The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023070	Sinorhizobium fredii CCBAU 83666 chromosome, complete genome	3986633	1239470	1253599	3986633	tRNA	uncultured_Mediterranean_phage(81.82%)	14	NA	NA
WP_162129704.1|1239470_1240334_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.3	8.1e-33
WP_014328223.1|1240326_1241052_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.2	1.7e-39
WP_014328224.1|1241124_1242234_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.1e-29
WP_014328225.1|1242326_1242533_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	68.2	2.8e-08
WP_014328226.1|1242606_1243320_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_014328227.1|1243316_1244159_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.4	7.7e-44
WP_014328228.1|1244198_1245482_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.7	2.5e-102
WP_037393414.1|1245507_1246278_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	33.6	3.3e-25
WP_014328230.1|1246274_1246928_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.0	6.8e-16
WP_014328231.1|1247087_1247738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037393411.1|1247902_1249444_+	LysM peptidoglycan-binding domain-containing protein	NA	Q8SBN9	Clostridium_phage	35.9	5.6e-16
WP_037429911.1|1249476_1250352_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014328234.1|1250651_1250984_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	38.8	5.7e-11
WP_037393390.1|1251028_1253599_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	44.0	3.3e-53
>prophage 2
NZ_CP023070	Sinorhizobium fredii CCBAU 83666 chromosome, complete genome	3986633	1402776	1450967	3986633	capsid,head,tail,terminase,portal,integrase	Rhizobium_phage(21.62%)	57	1449593:1449620	1452651:1452678
WP_037435911.1|1402776_1403109_-	hypothetical protein	NA	A0A291AUJ8	Sinorhizobium_phage	39.0	6.1e-05
WP_157750282.1|1403108_1403273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037431627.1|1403269_1403707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037431626.1|1403703_1404045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037431624.1|1404127_1404358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095689684.1|1404443_1404779_-	helix-turn-helix transcriptional regulator	NA	J7FAF1	Agrobacterium_phage	47.8	4.0e-12
WP_037431619.1|1405203_1405425_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_157750284.1|1405521_1405719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037431616.1|1405728_1406085_+	hypothetical protein	NA	A0A068CE49	Rhizobium_phage	44.3	6.6e-13
WP_037431614.1|1406193_1406541_-	helix-turn-helix transcriptional regulator	NA	A0A068C9F0	Rhizobium_phage	45.6	2.0e-27
WP_037431611.1|1406636_1406879_+	helix-turn-helix transcriptional regulator	NA	A0A068CDI1	Rhizobium_phage	55.4	5.3e-14
WP_095689685.1|1407144_1407612_+	hypothetical protein	NA	A0A291AUS4	Sinorhizobium_phage	44.4	2.4e-23
WP_037431582.1|1407611_1408049_+	hypothetical protein	NA	A0A068CE53	Rhizobium_phage	51.2	1.7e-26
WP_050994634.1|1408045_1408342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157750286.1|1408380_1409109_+	hypothetical protein	NA	A0A291AUK6	Sinorhizobium_phage	27.0	3.2e-06
WP_037431605.1|1409384_1410494_+	hypothetical protein	NA	A0A068C9F4	Rhizobium_phage	63.6	2.9e-123
WP_037431579.1|1410490_1411432_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	56.8	2.0e-101
WP_037431577.1|1411428_1411743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037431574.1|1411729_1413754_+	DNA cytosine methyltransferase	NA	R9TP91	Rhizobium_phage	58.9	1.0e-219
WP_037431572.1|1413753_1415052_+	helix-turn-helix domain-containing protein	NA	A0A291AUS5	Sinorhizobium_phage	37.0	2.9e-42
WP_037431570.1|1415035_1415674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037431604.1|1416056_1416413_+	HNH endonuclease	NA	I3ULZ4	Rhodobacter_phage	63.5	6.5e-37
WP_037431602.1|1416491_1416977_+	hypothetical protein	NA	I3ULZ5	Rhodobacter_phage	47.7	2.8e-30
WP_037431568.1|1416960_1418661_+|terminase	terminase large subunit	terminase	I3ULZ6	Rhodobacter_phage	61.6	1.4e-190
WP_080579087.1|1418675_1420625_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	51.8	5.3e-165
WP_037431564.1|1421299_1421620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037431560.1|1421619_1422966_+|portal	phage portal protein	portal	F8TVA0	EBPR_siphovirus	61.6	2.5e-145
WP_080579086.1|1422962_1423958_+	hypothetical protein	NA	F8TVA1	EBPR_siphovirus	39.5	8.8e-23
WP_086021516.1|1423965_1424304_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B5WZS4	Pseudomonas_phage	46.5	8.4e-18
WP_037431556.1|1424335_1424593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037431555.1|1425206_1425932_+	hypothetical protein	NA	A0A2P0VNH9	Tetraselmis_virus	38.9	1.2e-40
WP_157750288.1|1425928_1426651_+	hypothetical protein	NA	A0A2K9L3I9	Tupanvirus	29.5	2.5e-11
WP_037431553.1|1426647_1427067_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A218MKF4	uncultured_virus	46.1	1.7e-20
WP_037431552.1|1427063_1427807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050994630.1|1427803_1428442_+	FkbM family methyltransferase	NA	K4JUF8	Caulobacter_phage	34.5	1.6e-14
WP_157750290.1|1428489_1429368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037431549.1|1429364_1429724_+|head	phage head closure protein	head	A0A141GEW5	Brucella_phage	64.2	1.4e-34
WP_086021515.1|1429735_1430191_+	HK97 gp10 family phage protein	NA	B4UTQ0	Rhizobium_phage	38.0	1.3e-13
WP_037431545.1|1430187_1430601_+	DUF3168 domain-containing protein	NA	A0A141GEW7	Brucella_phage	40.6	4.0e-14
WP_037431544.1|1430679_1431123_+	hypothetical protein	NA	A0A2D2W2I6	Sinorhizobium_phage	39.1	8.2e-13
WP_037431542.1|1431122_1431512_+	gene transfer agent family protein	NA	B4UTQ4	Rhizobium_phage	38.8	5.1e-11
WP_157750292.1|1431690_1431852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050994629.1|1431985_1435135_+	TIGR02594 family protein	NA	A0A1V0EEJ8	Caulobacter_phage	39.6	7.4e-23
WP_037431539.1|1435138_1436332_+	hypothetical protein	NA	A0A0N9ERB2	Pseudomonas_phage	21.6	2.8e-07
WP_037431535.1|1436328_1437186_+	phage BR0599 family protein	NA	A0A1V0DX31	Synechococcus_virus	40.0	1.9e-53
WP_037431532.1|1437195_1437423_+	hypothetical protein	NA	M4R174	Loktanella_phage	51.7	1.6e-12
