The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022537	Streptococcus agalactiae strain 874391 chromosome, complete genome	2153937	36560	48624	2153937		Microbacterium_phage(14.29%)	8	NA	NA
WP_001042246.1|36560_40286_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.0	4.3e-38
WP_000220675.1|40519_41974_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_001291333.1|42001_43024_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.7	2.0e-62
WP_000685108.1|43190_43739_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	4.0e-25
WP_000780023.1|43761_44514_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_095725744.1|44533_46081_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.6	1.3e-76
WP_001045908.1|46273_47173_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
WP_000783413.1|47319_48624_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	1.7e-05
>prophage 2
NZ_CP022537	Streptococcus agalactiae strain 874391 chromosome, complete genome	2153937	102579	134838	2153937	head,tail,integrase,terminase,capsid,portal,protease	Streptococcus_phage(81.82%)	54	102482:102499	144977:144994
102482:102499	attL	TTTTTTGTTATAATATAA	NA	NA	NA	NA
WP_000570847.1|102579_103677_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	97.5	8.1e-203
WP_000742866.1|103849_104464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000095652.1|104595_105375_-	helix-turn-helix transcriptional regulator	NA	M1NS52	Streptococcus_phage	78.9	3.1e-108
WP_000364978.1|105735_106029_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1X9I661	Streptococcus_phage	76.7	1.0e-35
WP_001097075.1|106012_106183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104157.1|106240_106399_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	96.2	2.0e-22
WP_000219235.1|106429_106672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000880594.1|106657_107215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247539.1|107270_107480_+	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	97.1	8.2e-32
WP_000164462.1|107711_107918_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SFQ0	Streptococcus_phage	72.1	8.4e-21
WP_001156316.1|107971_108931_+	hypothetical protein	NA	A0A286QS27	Streptococcus_phage	55.8	1.6e-90
WP_000032141.1|108923_109433_+	ORF6C domain-containing protein	NA	J7KJY1	Streptococcus_phage	98.2	2.5e-82
WP_000627309.1|109465_109603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001867241.1|109729_109876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000651.1|109838_110147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016480517.1|110256_110514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047208982.1|110542_110767_+	hypothetical protein	NA	J7KBY5	Streptococcus_phage	78.4	1.4e-29
WP_000546751.1|110842_111601_+	replication initiator protein A	NA	A0A097PBE7	Streptococcus_pyogenes_phage	64.4	1.7e-71
WP_000600243.1|111587_112370_+	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	88.8	2.4e-132
WP_165694407.1|112360_112507_+	hypothetical protein	NA	J7KBQ4	Streptococcus_phage	89.4	3.7e-15
WP_000431575.1|112496_112772_+	hypothetical protein	NA	J7KJY6	Streptococcus_phage	84.6	3.1e-34
WP_047200442.1|112758_113013_+	hypothetical protein	NA	Q938N0	Temperate_phage	75.0	2.3e-28
WP_079398808.1|113014_113176_+	hypothetical protein	NA	J7KDI4	Streptococcus_phage	83.0	1.5e-17
WP_047200443.1|113177_113507_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	82.6	1.7e-44
WP_047200444.1|113509_114490_+	recombinase RecT	NA	J7KDK3	Streptococcus_phage	59.5	2.2e-103
WP_000474006.1|115443_115641_+	hypothetical protein	NA	J7KIX6	Streptococcus_phage	93.8	1.8e-25
WP_000143298.1|115630_116107_+	RusA family crossover junction endodeoxyribonuclease	NA	J7KBT1	Streptococcus_phage	98.2	1.3e-59
WP_047200446.1|116096_116444_+	hypothetical protein	NA	J7KK12	Streptococcus_phage	83.5	2.0e-51
WP_047200447.1|116455_116743_+	DUF1599 domain-containing protein	NA	J7KBY0	Streptococcus_phage	67.0	6.7e-24
WP_047200448.1|116726_117134_+	hypothetical protein	NA	A0A141E233	Streptococcus_phage	37.5	9.8e-13
WP_000564611.1|117257_117401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019154.1|117397_117919_+	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	44.0	1.1e-24
WP_000660740.1|117915_118182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142571.1|118573_119008_+	ArpU family phage encoded transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	94.4	3.2e-70
WP_000964195.1|119625_120003_-	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	41.3	1.5e-15
WP_001132272.1|120055_120241_-	type II toxin-antitoxin system HicA family toxin	NA	F0PIL1	Enterococcus_phage	61.3	3.5e-10
WP_001247766.1|120341_120677_+	HNH endonuclease	NA	J7KH36	Streptococcus_phage	94.6	5.3e-57
WP_000532791.1|120850_121318_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	88.4	1.3e-72
WP_000151569.1|121332_123087_+	hypothetical protein	NA	J7KKD1	Streptococcus_phage	94.3	0.0e+00
