The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023185	Klebsiella michiganensis strain K518 chromosome, complete genome	6138996	1006	70879	6138996	head,holin,integrase,portal,protease,terminase,tail,capsid	Salmonella_phage(23.08%)	89	14449:14508	69517:69792
WP_014838123.1|1006_2389_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.4	7.5e-105
WP_038808205.1|2376_2835_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838122.1|2831_3743_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	75.2	9.8e-53
WP_023322342.1|3732_3912_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
WP_014838121.1|4084_4633_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	66.9	3.0e-65
WP_014838120.1|4713_5181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025714631.1|5414_5645_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	2.7e-12
WP_038808210.1|5742_6375_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	6.0e-33
WP_087855718.1|6647_7163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838118.1|7979_8351_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.5	4.8e-51
WP_014838117.1|8403_9234_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	82.4	9.3e-127
WP_042934058.1|9369_9897_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	70.9	9.3e-64
WP_023343167.1|9896_10097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838115.1|10089_10875_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	4.5e-62
WP_042934057.1|11002_11347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934056.1|11774_12002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838111.1|11998_12550_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	46.0	7.0e-30
WP_040235764.1|12542_12779_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.9e-09
WP_008806034.1|13079_13316_+	excisionase	NA	NA	NA	NA	NA
WP_008806033.1|13305_14448_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	81.9	1.2e-172
14449:14508	attL	TCTTCAATCAGTTTTGGGGAAGAATTTTGGGGAAGTTTTGGGGAAGCCTCCGCACACTCC	NA	NA	NA	NA
WP_095762634.1|14560_14743_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.8e-20
WP_042934078.1|14966_15380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157698320.1|16198_16867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838159.1|16851_17958_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014838158.1|18199_19465_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.6	1.8e-209
WP_042934076.1|19467_19887_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.2e-34
WP_014838156.1|19964_20207_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	82.3	7.3e-32
WP_031592310.1|20206_20449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838155.1|20578_21127_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	89.5	1.8e-86
WP_042934074.1|22990_23248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934075.1|23283_23556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157738576.1|23565_26013_-	hypothetical protein	NA	A0A1U9ZA50	Proteus_phage	37.9	5.4e-13
WP_014838152.1|26077_29161_-	kinase	NA	A0A286S259	Klebsiella_phage	69.3	0.0e+00
WP_042934072.1|29157_29538_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.0	1.2e-57
WP_014838151.1|29547_30033_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.2	2.3e-53
WP_042934071.1|30019_30493_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.2	3.2e-55
WP_014838149.1|30513_34119_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	55.4	4.7e-207
WP_071886327.1|34178_34520_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	46.8	5.7e-06
WP_042934070.1|34574_34880_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.0	2.8e-28
WP_014838147.1|34882_35287_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.0	2.1e-31
WP_014838146.1|35317_36028_-|tail	tail protein	tail	K7PHL2	Enterobacterial_phage	69.5	9.9e-85
WP_014838145.1|36084_36432_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	58.4	1.5e-30
WP_014838144.1|36428_36878_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	5.1e-63
WP_042934069.1|36874_37213_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	66.1	2.1e-37
WP_032734570.1|37225_37558_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_014838142.1|37563_37818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838141.1|37863_39084_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.8	1.2e-141
WP_014838140.1|39093_39801_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	6.4e-68
WP_042934068.1|39776_41096_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	59.3	1.2e-139
WP_077253184.1|41102_42839_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.9	1.1e-137
WP_014838137.1|42792_43257_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	6.3e-48
WP_014838136.1|43374_43716_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	1.3e-47
WP_014838135.1|44039_44285_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	2.3e-17
WP_014838134.1|44834_45110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934066.1|45106_45454_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.0	4.0e-39
WP_014838132.1|45450_45990_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	2.6e-101
WP_042934065.1|46079_46358_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	77.8	1.4e-34
WP_042934064.1|46347_46737_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	78.1	1.2e-47
WP_014838130.1|46997_47147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130951362.1|47800_48379_-	SocA family protein	NA	A0A088CD78	Shigella_phage	62.5	6.3e-05
WP_014838128.1|48800_49853_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.9	2.8e-168
WP_023343183.1|50002_50194_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	81.0	2.1e-21
WP_042934063.1|50403_51234_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	47.2	1.7e-59
WP_014838127.1|51252_52239_-	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	48.9	1.5e-91
WP_049824822.1|52320_53142_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	1.8e-90
WP_042934062.1|53231_53630_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	70.6	1.2e-44
WP_014838125.1|53626_54103_-|protease	SOS-response repressor and protease LexA	protease	NA	NA	NA	NA
WP_042934060.1|54099_56082_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.1	4.4e-199
WP_014838123.1|56074_57457_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.4	7.5e-105
WP_038808205.1|57444_57903_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838122.1|57899_58811_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	75.2	9.8e-53
WP_023322342.1|58800_58980_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
WP_014838121.1|59152_59701_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	66.9	3.0e-65
WP_014838120.1|59781_60249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025714631.1|60482_60713_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	2.7e-12