WP_037431531.1|1437419_1437611_+	hypothetical protein	NA	A0A2D0W9I0	Bordetella_phage	48.3	8.9e-09
WP_095689687.1|1437603_1442727_+	hypothetical protein	NA	G8DCR8	Silicibacter_phage	32.9	1.2e-120
WP_037431523.1|1442777_1443791_+	acyltransferase	NA	B5WZU0	Pseudomonas_phage	32.5	7.8e-35
WP_037431519.1|1444745_1444961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037431518.1|1444960_1445386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050999880.1|1445333_1445636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037431512.1|1445691_1446033_+	DUF1515 family protein	NA	A0A291AUW4	Sinorhizobium_phage	64.1	3.5e-32
WP_095689690.1|1446803_1447796_+	ATP-dependent DNA ligase	NA	A0A291AUP8	Sinorhizobium_phage	75.6	1.2e-136
WP_037431504.1|1447785_1448349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157750296.1|1448364_1449411_-	hypothetical protein	NA	NA	NA	NA	NA
1449593:1449620	attL	TGGAGGCCTCGCCCGGAATTGAACCGGG	NA	NA	NA	NA
WP_037431500.1|1449641_1450967_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037431500.1|1449641_1450967_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1452651:1452678	attR	TGGAGGCCTCGCCCGGAATTGAACCGGG	NA	NA	NA	NA
>prophage 3
NZ_CP023070	Sinorhizobium fredii CCBAU 83666 chromosome, complete genome	3986633	1848019	1859791	3986633	portal,tail	Sulfitobacter_phage(60.0%)	12	NA	NA
WP_014328774.1|1848019_1849378_-|tail	tail fiber domain-containing protein	tail	M4NM77	Sulfitobacter_phage	33.1	2.6e-41
WP_014328775.1|1849437_1849890_-	GNAT family N-acetyltransferase	NA	X2CY06	Brucella_phage	53.6	4.9e-37
WP_037434232.1|1849886_1851497_-	hypothetical protein	NA	A0A088F6U1	Sulfitobacter_phage	37.9	1.8e-81
WP_014328777.1|1851496_1852099_-	hypothetical protein	NA	A0A088FAT4	Sulfitobacter_phage	33.0	1.7e-16
WP_014328778.1|1852095_1852692_-	hypothetical protein	NA	A0A2K9VHC9	Pseudomonas_phage	25.4	5.7e-09
WP_014328779.1|1852688_1853012_-	hypothetical protein	NA	F8TUS1	EBPR_podovirus	49.5	3.7e-23
WP_014328780.1|1853008_1853185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014328781.1|1853251_1854247_-	DUF5309 domain-containing protein	NA	A0A088FAT7	Sulfitobacter_phage	71.9	4.4e-131
WP_014328782.1|1854408_1855362_-	hypothetical protein	NA	A0A088F6W8	Sulfitobacter_phage	38.5	3.3e-35
WP_014328783.1|1855521_1855758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014328784.1|1856306_1858361_-|portal	phage portal protein	portal	A0A088F830	Sulfitobacter_phage	58.7	6.6e-198
WP_037434226.1|1858360_1859791_-	DNA packaging protein	NA	C8CLI4	Xylella_phage	64.3	3.1e-170
>prophage 4
NZ_CP023070	Sinorhizobium fredii CCBAU 83666 chromosome, complete genome	3986633	2341837	2397712	3986633	tRNA,transposase,holin,protease	Klosneuvirus(14.29%)	47	NA	NA
WP_037436541.1|2341837_2342557_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_037436544.1|2342745_2342958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095689705.1|2343037_2346067_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_095689706.1|2346331_2349370_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_037436205.1|2349921_2351022_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012708843.1|2351075_2351387_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_037436202.1|2351563_2352667_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_014329133.1|2352706_2353162_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_080578672.1|2353158_2353629_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_037400797.1|2353710_2354253_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.8	2.2e-36
WP_037436199.1|2354550_2354736_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_037436197.1|2354751_2356011_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1B0V011	Roseobacter_phage	43.1	3.6e-53
WP_014329137.1|2356007_2356640_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_014329138.1|2356636_2357260_-	DUF1285 domain-containing protein	NA	NA	NA	NA	NA
WP_037436196.1|2357526_2358540_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_014329140.1|2358543_2359464_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_095689707.1|2359460_2362274_+	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_037436187.1|2362281_2364351_+	membrane protein	NA	NA	NA	NA	NA
WP_014329144.1|2364825_2365386_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014329145.1|2365637_2366615_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_014329146.1|2366990_2367479_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_086020626.1|2367709_2368470_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	2.1e-24
WP_014329147.1|2368834_2369743_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014329148.1|2369914_2370460_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014329149.1|2370639_2371158_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_037428979.1|2371161_2371989_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_037428982.1|2372188_2373898_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_037396119.1|2374325_2374910_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	37.3	1.1e-28
WP_037428984.1|2375141_2375720_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_014329155.1|2375867_2376332_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	48.6	1.0e-29
WP_037428999.1|2376328_2377249_-	cation transporter	NA	NA	NA	NA	NA
WP_037469635.1|2377428_2379618_-	anthranilate synthase	NA	NA	NA	NA	NA
WP_037428988.1|2379908_2382014_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_037428990.1|2382269_2383085_+	extensin family protein	NA	NA	NA	NA	NA
WP_037428992.1|2383085_2383544_-	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_037428994.1|2383698_2384208_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_037428995.1|2384229_2385909_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_037428997.1|2385996_2387217_-	DUF2333 family protein	NA	NA	NA	NA	NA
WP_037396098.1|2387220_2388510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014329165.1|2388702_2389110_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_042777459.1|2389378_2391295_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_037429004.1|2391296_2392445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037396079.1|2392506_2393595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037396078.1|2393809_2394397_-	thymidine kinase	NA	A7XF40	Enterobacteria_phage	54.6	3.1e-52