WP_095725745.1|123083_123263_+	hypothetical protein	NA	J7KK43	Streptococcus_phage	54.2	2.7e-07
WP_001042284.1|123246_123477_+	hypothetical protein	NA	A7J295	Streptococcus_phage	51.7	1.7e-06
WP_000007732.1|123483_124704_+|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	4.0e-187
WP_001124818.1|124681_125347_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.6	7.0e-93
WP_000459130.1|125370_126555_+|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	76.9	2.3e-163
WP_017285214.1|126568_126730_+	hypothetical protein	NA	J7KH04	Streptococcus_phage	100.0	8.6e-21
WP_000218659.1|126732_127035_+|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	90.0	5.5e-45
WP_095725746.1|127044_127371_+|head,tail	head-tail adaptor protein	head,tail	J7KJ42	Streptococcus_phage	81.4	2.5e-43
WP_000160228.1|127354_127732_+	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	83.2	6.6e-56
WP_000559944.1|127728_128154_+	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	93.6	1.5e-75
WP_000521118.1|128169_128793_+	hypothetical protein	NA	J7KKC8	Streptococcus_phage	93.7	7.5e-97
WP_000273027.1|128846_129167_+	hypothetical protein	NA	J7KK85	Streptococcus_phage	82.1	8.4e-44
WP_000264971.1|129196_129364_+	hypothetical protein	NA	J7KBS0	Streptococcus_phage	100.0	7.3e-23
WP_050977834.1|129376_133318_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	98.4	0.0e+00
WP_050977835.1|133314_134838_+|tail	phage tail family protein	tail	J7KH53	Streptococcus_phage	93.3	1.2e-281
144977:144994	attR	TTTTTTGTTATAATATAA	NA	NA	NA	NA
>prophage 3
NZ_CP022537	Streptococcus agalactiae strain 874391 chromosome, complete genome	2153937	138967	147031	2153937	holin	Streptococcus_phage(87.5%)	11	NA	NA
WP_000214867.1|138967_140959_+	hypothetical protein	NA	J7KC14	Streptococcus_phage	98.2	0.0e+00
WP_000404431.1|140972_141299_+	DUF1366 domain-containing protein	NA	J7KDI9	Streptococcus_phage	68.2	1.3e-31
WP_000698337.1|141273_141486_+	hypothetical protein	NA	J7KDP6	Streptococcus_phage	60.0	2.1e-14
WP_000215499.1|141498_141801_+	hypothetical protein	NA	X2KT07	Streptococcus_phage	59.6	2.2e-25
WP_000611524.1|141802_142057_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	96.4	1.6e-37
WP_000257233.1|142182_143517_+	1,4-beta-N-acetylmuramidase	NA	Q5MY96	Streptococcus_phage	93.0	1.4e-249
WP_000634505.1|143881_144394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000965649.1|144622_144805_+	hypothetical protein	NA	J7KIW4	Streptococcus_phage	83.1	1.7e-17
WP_000049277.1|145017_145710_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_000739666.1|145706_146459_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_001231504.1|146455_147031_+	N-acetylmuramoyl-L-alanine amidase	NA	H7BV84	unidentified_phage	31.4	4.2e-09
>prophage 4
NZ_CP022537	Streptococcus agalactiae strain 874391 chromosome, complete genome	2153937	547631	610374	2153937	protease,tRNA,transposase,integrase	Streptococcus_phage(33.33%)	62	573952:573969	621914:621931
WP_000882544.1|547631_549893_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.4	5.7e-126
WP_000443582.1|550190_550421_+	DUF1797 family protein	NA	NA	NA	NA	NA
WP_001011647.1|550561_551254_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000230129.1|551246_551981_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	1.1e-35
WP_001106849.1|552267_553962_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	43.3	7.7e-128
WP_000137498.1|554100_554955_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.2	1.5e-39
WP_000634982.1|554951_555788_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_001286946.1|555913_557254_+	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	32.0	2.0e-38
WP_001280898.1|557231_557447_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000256277.1|557446_558319_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_001041038.1|558311_559139_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_000747940.1|559125_559599_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000923611.1|559610_561269_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_000034835.1|561381_562218_+	DegV family protein	NA	NA	NA	NA	NA
WP_001035227.1|562210_563050_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_000806954.1|563024_563627_+	YpmS family protein	NA	NA	NA	NA	NA
WP_001284634.1|563729_564005_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	71.9	1.2e-25
WP_001290370.1|564201_564399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254068.1|564442_565375_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	43.4	1.9e-64
WP_001185383.1|565562_566798_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000285510.1|566816_568028_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000527081.1|568040_569276_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000200660.1|569260_570073_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_001003542.1|570144_571461_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.6	8.1e-24