WP_038808210.1|60810_61443_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	6.0e-33
WP_087855718.1|61715_62231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838118.1|63047_63419_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.5	4.8e-51
WP_014838117.1|63471_64302_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	82.4	9.3e-127
WP_042934058.1|64437_64965_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	70.9	9.3e-64
WP_023343167.1|64964_65165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838115.1|65157_65943_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	4.5e-62
WP_042934057.1|66070_66415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934056.1|66842_67070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838111.1|67066_67618_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	46.0	7.0e-30
WP_040235764.1|67610_67847_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.9e-09
WP_008806034.1|68147_68384_+	excisionase	NA	NA	NA	NA	NA
WP_008806033.1|68373_69516_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	81.9	1.2e-172
WP_014228876.1|69628_70879_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
69517:69792	attR	TCTTCAATCAGTTTTGGGGAAGAATTTTGGGGAAGTTTTGGGGAAGCCTCCGCACACTCCAAAAAAAACGGGAGCCCATCGGCTCCCGCTTTTACTTAATCCACCAACGGGATTACATGTTCGCGATAATCGCGTCGCCAAACTCGCTACATTTCAGTAGTTTAGCGCCTTCCATCAGACGTTCGAAGTCATAGGTCACGGTCTTGGCGGCGATAGCGCCTTCCATGCCTTTGACGATCAGGTCTGCGGCTTCGAACCACTGCATATGGCGCAGCA	NA	NA	NA	NA
>prophage 2
NZ_CP023185	Klebsiella michiganensis strain K518 chromosome, complete genome	6138996	500791	538060	6138996	integrase,transposase	Escherichia_phage(47.06%)	36	504767:504783	529474:529490
WP_004849345.1|500791_501550_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	2.0e-11
WP_038423245.1|501578_502781_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	2.7e-95
WP_042934048.1|503240_503657_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	48.4	1.2e-26
WP_001067855.1|504012_504717_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
504767:504783	attL	TTTGCAACAGTGCCGCC	NA	NA	NA	NA
WP_000027057.1|505301_506162_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|506311_506713_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|506759_507464_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000656305.1|510251_510629_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|510829_511489_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000429836.1|512571_513006_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|513077_513428_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732293.1|513441_513717_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|513752_514175_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|514226_515921_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|515938_516301_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|516297_516534_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|516530_517238_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|518462_519167_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|519288_520194_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|520190_521429_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|521428_522013_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|522505_523270_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|523496_523802_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|523812_525018_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|525173_525377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|525504_526344_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|526337_526685_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|526890_527679_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|527809_528283_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_000845048.1|528440_529454_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067858.1|529528_530233_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
529474:529490	attR	GGCGGCACTGTTGCAAA	NA	NA	NA	NA
WP_009654380.1|531149_531302_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	77.6	6.9e-12
WP_042928472.1|531383_531689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837925.1|531692_534167_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	86.2	0.0e+00
WP_014837924.1|534170_535979_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	70.9	2.2e-237
WP_042934310.1|535975_538060_-	lytic transglycosylase domain-containing protein	NA	T1SBJ1	Salmonella_phage	48.1	1.6e-106
>prophage 3
NZ_CP023185	Klebsiella michiganensis strain K518 chromosome, complete genome	6138996	546167	565309	6138996	holin,terminase	Klebsiella_phage(27.78%)	30	NA	NA
WP_014837913.1|546167_547739_-	hypothetical protein	NA	A0A1B1ITN4	uncultured_Mediterranean_phage	29.7	5.6e-56
WP_014837912.1|547780_548002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837911.1|548002_549595_-|terminase	phage terminase	terminase	Q775B9	Bordetella_phage	40.4	8.7e-97
WP_014837910.1|549596_550568_-|terminase	terminase small subunit	terminase	Q6J1S5	Burkholderia_virus	38.5	5.6e-30
WP_042934307.1|550571_550943_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	76.3	2.4e-50
WP_014837909.1|551009_551210_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	1.0e-18
WP_014228564.1|551360_551546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837908.1|551670_551964_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	73.2	4.0e-32
WP_014837907.1|552102_552387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837906.1|552622_552898_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	35.6	3.0e-05
WP_014837905.1|552894_553239_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	82.5	4.5e-43
WP_004849279.1|553235_553778_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	76.4	2.0e-77
WP_031280382.1|553774_554074_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_025108063.1|554786_555395_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	60.2	1.5e-70
WP_089046440.1|555391_555532_-	YlcG family protein	NA	NA	NA	NA	NA
WP_014837903.1|555528_557511_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	51.9	2.8e-193
WP_014837902.1|557503_558400_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	73.4	7.7e-127
WP_025108065.1|558396_558990_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	48.5	3.9e-42
WP_014837900.1|559156_559339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004111726.1|560118_560412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029946971.1|560849_561068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837897.1|561127_561385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009653780.1|561397_562474_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	42.6	4.7e-30