WP_037396076.1|2394680_2395637_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_037396090.1|2395820_2396666_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_014329172.1|2396662_2397712_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	32.6	9.6e-20
>prophage 1
NZ_CP023072	Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence	742947	16669	164288	742947	transposase,integrase	Gordonia_phage(15.0%)	93	100039:100098	129020:129145
WP_086018618.1|16669_17769_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	3.6e-49
WP_042779412.1|19517_20609_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_042779412.1|20694_21786_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_095689811.1|22522_23524_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A160DCT0	Gordonia_phage	28.6	1.9e-12
WP_066005166.1|24820_25870_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_014857758.1|25955_26858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037427384.1|26854_28405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078070838.1|28540_30601_-	cytochrome P450	NA	NA	NA	NA	NA
WP_034859623.1|30812_31121_-	ferredoxin	NA	NA	NA	NA	NA
WP_095689812.1|31122_32430_-	cytochrome P450	NA	NA	NA	NA	NA
WP_015633479.1|33129_33363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157750340.1|34069_34261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086021548.1|36288_37302_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014328473.1|37400_38321_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.3	2.0e-29
WP_161623564.1|38317_39802_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_161623566.1|40108_40429_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_095689849.1|41485_45115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015633423.1|45256_45703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080579334.1|45699_46056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015633421.1|46851_47658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034859947.1|49101_49566_+	phasin	NA	NA	NA	NA	NA
WP_080579360.1|51070_51796_-	2-O-methyltransferase NoeI	NA	A0A2P0VP97	Tetraselmis_virus	28.3	3.3e-11
WP_095689814.1|51881_52085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095689850.1|52739_54323_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015633430.1|57897_58869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050994801.1|62187_63744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157750341.1|63964_64303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037426177.1|65659_66082_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015633379.1|66078_66948_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	29.3	2.8e-25
WP_037427413.1|67485_68781_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_037427675.1|69833_70595_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	55.6	5.1e-71
WP_095689815.1|70610_72152_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	43.9	5.0e-126
WP_037436672.1|74945_75635_+	OmpW family protein	NA	NA	NA	NA	NA
WP_078070374.1|76074_76308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078070375.1|76306_77020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037436679.1|78087_78546_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_078070376.1|85478_86027_+	YecA family protein	NA	NA	NA	NA	NA
WP_080579337.1|87346_87586_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_157750342.1|88409_88658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078070378.1|89444_90197_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080579338.1|90456_91023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095689851.1|91648_92482_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_037436876.1|92792_94055_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010875278.1|94051_94282_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	42.9	7.2e-05
WP_162130067.1|94819_95167_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_095678161.1|98511_99771_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
100039:100098	attL	GTTTATGCCGACCGGCGAACTATGCCGATTAATCAACTTTTTGCCAACGTTTCCGGTACC	NA	NA	NA	NA
WP_037427235.1|100164_101406_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	29.0	3.0e-12
WP_095689786.1|101402_102326_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_095689787.1|102322_103324_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A160DCT0	Gordonia_phage	28.7	1.4e-12
WP_095689816.1|104770_105808_-	transketolase family protein	NA	NA	NA	NA	NA
WP_095689817.1|105804_106644_-	transketolase	NA	NA	NA	NA	NA
WP_037436789.1|106675_107437_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.1	1.7e-10
WP_037436792.1|107584_108481_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.3	8.5e-17
WP_037436794.1|108881_111062_-	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	32.8	1.1e-41
WP_153297037.1|116043_116349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162832844.1|117058_117217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014857797.1|117915_118518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034859822.1|118548_118734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050994795.1|119418_120609_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4X257	Flamingopox_virus	30.1	3.6e-07
WP_037436658.1|120605_120959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037436665.1|120975_121368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050994796.1|121382_122864_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_080579323.1|123250_123697_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_080579326.1|123708_124047_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	55.4	2.5e-30
WP_095689818.1|125793_126795_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A160DCT0	Gordonia_phage	28.7	1.9e-12
WP_095689786.1|126791_127715_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037427235.1|127711_128953_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	29.0	3.0e-12
WP_037436078.1|129204_129438_-	hypothetical protein	NA	NA	NA	NA	NA