WP_001209457.1|571524_571923_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_000910750.1|572266_574951_+	calcium-translocating P-type ATPase, PMCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.3	1.1e-70
573952:573969	attL	TATTATTGATGCAAATGA	NA	NA	NA	NA
WP_000064641.1|576007_577939_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_000351633.1|578028_579153_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011324939.1|579221_580319_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_001173889.1|580338_581031_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.1	1.3e-28
WP_000236202.1|581014_581944_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_088186184.1|582017_583362_+|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	7.4e-65
WP_001022577.1|583432_584143_-	thioesterase	NA	NA	NA	NA	NA
WP_001115859.1|584139_584838_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	64.9	1.5e-82
WP_000048142.1|585005_585770_+	(S)-acetoin forming diacetyl reductase	NA	V5L4T3	Hirudovirus	31.8	9.8e-06
WP_000458617.1|585877_588385_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	50.5	1.4e-218
WP_000221828.1|588470_589664_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_000038473.1|589684_591031_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	3.7e-56
WP_000167485.1|591070_591628_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_001031103.1|591624_592608_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000965178.1|592853_593267_-	OsmC family protein	NA	NA	NA	NA	NA
WP_001278845.1|593420_594311_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.1	7.4e-05
WP_001231102.1|594307_595282_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	78.8	9.8e-144
WP_000011316.1|595278_596190_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	65.7	1.4e-107
WP_000752455.1|596204_597602_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_001227397.1|597743_599264_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_000710757.1|599376_599637_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000583233.1|599745_600681_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_000189636.1|600947_601970_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_001162136.1|602028_602472_+	flavodoxin	NA	NA	NA	NA	NA
WP_000418127.1|602548_602824_+	chorismate mutase	NA	NA	NA	NA	NA
WP_000595706.1|602816_604013_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	3.6e-103
WP_001068667.1|604596_604944_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_071659971.1|605088_605703_-|integrase	site-specific integrase	integrase	F8HGP4	Streptococcus_phage	60.7	9.2e-55
WP_001872365.1|605705_605972_-	hypothetical protein	NA	Q77YW7	Streptococcus_phage	65.2	9.2e-20
WP_000640620.1|605971_606376_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001122304.1|606537_606738_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001865698.1|606759_607020_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.0	3.4e-11
WP_001867107.1|607145_607355_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.4	1.4e-15
WP_000508795.1|607527_607689_-	NINE protein	NA	NA	NA	NA	NA
WP_000594360.1|608430_609708_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000353149.1|609717_610374_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.2e-22
621914:621931	attR	TATTATTGATGCAAATGA	NA	NA	NA	NA
>prophage 5
NZ_CP022537	Streptococcus agalactiae strain 874391 chromosome, complete genome	2153937	671726	690980	2153937	integrase	Streptococcus_phage(100.0%)	21	688597:688611	697730:697744
WP_000420682.1|671726_672041_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_000985015.1|672056_672443_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000813488.1|672471_673857_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000879507.1|673859_674012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398284.1|674034_675240_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_001009056.1|675282_675504_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000342539.1|675620_676118_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_000506270.1|676092_676599_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_095725753.1|676582_679030_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	99.1	0.0e+00
WP_000804748.1|679032_681210_+	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_000769868.1|681206_682208_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_095725754.1|682204_683140_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	95.5	4.8e-164
WP_001791010.1|683393_683510_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691736.1|683525_685445_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
WP_076640876.1|685562_685730_+	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	2.5e-15