WP_071886321.1|562470_562725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009653775.1|562738_563164_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_009653783.1|563147_563375_-	transcriptional regulator	NA	K7PHK4	Enterobacteria_phage	44.3	1.4e-08
WP_025108070.1|563454_563859_+	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	54.9	1.2e-13
WP_025108072.1|564449_564743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123828190.1|564808_565042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064404689.1|565084_565309_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	58.1	6.8e-16
>prophage 4
NZ_CP023185	Klebsiella michiganensis strain K518 chromosome, complete genome	6138996	1046592	1112636	6138996	holin,integrase,tRNA,terminase,tail	Salmonella_phage(20.29%)	88	1042149:1042163	1109466:1109480
1042149:1042163	attL	CCCTACAGGATTCGA	NA	NA	NA	NA
WP_014837694.1|1046592_1049583_-|tail	phage tail length tape-measure protein 1	tail	F1C5E9	Cronobacter_phage	33.3	1.1e-73
WP_004213174.1|1049590_1049917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837693.1|1050253_1051393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837692.1|1051858_1052044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837691.1|1052177_1052504_-	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	77.7	1.8e-33
WP_042934035.1|1053032_1053131_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_107326859.1|1053423_1054242_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	48.0	3.6e-38
WP_014837689.1|1054273_1055251_-	helix-turn-helix domain-containing protein	NA	F1C596	Cronobacter_phage	56.7	1.1e-83
WP_071886316.1|1055271_1055715_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_089046430.1|1055898_1058655_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	55.3	3.7e-289
WP_014837686.1|1058647_1058998_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	68.2	8.9e-39
WP_042934034.1|1059007_1059634_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.5	1.4e-26
WP_042934033.1|1059630_1059840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934032.1|1059836_1060340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837682.1|1060336_1061296_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.8e-07
WP_014837681.1|1061292_1061472_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_042934031.1|1061471_1062074_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	55.3	1.2e-51
WP_042934030.1|1062087_1062519_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.2	5.3e-25
WP_029602956.1|1062518_1062731_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	47.2	3.2e-07
WP_014837677.1|1062842_1063775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934029.1|1063918_1065133_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	52.8	2.6e-125
WP_042934028.1|1065478_1065799_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.0	7.7e-21
WP_009308066.1|1066162_1066420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934027.1|1068738_1069317_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	50.3	2.1e-48
WP_042934026.1|1069316_1070102_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.3	1.4e-26
WP_042934025.1|1070101_1070875_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	50.2	3.8e-66
WP_089046429.1|1070871_1072071_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	74.7	2.9e-161
WP_014837671.1|1072070_1072424_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	78.6	3.3e-49
WP_014837670.1|1072420_1073077_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	58.0	1.6e-68
WP_071886315.1|1073124_1073490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837669.1|1073495_1073729_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	51.3	2.9e-17
WP_014837668.1|1073829_1074861_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.4	6.6e-98
WP_014837667.1|1074863_1075166_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	55.0	2.3e-27
WP_042934023.1|1075166_1075757_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	64.1	5.9e-59
WP_014837665.1|1075756_1077682_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	73.5	1.1e-189
WP_004152565.1|1077671_1077824_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_014837664.1|1077859_1078285_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	64.2	1.5e-40
WP_004199809.1|1078288_1078729_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_014837663.1|1078739_1079885_-	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.6	1.9e-162
WP_014837662.1|1079888_1080329_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	52.4	3.0e-39
WP_014837661.1|1080423_1080810_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	76.6	2.6e-47
WP_014837660.1|1080809_1081310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934022.1|1081309_1081726_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	1.4e-38
WP_014837658.1|1081694_1081955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837657.1|1082000_1082942_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	76.8	5.4e-139
WP_014837656.1|1082953_1083448_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	64.4	4.2e-50
WP_014837655.1|1083459_1084659_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.6	9.4e-104
WP_042934020.1|1084920_1085469_-	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	54.6	2.6e-48
WP_042934019.1|1085524_1086976_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.1	2.5e-191
WP_014837651.1|1087213_1088614_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.8	2.3e-186
WP_042934018.1|1088564_1089341_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	62.3	3.5e-11
WP_019705419.1|1089544_1089760_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	54.3	2.0e-12
WP_014837648.1|1090012_1090555_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	78.1	3.1e-78
WP_031280382.1|1090551_1090851_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_042934016.1|1091665_1092163_-	antiterminator	NA	G8C7V7	Escherichia_phage	92.7	1.9e-87
WP_014837646.1|1092159_1092300_-	YlcG family protein	NA	NA	NA	NA	NA
WP_042934015.1|1092296_1092878_-	protein ninG	NA	E7C9S3	Salmonella_phage	49.8	2.1e-40
WP_014837644.1|1092870_1093542_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	71.6	7.3e-98
WP_004243010.1|1093538_1093706_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_014837643.1|1093686_1094154_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.2	9.8e-33
WP_014837641.1|1094407_1094596_-	hypothetical protein	NA	R9TNE4	Aeromonas_phage	80.0	1.0e-20
WP_014837640.1|1095401_1095914_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	74.9	6.2e-73
WP_042934014.1|1096724_1097000_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	76.2	3.5e-30
WP_014837636.1|1096996_1097437_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.8	4.9e-10
WP_014837634.1|1097735_1098512_-	Origin specific replication-binding factor	NA	A0A193GYX1	Enterobacter_phage	65.4	3.0e-95