129020:129145	attR	GGTACCGGAAACGTTGGCAAAAAGTTGATTAATCGGCATAGTTCGCCGGTCGGCATAAACTTGCCGTCTCAACGACGTCGACCCAAAGGCGTGGCTCGCCGATGTGTTCGCCCGCATCGCCGATCT	NA	NA	NA	NA
WP_037436076.1|131220_132291_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162832842.1|132309_133779_-	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_037436075.1|134376_135018_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_037436073.1|135192_136488_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_037436072.1|136570_137500_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_050994777.1|137511_138345_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_037436071.1|138388_139456_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	31.9	1.0e-24
WP_037436070.1|139452_140055_-	phosphoenolpyruvate hydrolase family protein	NA	NA	NA	NA	NA
WP_037436069.1|140187_141396_+	Tm-1-like ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_037436068.1|141385_142243_+	phosphoenolpyruvate hydrolase family protein	NA	NA	NA	NA	NA
WP_037436067.1|142266_142896_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_037436065.1|142936_144025_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_037436064.1|144044_145874_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_037436056.1|149026_149257_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	47.6	3.8e-06
WP_095689819.1|149999_150902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095689820.1|150898_152449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095689821.1|152582_153581_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_095689822.1|153730_155074_-	cytochrome P450	NA	NA	NA	NA	NA
WP_037437109.1|155073_155910_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	8.2e-14
WP_095689852.1|155896_156205_-	ferredoxin	NA	NA	NA	NA	NA
WP_095689823.1|156206_157496_-	cytochrome P450	NA	NA	NA	NA	NA
WP_037436962.1|157590_158793_-	cytochrome P450	NA	NA	NA	NA	NA
WP_100209506.1|159084_159363_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_037436960.1|159528_160761_-	cytochrome P450	NA	NA	NA	NA	NA
WP_095689853.1|163253_164288_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023072	Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence	742947	229304	301688	742947	transposase,integrase	Acidithiobacillus_phage(23.08%)	53	237889:237907	240110:240128
WP_037437180.1|229304_230726_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	34.7	4.7e-70
WP_037434276.1|231004_231790_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050994701.1|232030_233227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037434283.1|233531_234707_+	alanine racemase	NA	NA	NA	NA	NA
WP_050994700.1|235145_236021_+	TIGR01459 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_037434275.1|236074_236773_-	response regulator transcription factor	NA	NA	NA	NA	NA
237889:237907	attL	GGCGGCAAGAGCTTCGTCG	NA	NA	NA	NA
WP_080579189.1|238237_238780_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157750345.1|240909_241980_+	acyl-CoA-6-aminopenicillanic acid acyltransferase	NA	NA	NA	NA	NA
240110:240128	attR	CGACGAAGCTCTTGCCGCC	NA	NA	NA	NA
WP_037434270.1|242493_243255_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.2e-18
WP_157750346.1|244141_244480_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_037434281.1|244913_245675_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	1.2e-19
WP_050994698.1|245874_246936_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_050994697.1|246977_248087_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.7e-27
WP_050994696.1|248083_248914_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_080579190.1|249060_249870_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_037434268.1|250172_251174_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_037434267.1|251183_251831_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_037434266.1|252248_253823_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_037434265.1|253845_255222_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_037434264.1|255524_256883_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	42.7	2.3e-45
WP_037434263.1|257116_258073_-	transaldolase	NA	A0A0E3FGE1	Synechococcus_phage	29.1	7.9e-13
WP_050994695.1|258222_259074_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095689830.1|259108_260470_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_037434257.1|260833_261976_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_157750347.1|262118_262421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037434256.1|262534_262855_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_037434255.1|262847_264230_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_037434254.1|264226_265354_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_037434253.1|265558_265981_+	endoribonuclease	NA	NA	NA	NA	NA
WP_037434252.1|266579_267680_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_037434251.1|267757_268840_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.9	3.3e-15
WP_037434250.1|268836_269724_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_037434249.1|269720_270563_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_080579187.1|272094_272271_-	Hin recombinase	NA	NA	NA	NA	NA
WP_037434246.1|272897_273818_+	DMT family transporter	NA	NA	NA	NA	NA
WP_037434261.1|276509_277355_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_037434244.1|277458_278613_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_037434243.1|279299_279776_+	RidA family protein	NA	NA	NA	NA	NA
WP_037434242.1|279779_280982_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_080579185.1|281933_282959_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.3	8.8e-18
WP_050994692.1|282955_283972_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	1.6e-11
WP_037434241.1|283968_284862_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_037434240.1|284863_285802_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_037434239.1|285830_287414_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_037434238.1|287851_288265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037434237.1|291150_292587_-	amidase	NA	NA	NA	NA	NA
WP_050994693.1|293057_294161_-	threonine aldolase family protein	NA	NA	NA	NA	NA
