|1175276_1175783_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_048638495.1|1176001_1176628_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_095833830.1|1176657_1178793_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_048638497.1|1178813_1179260_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_095833831.1|1179429_1181484_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.9	1.3e-15
WP_048638499.1|1181554_1182013_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_072065875.1|1182164_1182842_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_048639905.1|1183073_1183487_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_048638500.1|1183554_1183863_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_048638501.1|1184084_1184363_+	acylphosphatase	NA	NA	NA	NA	NA
WP_048638502.1|1184366_1184696_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_048638503.1|1184804_1185464_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	47.9	6.6e-43
>prophage 4
NZ_CP014137	Brenneria goodwinii strain FRB141 chromosome, complete genome	5360730	1906766	1915838	5360730	tRNA	Bacillus_phage(16.67%)	9	NA	NA
WP_095834158.1|1906766_1908485_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	2.3e-55
WP_009112984.1|1908598_1908895_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.1e-13
WP_095834159.1|1908899_1911287_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	3.5e-09
WP_048639026.1|1911302_1912286_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	8.4e-34
WP_121514181.1|1912466_1912511_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_048639027.1|1912666_1913023_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_048639028.1|1913066_1913264_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_072065893.1|1913363_1913906_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.5	6.3e-15
WP_095834160.1|1913909_1915838_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	8.5e-131
>prophage 5
NZ_CP014137	Brenneria goodwinii strain FRB141 chromosome, complete genome	5360730	5023965	5112539	5360730	tRNA,plate,protease,head,tail,transposase	Vibrio_phage(56.82%)	96	NA	NA
WP_095835501.1|5023965_5025105_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_095835502.1|5025249_5026755_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_048637376.1|5026775_5027258_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_095835503.1|5027254_5028934_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	2.5e-17
WP_095835504.1|5028983_5030930_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.3e-59
WP_048637379.1|5030922_5031864_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_048637380.1|5031977_5032274_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_095835505.1|5032366_5033647_+	GTPase HflX	NA	NA	NA	NA	NA
WP_095835506.1|5033738_5034998_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_048637383.1|5035001_5035991_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_048637384.1|5036317_5036518_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_048637385.1|5036617_5037916_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	35.6	1.2e-64
WP_095835507.1|5038121_5039507_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_095835508.1|5039675_5040680_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	1.8e-71
WP_048637388.1|5040751_5041171_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_048637389.1|5041170_5041734_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_048637390.1|5041837_5042797_-	glutathione synthase	NA	NA	NA	NA	NA
WP_048637391.1|5042808_5043543_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_095835509.1|5043830_5044529_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_048639787.1|5044627_5045140_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_048637393.1|5045263_5046415_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.4	3.5e-124
WP_183092072.1|5046965_5047124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048637394.1|5047116_5049096_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_082153020.1|5049156_5049777_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048637395.1|5050251_5051010_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_048637396.1|5051351_5053346_+	transketolase	NA	NA	NA	NA	NA
WP_048637397.1|5053714_5054803_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048637398.1|5054884_5056654_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_048637399.1|5056646_5057723_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	7.1e-26
WP_048637400.1|5058153_5059170_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_048637401.1|5059242_5060406_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_048637402.1|5060528_5061608_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_095835510.1|5061739_5062594_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_048637404.1|5062912_5063527_+	arginine exporter ArgO	NA	NA	NA	NA	NA
WP_072065835.1|5063690_5064416_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_048637406.1|5064427_5065321_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_121514205.1|5065585_5065804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835511.1|5065793_5065988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_183096787.1|5065984_5067634_-	hypothetical protein	NA	A0A0C4UQS2	Shigella_phage	40.3	4.3e-14