WP_042934285.1|1098508_1099237_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	1.6e-37
WP_004141720.1|1099371_1099692_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_004178811.1|1099731_1099965_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_024622727.1|1100069_1100759_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_014837632.1|1100781_1100901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038989577.1|1101050_1101593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038989578.1|1101580_1102357_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_008807814.1|1103023_1103230_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_014837629.1|1103309_1104281_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	91.0	1.8e-65
WP_042934013.1|1104288_1104573_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	2.3e-29
WP_020804996.1|1104814_1105318_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	29.5	6.0e-12
WP_040218321.1|1105314_1105938_+	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	48.1	1.3e-45
WP_071886314.1|1105934_1106093_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.0	8.7e-10
WP_014837628.1|1106089_1106617_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	5.5e-56
WP_014837627.1|1106613_1107381_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.2	1.4e-65
WP_023304908.1|1107377_1107596_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.6e-09
WP_032419565.1|1107597_1107816_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	58.6	3.3e-15
WP_042934012.1|1107815_1108055_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	3.9e-09
WP_004223135.1|1108067_1108403_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_014837625.1|1108279_1109443_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.8	3.3e-202
WP_004099791.1|1109875_1110742_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
1109466:1109480	attR	CCCTACAGGATTCGA	NA	NA	NA	NA
WP_004099787.1|1110743_1110956_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_089046428.1|1111250_1112636_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
>prophage 5
NZ_CP023185	Klebsiella michiganensis strain K518 chromosome, complete genome	6138996	1359528	1369464	6138996	integrase	Enterobacteria_phage(100.0%)	10	1351902:1351918	1368575:1368591
1351902:1351918	attL	CAGCACCATAAACAGCG	NA	NA	NA	NA
WP_014837523.1|1359528_1360698_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.5	1.4e-141
WP_095762635.1|1360698_1362198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934000.1|1362236_1363016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837520.1|1363651_1364218_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.1e-57
WP_014837519.1|1364235_1364481_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
WP_089046423.1|1364477_1365215_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	4.9e-71
WP_089046422.1|1366029_1366578_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	67.6	3.1e-30
WP_014837516.1|1366574_1366802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837515.1|1366798_1367119_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_014837514.1|1367130_1369464_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.1	0.0e+00
1368575:1368591	attR	CGCTGTTTATGGTGCTG	NA	NA	NA	NA
>prophage 6
NZ_CP023185	Klebsiella michiganensis strain K518 chromosome, complete genome	6138996	1939307	1975779	6138996	protease,transposase	Salmonella_phage(40.0%)	27	NA	NA
WP_014839937.1|1939307_1940276_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.2	2.6e-181
WP_071846184.1|1940960_1941023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125295935.1|1941877_1942534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122117646.1|1943565_1943913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837258.1|1943799_1944117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071886350.1|1945522_1945855_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_014837255.1|1945841_1946222_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_014837254.1|1946228_1947842_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	37.4	1.5e-83
WP_103433584.1|1948072_1948288_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014837253.1|1948422_1949367_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014837252.1|1949363_1950182_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.0	1.8e-13
WP_074075383.1|1950186_1950849_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_042933959.1|1950845_1951517_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_074075384.1|1951540_1952389_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014837246.1|1952545_1953499_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014837245.1|1953585_1954803_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_122117645.1|1955202_1955490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077253179.1|1955798_1956767_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	2.3e-185
WP_089046459.1|1957392_1957995_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_014837242.1|1957991_1958594_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_014837241.1|1958605_1962247_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_065810012.1|1962292_1965907_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_077253178.1|1966095_1968693_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_014837239.1|1968703_1970788_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_014837237.1|1972022_1973546_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.4	9.6e-45
WP_089046404.1|1973869_1974211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031967.1|1974810_1975779_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP023185	Klebsiella michiganensis strain K518 chromosome, complete genome	6138996	3955284	3962460	6138996		Enterobacteria_phage(83.33%)	8	NA	NA
WP_014839253.1|3955284_3956184_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	86.3	1.4e-147
WP_089046387.1|3956647_3958990_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.3	0.0e+00
WP_002889897.1|3959004_3959325_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004185275.1|3959321_3959549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089046386.1|3959545_3960094_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	67.6	5.9e-29
WP_014839248.1|3960896_3961634_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.8	2.6e-72
WP_014839247.1|3961630_3961876_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	55.6	2.7e-18
WP_014839246.1|3961893_3962460_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
>prophage 8
NZ_CP023185	Klebsiella michiganensis strain K518 chromosome, complete genome	6138996	4275724	4347862	6138996	plate,holin,integrase,protease,transposase	Pseudomonas_phage(13.33%)	58	4271038:4271055	4303890:4303907
4271038:4271055	attL	CTGCTGGGCGGCGCGGTG	NA	NA	NA	NA