WP_037434236.1|294518_294971_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_037434235.1|295196_296153_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_037434234.1|296333_297521_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	28.5	8.3e-36
WP_095689831.1|297712_298393_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	46.3	7.4e-21
WP_037427675.1|299369_300131_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	55.6	5.1e-71
WP_037437027.1|300146_301688_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	43.9	3.9e-126
>prophage 3
NZ_CP023072	Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence	742947	325035	377351	742947	transposase,integrase	Enterobacteria_phage(22.22%)	28	369079:369106	372453:372480
WP_037435898.1|325035_326298_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	38.1	1.3e-47
WP_037435879.1|326294_327176_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.3	6.1e-52
WP_014327878.1|327282_328116_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_037436812.1|330610_331411_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	45.2	1.8e-58
WP_080579332.1|331571_332810_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.1	8.4e-31
WP_037436810.1|333937_334636_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_095689853.1|336069_337104_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_095689832.1|337258_337690_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_037435551.1|340162_341218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050994753.1|341228_342287_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_037435548.1|342283_344986_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_037435546.1|346159_347389_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_037435544.1|347974_349018_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_095689833.1|349448_351251_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	4.5e-33
WP_157750349.1|353996_354239_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_037435536.1|354251_354569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095689835.1|356384_357785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037435529.1|358351_358549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037435537.1|362165_363197_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157750351.1|365703_365919_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037435521.1|367895_368180_-	hypothetical protein	NA	NA	NA	NA	NA
369079:369106	attL	GTTTATGCCGACCGGCGAACTATGCCGA	NA	NA	NA	NA
WP_095689787.1|369194_370196_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A160DCT0	Gordonia_phage	28.7	1.4e-12
WP_095689786.1|370192_371116_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037427235.1|371112_372354_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	29.0	3.0e-12
WP_057220201.1|372906_373086_+	hypothetical protein	NA	NA	NA	NA	NA
372453:372480	attR	TCGGCATAGTTCGCCGGTCGGCATAAAC	NA	NA	NA	NA
WP_095689837.1|373072_375142_+	recombinase family protein	NA	K4JU73	Streptococcus_phage	21.3	1.5e-08
WP_037435640.1|376599_376947_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	58.1	1.2e-27
WP_037435642.1|376943_377351_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP023072	Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence	742947	425653	486194	742947	transposase	Paenibacillus_phage(33.33%)	52	NA	NA
WP_095689838.1|425653_426688_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014327878.1|427080_427914_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_086020626.1|428013_428774_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	2.1e-24
WP_080579319.1|429568_430006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050994790.1|430137_431655_-	radical SAM family RiPP maturation amino acid epimerase	NA	NA	NA	NA	NA
WP_037436576.1|431731_432109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875135.1|432755_433208_-	nitrogenase stabilizing/protective protein NifW	NA	NA	NA	NA	NA
WP_037436573.1|433371_434535_-	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	35.1	3.4e-34
WP_095689839.1|435335_437327_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_037427441.1|438718_439126_+	phasin family protein	NA	NA	NA	NA	NA
WP_010875130.1|440044_440935_+	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_037436943.1|441030_442542_+	nitrogenase molybdenum-iron protein alpha chain	NA	NA	NA	NA	NA
WP_095689840.1|442637_444179_+	nitrogenase molybdenum-iron protein subunit beta	NA	NA	NA	NA	NA
WP_080579242.1|444431_444920_+	NifX-associated nitrogen fixation protein	NA	NA	NA	NA	NA
WP_010875126.1|444942_445146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037435246.1|445450_445753_+	exopolysaccharide production repressor	NA	NA	NA	NA	NA
WP_050988395.1|446179_447697_+	tryptophan 7-halogenase	NA	Q58MD8	Prochlorococcus_phage	24.6	2.1e-31
WP_010875122.1|447825_448764_-	transcriptional regulator NodD2	NA	NA	NA	NA	NA
WP_014857541.1|449083_449290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014857543.1|450458_451139_+	winged helix-turn-helix domain-containing protein	NA	W8CYM9	Bacillus_phage	26.5	3.8e-17
WP_037426125.1|451162_452590_+	type II and III secretion system protein family protein	NA	NA	NA	NA	NA
WP_014857545.1|452599_453166_+	CpaD family pilus assembly lipoprotein	NA	NA	NA	NA	NA
WP_014857546.1|453610_454627_-	type II secretion system effector nodulation protein NopL	NA	NA	NA	NA	NA
WP_037426130.1|454884_456099_-	MFS transporter	NA	NA	NA	NA	NA
WP_037426133.1|456095_457982_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_014857549.1|457981_459121_-	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_037426137.1|459117_460128_-	cysteine synthase family protein	NA	NA	NA	NA	NA
WP_037426141.1|460128_461490_-	Y4yA family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_014857553.1|461489_461918_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_037426143.1|462102_463893_-	type II secretion system effector nodulation protein NopX	NA	NA	NA	NA	NA
WP_032490256.1|464174_464879_-	nodulation protein NolW	NA	NA	NA	NA	NA
WP_037435248.1|465034_465529_+	nodulation protein NolB	NA	NA	NA	NA	NA
WP_037426145.1|465538_466408_+	nodulation protein NolT	NA	NA	NA	NA	NA