WP_095835512.1|5067646_5068528_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	46.1	7.3e-29
WP_095835513.1|5068527_5069283_-|tail	phage tail protein	tail	A0A0C4UQS2	Shigella_phage	41.7	1.4e-12
WP_095835514.1|5069285_5069870_-	YmfQ family protein	NA	A0A2I7S9L6	Vibrio_phage	48.7	4.6e-48
WP_095835515.1|5069854_5070928_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	53.1	1.2e-105
WP_095835516.1|5070917_5071367_-	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	45.4	1.4e-28
WP_095835517.1|5071363_5071903_-|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	41.9	3.1e-30
WP_183096790.1|5071893_5072919_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	49.7	3.1e-87
WP_095835519.1|5072968_5074228_-	DNA circularization N-terminal domain-containing protein	NA	M4M9N2	Vibrio_phage	42.1	9.0e-89
WP_095835520.1|5074227_5076009_-|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	32.2	2.9e-69
WP_095835521.1|5076107_5076491_-|tail	phage tail assembly protein	tail	C9DGP9	Escherichia_phage	45.0	1.2e-09
WP_095835522.1|5076493_5076844_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_095835523.1|5076853_5078332_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	56.0	7.4e-151
WP_095835524.1|5078334_5078523_-	DUF2635 domain-containing protein	NA	A0A2I7S9K4	Vibrio_phage	51.7	7.0e-06
WP_095835525.1|5078503_5079124_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	38.5	2.1e-35
WP_095835526.1|5079120_5079663_-	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	62.6	1.6e-58
WP_095835527.1|5079662_5080100_-	DUF1320 domain-containing protein	NA	M1PVU7	Vibrio_phage	57.2	1.7e-39
WP_147438986.1|5080096_5080573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835529.1|5080636_5081539_-|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	60.2	3.9e-102
WP_095835530.1|5081538_5082504_-	peptidase	NA	M1Q578	Vibrio_phage	50.8	1.2e-80
WP_095835531.1|5082716_5083559_-	hypothetical protein	NA	M1PVV7	Vibrio_phage	57.3	1.6e-89
WP_095835532.1|5083663_5084107_-	hypothetical protein	NA	M4MHH2	Vibrio_phage	39.7	1.6e-21
WP_095835533.1|5084330_5084645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835534.1|5084786_5086367_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	58.5	3.1e-171
WP_095835535.1|5086366_5087938_-	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	71.0	2.2e-185
WP_183096788.1|5087937_5088525_-	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	58.1	3.1e-52
WP_095835877.1|5088527_5088815_-	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	66.7	1.1e-26
WP_095835537.1|5088825_5089128_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_095835538.1|5089108_5089339_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_095835539.1|5089331_5089940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835540.1|5089927_5090302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835542.1|5090515_5091097_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	50.0	1.2e-43
WP_095835543.1|5091200_5091722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835544.1|5091731_5092127_-	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	63.2	1.6e-36
WP_095835545.1|5092116_5092647_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	40.7	1.7e-28
WP_095835546.1|5092643_5093174_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	38.2	1.6e-26
WP_095835547.1|5093260_5093455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835548.1|5093457_5094072_-	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	60.0	5.4e-63
WP_095835549.1|5094064_5094340_-	host nuclease inhibitor protein	NA	I6WB15	Burkholderia_virus	54.8	1.9e-15
WP_095835550.1|5094355_5094592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957990.1|5094593_5094845_-	host nuclease inhibitor protein	NA	A0A1C6ZDJ8	Pseudomonas_phage	40.6	9.3e-06
WP_095835551.1|5094850_5095048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835552.1|5095044_5096001_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	52.2	2.7e-85
WP_095835553.1|5096013_5098005_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2I7S9A8	Vibrio_phage	51.4	9.2e-197
WP_183096789.1|5098001_5098274_-	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	58.7	7.0e-15
WP_095835879.1|5098460_5099204_+	S24 family peptidase	NA	A0A2I7S9A5	Vibrio_phage	62.9	3.6e-45
WP_048639791.1|5099658_5100315_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_095835554.1|5100613_5101846_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	1.5e-104
WP_095835555.1|5101887_5102889_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_095835556.1|5103070_5104738_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	26.9	8.6e-39
WP_048637415.1|5105185_5107114_+	murein transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	38.1	4.8e-09
WP_095835557.1|5107184_5107532_+	trp operon repressor	NA	NA	NA	NA	NA
WP_048637417.1|5107528_5108065_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_095835558.1|5108117_5108768_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_048637419.1|5108776_5109649_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_048637420.1|5109894_5110362_+	protein CreA	NA	NA	NA	NA	NA