WP_014839116.1|4275724_4276276_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
WP_014839114.1|4276701_4277238_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014230248.1|4277300_4277963_+	molecular chaperone	NA	NA	NA	NA	NA
WP_014230247.1|4277993_4280543_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_014839113.1|4280562_4281594_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014839112.1|4281606_4282116_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_014839111.1|4282149_4282680_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014839110.1|4282726_4283647_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_004852808.1|4283831_4284293_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014839109.1|4284390_4285686_+	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_014839108.1|4285763_4287434_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_014839107.1|4287430_4288189_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_004123101.1|4288203_4289061_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_014839106.1|4289060_4290026_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_014839105.1|4290022_4291414_+	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_014839104.1|4291390_4292014_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_014230236.1|4292119_4293640_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_014839103.1|4293651_4294083_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_014230234.1|4294098_4295079_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014230233.1|4295213_4295888_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_014230232.1|4295874_4297290_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_014839102.1|4297281_4297707_-	nucleoside triphosphatase NudI	NA	NA	NA	NA	NA
WP_014839101.1|4297844_4298825_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.7	1.8e-73
WP_014230229.1|4298873_4300322_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
WP_004123076.1|4300591_4301134_+	membrane protein	NA	NA	NA	NA	NA
WP_014230228.1|4301230_4302427_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_004852774.1|4302631_4303414_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839100.1|4303427_4304633_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.8e-25
4303890:4303907	attR	CTGCTGGGCGGCGCGGTG	NA	NA	NA	NA
WP_004852770.1|4304685_4305975_+	MFS transporter	NA	NA	NA	NA	NA
WP_014839099.1|4305989_4306793_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_014839098.1|4306815_4307994_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_014839097.1|4307990_4309250_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_014230223.1|4309239_4310862_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_014230222.1|4311133_4312480_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_014230221.1|4312489_4313557_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
WP_014230220.1|4313561_4314518_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230219.1|4314562_4316107_-|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	28.3	3.0e-38
WP_004104002.1|4316299_4316554_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
WP_004852757.1|4316553_4317684_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	7.3e-175
WP_014839096.1|4317787_4320073_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	3.5e-285
WP_014839095.1|4320417_4321146_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_014839094.1|4321331_4323965_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	6.2e-92
WP_014839093.1|4324095_4326942_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	7.5e-43
WP_004103995.1|4326986_4327637_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_014230215.1|4327653_4330314_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_014230214.1|4331085_4332204_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.5	1.9e-119
WP_014230213.1|4332306_4333359_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_014839092.1|4333431_4334496_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
WP_014839091.1|4334495_4335146_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_014230210.1|4335222_4336866_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.6	1.2e-08
WP_014230209.1|4337034_4338471_+	magnesium transporter	NA	NA	NA	NA	NA
WP_014230208.1|4338433_4339681_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.3	9.5e-67
WP_014230207.1|4339960_4341595_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_014230206.1|4341639_4342131_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_009653963.1|4342333_4343440_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014230205.1|4344421_4344919_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_014230204.1|4344955_4346506_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_014839089.1|4346524_4347862_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 9
NZ_CP023185	Klebsiella michiganensis strain K518 chromosome, complete genome	6138996	4452100	4541043	6138996	head,plate,holin,integrase,portal,coat,tRNA,terminase,transposase,lysis,tail,capsid	Escherichia_phage(32.65%)	85	4503983:4504005	4536938:4536960
WP_038424974.1|4452100_4454134_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.5	8.0e-55
WP_004103811.1|4454285_4455395_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_025107803.1|4455742_4456072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004852605.1|4456126_4456444_-	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
WP_014839036.1|4456613_4457534_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004852602.1|4457813_4459157_-	NCS2 family permease	NA	NA	NA	NA	NA
WP_014839035.1|4459159_4460971_-	adenine deaminase	NA	NA	NA	NA	NA
WP_014230124.1|4461070_4462006_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230123.1|4462059_4462482_-	universal stress protein	NA	NA	NA	NA	NA
WP_014839034.1|4462597_4464574_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.6	1.1e-160
WP_014839948.1|4465779_4466748_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	6.5e-172
WP_071598686.1|4467520_4467784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839032.1|4467815_4468769_+	hypothetical protein	NA	A0A1B1ITH5	uncultured_Mediterranean_phage	30.4	2.9e-31
WP_014839030.1|4469331_4469574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020244642.1|4469724_4470186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020244643.1|4470542_4471121_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	35.9	1.8e-15
WP_001339197.1|4471182_4472391_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_020244644.1|4472557_4473844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839027.1|4474915_4475419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020244646.1|4476855_4477563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839026.1|4477900_4478674_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_004852589.1|4478670_4479471_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_004122693.1|4479527_4480274_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839025.1|4480247_4481204_-	sugar kinase	NA	NA	NA	NA	NA