WP_015633406.1|466404_467043_+	nodulation protein NolU	NA	NA	NA	NA	NA
WP_037426152.1|467044_467671_+	nodulation protein NolV	NA	NA	NA	NA	NA
WP_037426155.1|467667_469023_+	type III secretion system ATPase SctN	NA	NA	NA	NA	NA
WP_014857562.1|468998_469535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037426158.1|469581_470637_+	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_037426161.1|470629_471298_+	type III secretion system export apparatus subunit SctR	NA	NA	NA	NA	NA
WP_014857565.1|471294_471573_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_037426165.1|471581_472400_+	type III secretion system export apparatus subunit SctT	NA	NA	NA	NA	NA
WP_014857567.1|472396_473434_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_014857569.1|474230_475043_+	effector protein NopP	NA	NA	NA	NA	NA
WP_010875097.1|475744_476041_+	nodulation protein NopC	NA	NA	NA	NA	NA
WP_037426169.1|476433_477324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014857573.1|477512_479606_+	type III secretion system export apparatus subunit SctV	NA	NA	NA	NA	NA
WP_015633401.1|479622_480171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034859758.1|481045_481483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037426177.1|481925_482348_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015633379.1|482344_483214_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	29.3	2.8e-25
WP_095678047.1|484451_485285_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_086022824.1|485440_486194_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	37.0	1.3e-10
>prophage 5
NZ_CP023072	Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence	742947	495388	562046	742947	transposase,integrase	Acidithiobacillus_phage(15.0%)	49	512289:512316	515663:515690
WP_095678167.1|495388_496475_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.7	5.8e-44
WP_078070781.1|496763_497150_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_034859283.1|497042_497981_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.6	3.5e-90
WP_014857595.1|497995_499051_-	GDP-mannose 4,6-dehydratase	NA	M1HKK4	Acanthocystis_turfacea_Chlorella_virus	64.3	4.5e-126
WP_037427231.1|499295_500264_-	nodulation protein NodZ	NA	NA	NA	NA	NA
WP_034859288.1|500578_501994_-	phosphomannomutase	NA	NA	NA	NA	NA
WP_050988434.1|502140_503595_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	27.8	3.3e-50
WP_014857603.1|504323_505289_+	transcriptional regulator NodD1	NA	NA	NA	NA	NA
WP_015633385.1|505888_506320_+	helix-turn-helix transcriptional regulator	NA	A0A223W054	Agrobacterium_phage	46.3	2.9e-23
WP_014857606.1|506465_506912_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014857607.1|507042_507660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010875074.1|508183_508615_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.1	1.9e-22
WP_037437180.1|509654_511076_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	34.7	4.7e-70
WP_014330935.1|511218_511509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100209413.1|511538_512153_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
512289:512316	attL	GTTTATGCCGACCGGCGAACTATGCCGA	NA	NA	NA	NA
WP_037427235.1|512414_513656_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	29.0	3.0e-12
WP_095689786.1|513652_514576_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_095689787.1|514572_515574_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A160DCT0	Gordonia_phage	28.7	1.4e-12
WP_057220201.1|516116_516296_+	hypothetical protein	NA	NA	NA	NA	NA
515663:515690	attR	TCGGCATAGTTCGCCGGTCGGCATAAAC	NA	NA	NA	NA
WP_095689837.1|516282_518352_+	recombinase family protein	NA	K4JU73	Streptococcus_phage	21.3	1.5e-08
WP_014330938.1|519840_520188_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.5	3.4e-38
WP_014330939.1|520184_520577_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_095689815.1|520779_522321_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	43.9	5.0e-126
WP_037427675.1|522336_523098_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	55.6	5.1e-71
WP_014331726.1|523694_525104_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_014331725.1|525090_525828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172900205.1|527001_528714_-	recombinase family protein	NA	NA	NA	NA	NA
WP_086021547.1|532422_532686_-	Y4bD/Y4pK family protein	NA	NA	NA	NA	NA
WP_037427476.1|533775_535128_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.4	7.0e-55
WP_095678168.1|535636_536374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037427474.1|536677_537100_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_010875326.1|537096_537354_-	plasmid stability protein stbC	NA	NA	NA	NA	NA
WP_037427472.1|537671_537968_+	DUF2604 domain-containing protein	NA	NA	NA	NA	NA
WP_037427479.1|537960_538566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037427470.1|538562_539051_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_037427469.1|539053_540613_+	E2 ligase fold family C protein	NA	NA	NA	NA	NA
WP_014857619.1|541332_541590_+	hypothetical protein	NA	A0A2I7REY7	Vibrio_phage	49.2	4.9e-10
WP_095678116.1|542203_543241_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_080579349.1|544749_544935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014858081.1|545143_545524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034859708.1|545742_546228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080579355.1|547878_549702_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	1.6e-33
WP_080579353.1|549812_550262_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	40.4	5.2e-07
WP_037437091.1|550242_550596_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.4	3.2e-20
WP_095689837.1|552065_554135_-	recombinase family protein	NA	K4JU73	Streptococcus_phage	21.3	1.5e-08
WP_057220201.1|554121_554301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080579355.1|554933_556757_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	1.6e-33
WP_037427413.1|558085_559381_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_095689841.1|561212_562046_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP023072	Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence	742947	573143	592310	742947	transposase	Lactococcus_phage(33.33%)	16	NA	NA