WP_057498846.1|685901_687275_+	tetracycline efflux MFS transporter Tet(L)	NA	NA	NA	NA	NA
WP_002387934.1|687589_687859_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-24
WP_005957428.1|688363_688789_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	98.6	1.4e-70
688597:688611	attL	TGATTTGTTGAGTGA	NA	NA	NA	NA
WP_001224508.1|688785_689016_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	88.2	2.6e-31
WP_000814510.1|689477_689681_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	95.5	9.8e-30
WP_053308415.1|689762_690980_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	94.6	5.4e-224
697730:697744	attR	TGATTTGTTGAGTGA	NA	NA	NA	NA
>prophage 6
NZ_CP022537	Streptococcus agalactiae strain 874391 chromosome, complete genome	2153937	1231803	1304061	2153937	protease,tRNA,transposase,integrase	Bacillus_phage(25.0%)	55	1268624:1268641	1312679:1312696
WP_001259482.1|1231803_1232514_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_000863793.1|1232603_1233392_-	esterase family protein	NA	NA	NA	NA	NA
WP_001280054.1|1233448_1235110_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000979970.1|1235406_1236168_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.3	3.1e-12
WP_000587301.1|1236167_1237031_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000790858.1|1237043_1238048_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000006716.1|1238406_1240062_+	fibronectin/fibrinogen-binding protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	2.3e-07
WP_000005481.1|1240115_1240835_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000140341.1|1240848_1242531_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_000934868.1|1242640_1243867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075588.1|1243856_1245047_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000796047.1|1245138_1245600_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000163512.1|1245589_1246072_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000403410.1|1246288_1249507_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_000134275.1|1249558_1250605_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.6	6.6e-69
WP_000139163.1|1250811_1251405_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_000676114.1|1251404_1252274_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.2	2.7e-100
WP_000716829.1|1252332_1253436_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000647415.1|1253444_1254233_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_000365673.1|1254222_1254906_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000221656.1|1255009_1255690_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	31.8	1.9e-08
WP_000365343.1|1255807_1256326_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.1	4.6e-31
WP_001247507.1|1256448_1259013_-	GBS Bsp-like repeat-containing protein	NA	NA	NA	NA	NA
WP_000622235.1|1259164_1261363_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	1.2e-72
WP_000124585.1|1261359_1262121_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000405388.1|1262122_1263052_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_000568320.1|1263093_1263741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000573351.1|1263733_1264972_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001226480.1|1265062_1265953_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_000239229.1|1266063_1266240_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_000823033.1|1267329_1271088_-	pullulanase	NA	NA	NA	NA	NA
1268624:1268641	attL	ATAGCTTTAGCTTCTTTA	NA	NA	NA	NA
WP_001205490.1|1271256_1271991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130587.1|1272005_1272590_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_000150951.1|1272686_1274093_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_000670189.1|1274139_1274742_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_000942623.1|1274911_1276693_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	25.0	2.1e-06
WP_088186184.1|1276749_1278095_-|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	7.4e-65
WP_001003955.1|1278169_1279951_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000567585.1|1280109_1280877_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000285045.1|1280935_1282276_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_000245056.1|1282375_1282792_-	VOC family protein	NA	NA	NA	NA	NA
WP_000582587.1|1282795_1283293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162278.1|1283514_1284111_+	Ltp family lipoprotein	NA	NA	NA	NA	NA
WP_088197863.1|1284299_1285404_+|transposase	IS3-like element ISSag2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.9	6.3e-70
WP_000754588.1|1287238_1289707_-	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_000755138.1|1289719_1290640_-	metal ABC transporter substrate-binding lipoprotein/laminin-binding adhesin Lmb	NA	NA	NA	NA	NA