WP_014839024.1|4481200_4482205_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	26.3	5.4e-12
WP_014230119.1|4482201_4483485_-	MFS transporter	NA	NA	NA	NA	NA
WP_004852587.1|4483734_4484787_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_014839022.1|4484881_4486489_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_014230117.1|4486519_4487248_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_042934137.1|4487527_4488529_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014839020.1|4488543_4489485_-	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_014839019.1|4489691_4491059_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	28.0	4.7e-43
WP_014839018.1|4491068_4492532_+	xylulokinase	NA	NA	NA	NA	NA
WP_004852573.1|4492601_4493879_+	MFS transporter	NA	NA	NA	NA	NA
WP_014839017.1|4493927_4494590_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_042934136.1|4494889_4496044_+	mandelate racemase	NA	NA	NA	NA	NA
WP_014839014.1|4496163_4497786_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014839013.1|4497782_4498820_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014230107.1|4498816_4499722_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014230106.1|4499693_4500557_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.9e-11
WP_014230105.1|4500567_4501341_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
WP_038423091.1|4501757_4502558_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230103.1|4502544_4503015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654032.1|4503015_4503909_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
4503983:4504005	attL	AAAAAAATAAGCCCGCGTAAGGG	NA	NA	NA	NA
WP_014839012.1|4504089_4505103_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	82.5	4.0e-164
WP_016831471.1|4505217_4505517_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	69.7	5.7e-34
WP_016831472.1|4505639_4505915_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	85.7	4.0e-42
WP_042934135.1|4506084_4506585_+	hypothetical protein	NA	M1SV55	Escherichia_phage	86.1	6.1e-81
WP_014839010.1|4506649_4506865_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_014839009.1|4506881_4507157_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	61.5	1.5e-25
WP_049824829.1|4507146_4509435_+	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	74.3	0.0e+00
WP_089046381.1|4509816_4510857_-	Fic family protein	NA	S4TP71	Salmonella_phage	80.3	7.0e-164
WP_014839007.1|4510989_4511421_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	90.2	1.1e-67
WP_014839006.1|4512127_4513171_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.4	5.2e-167
WP_014839005.1|4513170_4514940_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.8	3.7e-306
WP_014839004.1|4515105_4515960_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	79.6	2.8e-126
WP_014839003.1|4516033_4517092_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	81.8	1.5e-161
WP_014839002.1|4517095_4517839_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.1	1.6e-98
WP_014839001.1|4517935_4518442_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	82.8	7.8e-60
WP_014839000.1|4518441_4518645_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	80.6	4.2e-25
WP_004175164.1|4518649_4518940_+|holin	holin	holin	O80308	Escherichia_phage	84.7	1.2e-36
WP_014838999.1|4518926_4519424_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	85.5	1.1e-79
WP_014838998.1|4519420_4519852_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	65.5	9.0e-41
WP_014838996.1|4519947_4520415_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	2.4e-63
WP_014838995.1|4520407_4520857_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.7	2.5e-49
WP_042934133.1|4521057_4521978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838993.1|4522020_4522977_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_042934132.1|4523375_4524017_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.0	1.7e-91
WP_014838991.1|4524013_4524361_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	8.3e-45
WP_014838990.1|4524365_4525274_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.5	1.1e-112
WP_014838989.1|4525281_4525863_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	54.6	3.6e-53
WP_042934131.1|4525942_4527892_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	50.9	3.9e-06
WP_014838987.1|4527901_4529020_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	5.8e-55
WP_089046380.1|4529071_4530145_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.0	8.6e-40
WP_014838985.1|4530255_4531437_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	3.9e-195
WP_014838984.1|4531450_4531966_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	76.2	8.5e-70
WP_014838983.1|4532026_4532302_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.7	3.2e-31
WP_014838982.1|4532334_4532454_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	2.6e-14
WP_014838981.1|4532446_4534885_+|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	74.9	1.4e-308
WP_042934389.1|4534896_4535376_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	86.7	6.5e-64
WP_014838979.1|4535375_4536533_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	79.2	8.6e-171
WP_071886339.1|4536617_4536839_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	2.2e-27
WP_014230102.1|4537108_4538470_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	91.8	4.7e-200
4536938:4536960	attR	AAAAAAATAAGCCCGCGTAAGGG	NA	NA	NA	NA
WP_014230101.1|4538788_4539511_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_014838977.1|4539507_4541043_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	6.3e-28
>prophage 10
NZ_CP023185	Klebsiella michiganensis strain K518 chromosome, complete genome	6138996	4598910	4607489	6138996		Enterobacteria_phage(28.57%)	8	NA	NA
WP_014838945.1|4598910_4600317_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	4.3e-39
WP_014838944.1|4600529_4601594_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
WP_004122480.1|4601607_4602477_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.7	3.7e-110
WP_014230058.1|4602508_4603399_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	2.4e-27
WP_014230057.1|4603414_4603969_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	7.3e-51
WP_014838943.1|4604142_4605309_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	1.8e-112
WP_004138729.1|4605889_4606012_-	small membrane protein	NA	NA	NA	NA	NA
WP_014838941.1|4606484_4607489_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	2.3e-31
>prophage 11
NZ_CP023185	Klebsiella michiganensis strain K518 chromosome, complete genome	6138996	5120231	5171559	6138996	integrase,protease,plate	Escherichia_phage(40.0%)	41	5154347:5154363	5177723:5177739