WP_095689842.1|573143_573806_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_014327878.1|573888_574722_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_034859666.1|574966_575824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109023434.1|576938_577655_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_014330979.1|577939_579685_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_014328473.1|581116_582037_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.3	2.0e-29
WP_161623564.1|582033_583518_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_109023434.1|583757_584474_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_037436867.1|584672_585017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162109203.1|586107_586482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050988452.1|586405_587539_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_050988451.1|587516_588038_+	sugar isomerase	NA	NA	NA	NA	NA
WP_037427532.1|588042_589152_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	33.7	4.8e-46
WP_078070510.1|589258_589945_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_037427530.1|590206_590980_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_095678167.1|591223_592310_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.7	5.8e-44
>prophage 7
NZ_CP023072	Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence	742947	657490	702621	742947	transposase,integrase	Paenibacillus_phage(20.0%)	27	647777:647791	660267:660281
647777:647791	attL	CGCTCGCCGCCTGTT	NA	NA	NA	NA
WP_037437931.1|657490_658360_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.3	2.2e-33
WP_095678109.1|658369_659545_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_037427862.1|659956_660331_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.3	1.0e-24
660267:660281	attR	AACAGGCGGCGAGCG	NA	NA	NA	NA
WP_172900202.1|660327_660537_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_037437027.1|660690_662232_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	43.9	3.9e-126
WP_037427675.1|662247_663009_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	55.6	5.1e-71
WP_037427348.1|663129_663336_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	43.3	5.9e-06
WP_157213238.1|663476_663644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037436984.1|663987_665013_+	porin	NA	NA	NA	NA	NA
WP_157213237.1|665106_665544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078070844.1|666148_666352_+	GFA family protein	NA	NA	NA	NA	NA
WP_037427337.1|666883_668110_-	monooxygenase	NA	NA	NA	NA	NA
WP_037427335.1|668144_668927_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.2	1.4e-12
WP_037427333.1|668984_670343_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_095689846.1|671675_672761_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_037427331.1|673646_674438_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	23.0	1.6e-11
WP_037427278.1|677975_678428_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_157213233.1|679437_681762_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	26.4	1.7e-08
WP_037427270.1|681807_682542_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_050988439.1|684218_686699_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.8	2.4e-21
WP_095678164.1|686758_687331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050994765.1|687751_688237_-	NUDIX hydrolase	NA	A0A2H4IB87	Erwinia_phage	35.9	1.8e-13
WP_037435819.1|688527_690522_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_080579329.1|693968_694634_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_037427488.1|694630_695044_+	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_037427491.1|697396_698146_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014327878.1|701787_702621_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP023071	Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence	2277056	1108923	1148270	2277056	integrase,transposase	Leptospira_phage(33.33%)	25	1144985:1145012	1148359:1148386
WP_100209483.1|1108923_1109325_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_037430533.1|1109798_1110329_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	38.0	5.7e-21
WP_037430535.1|1110648_1111944_+	methyltransferase domain-containing protein	NA	A0A1V0SJ83	Klosneuvirus	27.8	1.2e-35
WP_037430538.1|1111940_1112756_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_037430540.1|1112752_1113406_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_037430544.1|1113975_1115358_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_153452093.1|1117267_1117411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037436772.1|1121083_1122115_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_037436774.1|1122142_1123129_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_037436778.1|1123161_1124622_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_080579331.1|1125003_1126347_+	glycoside hydrolase family 140 protein	NA	NA	NA	NA	NA
WP_037437555.1|1126343_1127645_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_037436806.1|1131681_1132833_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L0G1	Tupanvirus	25.6	9.5e-29
WP_037436804.1|1132829_1133522_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	49.1	1.8e-06
WP_037436801.1|1133606_1134617_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A2K9L2R7	Tupanvirus	27.8	4.5e-14
WP_037436800.1|1134668_1135922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037436798.1|1136184_1138668_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_095689785.1|1139273_1139609_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	37.3	2.4e-09
WP_095678167.1|1139542_1140630_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.7	5.8e-44
WP_157750332.1|1140893_1142468_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	29.2	2.4e-46
WP_037435909.1|1142358_1144434_-	recombinase family protein	NA	NA	NA	NA	NA
WP_162130061.1|1144430_1144868_-	hypothetical protein	NA	NA	NA	NA	NA
1144985:1145012	attL	GTTTATGCCGACCGGCGAACTATGCCGA	NA	NA	NA	NA