WP_095725758.1|1290873_1292151_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_001227840.1|1292732_1296185_-	C5a peptidase ScpA/B	NA	A0A218KC60	Bacillus_phage	39.4	7.6e-05
WP_000453221.1|1296838_1298173_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_000584204.1|1298280_1298829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863581.1|1298925_1299156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102864.1|1299224_1299566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088197863.1|1300213_1301318_+|transposase	IS3-like element ISSag2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.9	6.3e-70
WP_000248015.1|1301443_1302679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157135.1|1302858_1304061_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1312679:1312696	attR	ATAGCTTTAGCTTCTTTA	NA	NA	NA	NA
>prophage 7
NZ_CP022537	Streptococcus agalactiae strain 874391 chromosome, complete genome	2153937	1577318	1588814	2153937	transposase	Streptococcus_phage(90.91%)	13	NA	NA
WP_000767484.1|1577318_1578146_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.0	4.3e-124
WP_000287943.1|1578185_1578542_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	72.6	5.2e-42
WP_000966772.1|1578543_1579020_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	7.1e-39
WP_001167085.1|1580297_1580846_-	acetyltransferase	NA	M1PSC3	Streptococcus_phage	58.4	1.1e-54
WP_000587955.1|1580913_1582005_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	77.1	1.3e-163
WP_000603277.1|1582137_1582773_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000425856.1|1583042_1583912_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	4.9e-110
WP_000358198.1|1583911_1584238_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
WP_000364562.1|1584267_1585131_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.0	3.1e-72
WP_000715592.1|1585150_1585786_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	61.1	2.8e-67
WP_000160598.1|1585994_1587161_+|transposase	IS30-like element ISSag9 family transposase	transposase	NA	NA	NA	NA
WP_001144245.1|1587425_1588085_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	56.0	8.0e-65
WP_000178147.1|1588103_1588814_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	5.2e-17
>prophage 8
NZ_CP022537	Streptococcus agalactiae strain 874391 chromosome, complete genome	2153937	2098616	2114967	2153937	integrase	Streptococcus_phage(73.33%)	26	2097970:2097993	2112276:2112299
2097970:2097993	attL	AAAGTTAGCAAAAAAGTAAGCAAA	NA	NA	NA	NA
WP_025195363.1|2098616_2098994_-	DUF1492 domain-containing protein	NA	Q7Y4J3	Streptococcus_phage	36.6	7.2e-10
WP_000500998.1|2098968_2099331_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_000891800.1|2099729_2100218_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	56.2	7.3e-47
WP_017644960.1|2100291_2100849_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	59.8	1.4e-30
WP_001873750.1|2100850_2101024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694574.1|2101029_2101203_-	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	57.9	3.3e-10
WP_017644961.1|2101487_2103125_-	DNA primase	NA	A0A1X9I717	Streptococcus_phage	83.1	8.8e-262
WP_017644962.1|2103144_2104002_-	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.8	6.0e-121
WP_001100458.1|2104002_2104275_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	1.4e-18
WP_000174502.1|2104277_2104607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644963.1|2104618_2104816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644964.1|2104796_2104937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644965.1|2104933_2105266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000648623.1|2105520_2105763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644966.1|2105789_2106413_-	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	42.8	2.2e-40
WP_017644967.1|2106422_2107175_-	hypothetical protein	NA	A0A0A7RW33	Clostridium_phage	54.1	3.3e-22
WP_017644968.1|2107200_2107818_-	Rha family transcriptional regulator	NA	A0A249XSL1	Mycobacterium_phage	37.3	1.6e-11
WP_017644969.1|2107834_2108242_-	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	57.5	1.4e-35
WP_003066809.1|2108256_2108460_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_017644970.1|2108657_2109221_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	34.8	2.2e-18
WP_017644971.1|2109574_2109736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017646039.1|2109997_2110852_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	52.9	8.0e-57
WP_025195365.1|2111098_2112265_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	69.6	1.3e-153
WP_000092759.1|2112371_2112983_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
2112276:2112299	attR	AAAGTTAGCAAAAAAGTAAGCAAA	NA	NA	NA	NA
WP_001278152.1|2113312_2113600_-	Veg family protein	NA	NA	NA	NA	NA
WP_000230635.1|2113611_2114967_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	62.6	1.2e-152