WP_014838714.1|5120231_5121572_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014838713.1|5121568_5122258_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_014838711.1|5123883_5124375_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_089046371.1|5124661_5125027_+|protease	Clp protease	protease	NA	NA	NA	NA
WP_014838709.1|5125023_5127366_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.0	1.7e-03
WP_014838708.1|5127365_5128238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934109.1|5128262_5131382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838705.1|5132326_5133052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089046370.1|5133156_5133921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934367.1|5134025_5134766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838702.1|5135603_5138741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038424617.1|5138752_5139559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042945317.1|5139592_5140402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934107.1|5140435_5141236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032719381.1|5141269_5142070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934106.1|5142103_5142913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032719380.1|5142999_5144223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838699.1|5144219_5147690_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_071881737.1|5148179_5148458_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014838697.1|5148557_5150312_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_014229647.1|5150275_5151361_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_014838696.1|5151338_5151884_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_014838695.1|5152384_5153473_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014229644.1|5153544_5155314_+	iron ABC transporter permease	NA	NA	NA	NA	NA
5154347:5154363	attL	CGCTGGTGATGCTCCAG	NA	NA	NA	NA
WP_014838694.1|5155306_5156377_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	9.8e-28
WP_014838693.1|5156433_5157204_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_014838692.1|5157227_5158907_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_004851637.1|5158917_5159697_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_014229640.1|5159803_5160676_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
WP_004136705.1|5160704_5160917_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_014229639.1|5161680_5161851_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_004851627.1|5161881_5162022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838691.1|5162337_5163246_+	DUF535 family protein	NA	NA	NA	NA	NA
WP_014229637.1|5163360_5164032_-	cyclic nucleotide-binding protein	NA	NA	NA	NA	NA
WP_014838689.1|5164436_5164988_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
WP_014229635.1|5165025_5165553_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_042934104.1|5165598_5166600_-	fimbrial protein	NA	NA	NA	NA	NA
WP_089046369.1|5166615_5169186_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_014229632.1|5169245_5169935_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_014229631.1|5170035_5170554_-	fimbrial protein	NA	NA	NA	NA	NA
WP_014229630.1|5171010_5171559_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
5177723:5177739	attR	CTGGAGCATCACCAGCG	NA	NA	NA	NA
>prophage 12
NZ_CP023185	Klebsiella michiganensis strain K518 chromosome, complete genome	6138996	5830346	5892078	6138996	plate,holin,tRNA,protease,transposase	Enterobacteria_phage(22.22%)	62	NA	NA
WP_004112629.1|5830346_5831336_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
WP_014229134.1|5831461_5831902_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004101621.1|5831898_5832171_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_032693413.1|5832498_5832864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838315.1|5833090_5833633_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.9	4.0e-70
WP_032749344.1|5833640_5833913_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
WP_014838313.1|5833902_5834295_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	65.4	6.5e-38
WP_014229124.1|5834371_5834734_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	57.5	7.1e-31
WP_009653037.1|5835194_5835731_-	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
WP_014838312.1|5836365_5839893_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_009652979.1|5840250_5841357_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.4	4.9e-107
WP_004850325.1|5841510_5841723_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004850323.1|5841805_5842240_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_014229121.1|5842428_5842719_+	hypothetical protein	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
WP_042934342.1|5843097_5844036_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_014838310.1|5844847_5845783_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
WP_014229118.1|5845827_5847201_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
WP_004850311.1|5847684_5848668_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_042934083.1|5849011_5849632_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014838308.1|5850249_5850993_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.6	1.9e-14
WP_014838307.1|5851009_5852077_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014229114.1|5852149_5853415_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.4	1.0e-156
WP_004850301.1|5853414_5853837_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.2	2.6e-32
WP_014229113.1|5854124_5854319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004850297.1|5854475_5854667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838306.1|5854844_5855159_+	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_004850292.1|5855213_5855777_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_042934341.1|5855973_5856555_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_014838304.1|5856680_5857310_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071532263.1|5857679_5857868_-	cold-shock protein	NA	NA	NA	NA	NA
WP_042934340.1|5858706_5859732_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838302.1|5859926_5860757_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014838301.1|5860801_5861782_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_014838300.1|5861940_5862825_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838299.1|5862938_5863823_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229103.1|5863994_5865131_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014838298.1|5865339_5866461_+	MFS transporter	NA	NA	NA	NA	NA