WP_037427235.1|1145110_1146352_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_095689786.1|1146348_1147272_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_095689787.1|1147268_1148270_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	25.9	3.0e-18
1148359:1148386	attR	TCGGCATAGTTCGCCGGTCGGCATAAAC	NA	NA	NA	NA
>prophage 2
NZ_CP023071	Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence	2277056	2064934	2146482	2277056	transposase	Planktothrix_phage(33.33%)	57	NA	NA
WP_086021549.1|2064934_2066034_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.0e-48
WP_037395736.1|2066246_2068022_-	guanylate cyclase	NA	NA	NA	NA	NA
WP_080579269.1|2068411_2068645_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_037435781.1|2068602_2068872_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_037435783.1|2069764_2070382_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_037435785.1|2070579_2072010_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_037435787.1|2072006_2072831_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_037435789.1|2072827_2073766_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_037435791.1|2073779_2075300_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_037402184.1|2076429_2077098_-	hydrolase	NA	NA	NA	NA	NA
WP_037435793.1|2078871_2079465_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_141322281.1|2080076_2080517_+	M10 family metallopeptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_037402201.1|2081467_2082151_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_037402203.1|2082137_2082929_-	4-hydroxy-2-oxoheptanedioate aldolase	NA	NA	NA	NA	NA
WP_018237596.1|2082937_2083720_-	2-oxo-hepta-3-ene-1,7-dioic acid hydratase	NA	NA	NA	NA	NA
WP_037402206.1|2083744_2084638_-	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_014766263.1|2084896_2085634_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_037435796.1|2085633_2086455_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_037402211.1|2086501_2087170_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_037435798.1|2087179_2087830_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_037435800.1|2087871_2088696_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_050994764.1|2088703_2089477_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.4e-31
WP_037402220.1|2089495_2090356_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_015886723.1|2090370_2090739_+	5-carboxymethyl-2-hydroxymuconate Delta-isomerase	NA	NA	NA	NA	NA
WP_037435802.1|2090772_2091222_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_037435803.1|2091229_2092267_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_037437159.1|2092967_2094524_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_037437162.1|2095323_2095965_+	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_037437197.1|2096266_2097700_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_037437184.1|2097913_2098312_-	RidA family protein	NA	NA	NA	NA	NA
WP_037437187.1|2098467_2099061_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095689804.1|2099387_2100776_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162267718.1|2101078_2101516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037435622.1|2101551_2101833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037435621.1|2101874_2102624_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_037435616.1|2104412_2105498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050994757.1|2106719_2107952_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_050994756.1|2108015_2108798_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.8e-31
WP_037400656.1|2108807_2109947_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_086021536.1|2109948_2111076_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_037435614.1|2112030_2112507_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_037400335.1|2114934_2117214_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_037435608.1|2117210_2120453_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_162129736.1|2120449_2122684_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	38.7	1.8e-71
WP_037435606.1|2122876_2124034_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_037402433.1|2129484_2129991_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_014328473.1|2130307_2131228_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.3	7.1e-35
WP_161623564.1|2131224_2132709_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_037402435.1|2133965_2134895_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	27.9	1.4e-14
WP_141322333.1|2136225_2136621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037402439.1|2136890_2137805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050984208.1|2138322_2142714_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_037402441.1|2142670_2143042_+	response regulator	NA	NA	NA	NA	NA
WP_037402443.1|2143570_2144206_-	DUF1326 domain-containing protein	NA	NA	NA	NA	NA
WP_037436548.1|2144592_2144838_-	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_037437167.1|2145166_2145766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037437165.1|2146026_2146482_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP023073	Sinorhizobium fredii CCBAU 83666 plasmid pSF83666d, complete sequence	76753	40019	47493	76753		Sinorhizobium_phage(66.67%)	11	NA	NA
WP_080579151.1|40019_40997_-	ATP-dependent DNA ligase	NA	A0A076GD42	Sinorhizobium_phage	81.8	2.1e-154
WP_037433882.1|41055_41319_+	hypothetical protein	NA	A0A291AUP6	Sinorhizobium_phage	72.4	2.3e-31
WP_050994676.1|41935_42343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037433878.1|42476_43391_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_037433877.1|43439_43982_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	37.6	1.0e-17
WP_050994675.1|44186_44696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080579150.1|44692_45691_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_037433872.1|45687_46299_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	34.5	3.2e-15
WP_080579149.1|46394_46571_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_050994674.1|46567_46825_+	hypothetical protein	NA	A0A291AUP3	Sinorhizobium_phage	78.8	5.2e-36
WP_037433870.1|46833_47493_+	SOS response-associated peptidase	NA	A0A291AUP1	Sinorhizobium_phage	86.8	4.5e-116