WP_048637421.1|5110450_5111167_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_048637422.1|5111852_5112539_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP014137	Brenneria goodwinii strain FRB141 chromosome, complete genome	5360730	5322602	5360697	5360730	capsid,tRNA,protease,lysis,head,tail,holin,integrase,portal,terminase	Enterobacteria_phage(29.73%)	53	5312327:5312341	5337521:5337535
5312327:5312341	attL	TCGACGAGAAAGTCG	NA	NA	NA	NA
WP_095835892.1|5322602_5323631_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_095835647.1|5323732_5324821_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	68.1	1.3e-144
WP_095835648.1|5324815_5325070_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	56.4	7.4e-19
WP_095835649.1|5325148_5325418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_183096780.1|5325407_5326394_-	hypothetical protein	NA	A0A2P1JUF9	Erwinia_phage	48.0	3.2e-17
WP_095835650.1|5326378_5326891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835651.1|5326887_5327127_-	DUF4060 family protein	NA	NA	NA	NA	NA
WP_095835652.1|5327167_5327383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835653.1|5327363_5328200_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.6	2.9e-75
WP_095835654.1|5328285_5329098_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_095835655.1|5329162_5329534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835656.1|5329767_5329983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957992.1|5330189_5330393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835657.1|5330433_5330742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835658.1|5331124_5331952_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	39.5	8.1e-38
WP_095835659.1|5332249_5332960_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	67.6	1.2e-85
WP_095835660.1|5333065_5333272_+	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	55.7	3.3e-09
WP_095835661.1|5333331_5333862_+	DNA-binding protein	NA	S5FXP0	Shigella_phage	56.1	6.1e-47
WP_095835662.1|5333916_5334216_+	hypothetical protein	NA	A0A0N7BYT1	Escherichia_phage	54.2	3.7e-17
WP_095835663.1|5334398_5335937_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	65.1	6.0e-204
WP_095835664.1|5335933_5336899_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	62.6	3.3e-115
WP_095835665.1|5336895_5337906_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	46.4	1.8e-79
5337521:5337535	attR	TCGACGAGAAAGTCG	NA	NA	NA	NA
WP_095835666.1|5337898_5338294_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	57.9	7.5e-34
WP_095835667.1|5338537_5339590_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	68.2	1.3e-141
WP_095835668.1|5339612_5339897_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	63.6	2.1e-22
WP_095835669.1|5339896_5340175_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	59.8	4.0e-26
WP_095835670.1|5340332_5340587_+|holin	phage holin family protein	holin	K7P6H9	Enterobacteria_phage	63.5	8.0e-21
WP_095835671.1|5340583_5341141_+	lysozyme	NA	Q71TF3	Escherichia_phage	66.1	1.6e-66
WP_095835672.1|5341119_5341548_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	52.4	1.8e-28
WP_095835673.1|5341602_5342040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095835674.1|5342099_5342441_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	75.2	6.7e-47
WP_095835675.1|5342586_5343042_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	59.5	1.3e-29
WP_095835676.1|5343044_5344763_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	65.2	2.4e-225
WP_095835678.1|5344973_5346224_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	81.8	2.7e-194
WP_095835679.1|5346198_5346852_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	82.2	1.5e-100
WP_095835680.1|5346865_5348071_+|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	79.6	1.7e-166
WP_145957993.1|5348107_5348359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095835681.1|5348391_5348712_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	44.6	1.1e-19
WP_095835682.1|5348708_5349050_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	5.3e-36
WP_095835683.1|5349042_5349492_+	HK97 gp10 family phage protein	NA	K7PH04	Enterobacteria_phage	86.6	1.9e-65
WP_095835684.1|5349488_5349836_+	DUF3168 domain-containing protein	NA	K7P7Q9	Enterobacteria_phage	54.5	9.8e-30
WP_095833815.1|5349896_5350337_+|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	77.8	4.6e-56
WP_095833816.1|5350386_5350773_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	49.2	1.1e-24
WP_095833817.1|5350796_5351066_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	62.9	1.0e-21
WP_145957994.1|5351147_5351552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095835685.1|5351613_5354922_+	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	28.9	3.8e-62
WP_095833210.1|5354956_5355163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095833211.1|5355165_5355369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957947.1|5355385_5355607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095833213.1|5355784_5356381_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	62.9	8.0e-72
WP_095833214.1|5356380_5356965_+	hypothetical protein	NA	S4TND4	Salmonella_phage	69.6	1.1e-76
WP_095833215.1|5356972_5357371_+	hypothetical protein	NA	S4TR39	Salmonella_phage	61.8	2.6e-42
WP_095835686.1|5357370_5360697_+	hypothetical protein	NA	S4TTF5	Salmonella_phage	56.1	9.0e-221