WP_014838297.1|5866559_5866904_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_014838296.1|5867005_5867731_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	3.5e-45
WP_014838295.1|5867973_5868408_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004850270.1|5868404_5869124_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014838294.1|5869120_5870380_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014838293.1|5870381_5871104_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_014838292.1|5871100_5872324_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014229094.1|5872320_5872854_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_089046360.1|5872868_5873828_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_014838290.1|5873891_5875274_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001352368.1|5876141_5877350_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|5877715_5878921_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|5879364_5879685_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|5879677_5880064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|5880071_5880758_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001322387.1|5880735_5881362_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|5881440_5882646_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|5882758_5883352_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001339197.1|5883865_5885074_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_014838285.1|5885309_5886764_+	MFS transporter	NA	NA	NA	NA	NA
WP_014838284.1|5886818_5888498_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_014838283.1|5888660_5889995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838282.1|5890018_5890474_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032749377.1|5890475_5891015_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_014838280.1|5890992_5892078_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 1
NZ_CP023186	Klebsiella michiganensis strain K518 plasmid pK518_KPC, complete sequence	126846	6260	41742	126846	transposase	Salmonella_phage(15.79%)	32	NA	NA
WP_000427623.1|6260_7265_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100881.1|7342_10309_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|10383_10674_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|10670_11072_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|11061_11418_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|11672_11987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194048.1|12413_13595_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000509966.1|14254_14860_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_023307208.1|14954_17852_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_088903438.1|17848_18472_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.8	4.0e-21
WP_020314631.1|18906_19137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314635.1|19340_19586_+	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.1e-08
WP_020314636.1|19618_20032_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	2.1e-31
WP_020314652.1|20043_21318_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	1.3e-148
WP_020314634.1|21492_21720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644718.1|21764_22391_-	ParA family protein	NA	A0A2H4EW66	Aeromonas_phage	34.4	4.5e-25
WP_088903439.1|23295_23814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032635043.1|24066_24663_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.2	1.8e-23
WP_075606932.1|24768_27522_-	ABC transporter	NA	NA	NA	NA	NA
WP_100248964.1|27883_29049_-|transposase	IS3-like element ISKpn37 family transposase	transposase	Q716C2	Shigella_phage	48.0	1.3e-73
WP_088903440.1|29102_30299_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	41.9	4.6e-34
WP_075606933.1|30333_31767_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.8	8.3e-107
WP_020314642.1|32145_32766_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_088903441.1|32785_33049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314639.1|33173_34127_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_020804876.1|34123_34735_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_020314648.1|35052_35331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088903446.1|35368_35710_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001143760.1|35756_38762_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001217881.1|38924_39482_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_013213985.1|39604_40585_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_004199234.1|40860_41742_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
>prophage 1
NZ_CP023187	Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence	106579	62984	94984	106579	integrase,transposase	Escherichia_phage(25.0%)	26	92640:92661	97458:97479
WP_000019445.1|62984_63965_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_032160673.1|64408_65365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072920.1|66517_67177_-	endonuclease III	NA	NA	NA	NA	NA
WP_001183923.1|68726_69026_+	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_000376617.1|69109_69352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072921.1|69479_70319_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.5	2.9e-11
WP_015460530.1|70697_71663_-	TniQ family protein	NA	NA	NA	NA	NA
WP_015460531.1|71664_72597_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016479967.1|72593_73280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072922.1|73313_74075_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003149906.1|74817_76347_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000855769.1|76643_77489_+	RmtC family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_004201164.1|78046_78859_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|78862_79228_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|79232_79871_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|79881_80913_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|80917_81247_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|81440_81731_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|81786_83427_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_087728544.1|85077_86094_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_016479963.1|86225_86756_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_022652312.1|86759_87029_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_022652311.1|87884_88874_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
WP_089046468.1|90614_91734_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.0e-51
92640:92661	attL	GCTTATTCGCACCTTCCTTAGC	NA	NA	NA	NA
WP_016479957.1|92671_93994_+	GntP family transporter	NA	NA	NA	NA	NA
WP_008322208.1|94192_94984_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.4	1.4e-50
97458:97479	attR	GCTTATTCGCACCTTCCTTAGC	NA	NA	NA	NA
