The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006804	Lactobacillus rhamnosus DSM 14870 chromosome, complete genome	3013149	223918	323536	3013149	tail,integrase,capsid,portal,terminase,holin,transposase,head,tRNA	Lactobacillus_rhamnosus_Lc-Nu-like_prophage(33.33%)	94	237599:237619	319574:319594
WP_005685893.1|223918_225217_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	28.2	2.9e-50
WP_005685894.1|225240_226416_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_005685895.1|226468_226960_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_031546071.1|227234_230036_-	ribonuclease H-like domain-containing protein	NA	A0A1X9I5C8	Streptococcus_phage	33.0	3.2e-54
WP_005685897.1|230079_233790_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.2	6.4e-18
WP_005685898.1|233786_237326_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
237599:237619	attL	TGAGCGCGAGCCAGCCCGGTT	NA	NA	NA	NA
WP_005685900.1|237867_238803_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_005685903.1|238810_239815_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_005685905.1|239780_240815_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_005685907.1|240921_242253_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005685909.1|242239_243196_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005685911.1|243397_244141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685914.1|244256_244607_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_095691906.1|244644_245432_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_005685917.1|245500_245689_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_095691907.1|246146_247652_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005685921.1|247617_249348_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.3	1.5e-06
WP_005685922.1|249722_250517_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_005685924.1|250503_251214_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_005685926.1|251402_252653_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.9	1.1e-38
WP_005685928.1|252666_254436_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.4	8.2e-56
WP_095691908.1|254621_256691_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005685932.1|256692_257589_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_064522555.1|257993_259163_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	31.4	2.2e-41
WP_029943783.1|259205_259532_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014569668.1|260367_260754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031546063.1|260944_262102_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	63.1	2.2e-134
WP_016386932.1|262104_262437_-|holin	phage holin	holin	Q3L0R7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	2.6e-32
WP_003579629.1|262449_262683_-	hypothetical protein	NA	Q3L0R9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	2.6e-34
WP_032962754.1|262707_262839_-	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	7.7e-20
WP_064521237.1|262831_263122_-	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	7.9e-49
WP_064533550.1|263131_266101_-|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	99.9	0.0e+00
WP_021354707.1|266101_267994_-|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	0.0e+00
WP_095691990.1|267994_272221_-	transglycosylase SLT domain-containing protein	NA	Q3L0S4	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	99.6	0.0e+00
WP_016363330.1|272250_272481_-	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	2.9e-38
WP_031547154.1|272458_272809_-|tail	tail protein	tail	Q3L0S6	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	1.4e-55
WP_031547156.1|272971_273583_-|tail	phage tail protein	tail	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	4.5e-110
WP_031547158.1|273583_273964_-	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	1.4e-66
WP_031547160.1|273960_274380_-	HK97 gp10 family phage protein	NA	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	1.5e-72
WP_031547162.1|274382_274727_-|head	phage head closure protein	head	A8YQJ4	Lactobacillus_phage	82.3	1.0e-47
WP_031547165.1|274716_275007_-	hypothetical protein	NA	A0A2P0ZLF2	Lactobacillus_phage	40.5	8.3e-06
WP_032963838.1|275078_277001_-|capsid	phage major capsid protein	capsid	A0A2P0ZLF9	Lactobacillus_phage	44.8	6.6e-75
WP_095691909.1|277000_278101_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	43.1	7.3e-79
WP_032963841.1|278097_278280_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_032963843.1|278401_280303_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	44.3	1.2e-150
WP_031547220.1|280299_280776_-|terminase	phage terminase small subunit P27 family	terminase	A0A0M7REI3	Lactobacillus_phage	40.8	1.3e-24
WP_025013623.1|281257_281818_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.2	9.6e-35
WP_107750381.1|282050_282227_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_032963847.1|283610_283898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031546964.1|283894_284434_-	HNH endonuclease	NA	B8R694	Lactobacillus_phage	40.1	1.9e-24
WP_031546962.1|284427_284811_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_124106368.1|284810_285341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031546957.1|285327_285534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050489659.1|285596_286205_-	HNH endonuclease	NA	A0A0A7DMX6	Lactobacillus_phage	37.7	1.2e-14
WP_031546953.1|286550_287780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031546950.1|287890_288265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031546949.1|290322_290601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685933.1|291173_291701_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005685935.1|291797_292427_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_005685938.1|292423_293137_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.7e-12
WP_005687657.1|293791_294103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687658.1|294253_295069_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_005687659.1|295068_295971_-	GTPase Era	NA	NA	NA	NA	NA
WP_005713928.1|295967_296357_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_005687661.1|296360_296759_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_005687662.1|296742_297201_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_005687663.1|297204_298191_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	45.2	3.2e-49
WP_005687664.1|298757_299192_-	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	39.0	9.5e-14
WP_005687665.1|299219_299396_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005687666.1|299668_300499_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_005687667.1|300495_301383_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	27.0	2.1e-20
WP_005687668.1|301530_302451_-	YitT family protein	NA	NA	NA	NA	NA
WP_005687669.1|302755_303202_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_005687670.1|303287_305093_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005687671.1|305094_306378_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005687672.1|307016_308525_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_031546943.1|308521_309397_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	5.4e-24
WP_005687674.1|309596_310043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687675.1|310130_311453_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	30.2	3.0e-10
WP_005687676.1|311554_312181_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_005687677.1|312180_312627_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_005687678.1|312753_314979_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.1	3.1e-07
WP_005687679.1|315283_315607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569694.1|315644_316373_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005687681.1|316411_317356_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005687682.1|317436_317931_-	DUF3013 family protein	NA	NA	NA	NA	NA
WP_005687683.1|317927_318533_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_005687684.1|318638_318887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687685.1|318955_319342_-	YxeA family protein	NA	NA	NA	NA	NA
WP_005687686.1|319625_319805_-	hypothetical protein	NA	NA	NA	NA	NA
319574:319594	attR	AACCGGGCTGGCTCGCGCTCA	NA	NA	NA	NA
WP_005687687.1|319804_320191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687688.1|320608_321199_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005687689.1|321201_321759_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569018.1|322039_323536_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP006804	Lactobacillus rhamnosus DSM 14870 chromosome, complete genome	3013149	787702	833626	3013149	transposase,protease,tRNA	Lactococcus_phage(28.57%)	31	NA	NA
WP_005687181.1|787702_788974_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	43.7	5.5e-86
WP_095691916.1|789379_790318_-	cation transporter	NA	NA	NA	NA	NA
WP_005687178.1|790492_790828_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005687176.1|790978_791908_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_005687175.1|792021_793800_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_005687173.1|793821_796233_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.8	7.6e-12
WP_005687172.1|796380_797826_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_095691917.1|797818_798988_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_005687169.1|798984_800127_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_005687167.1|800156_802220_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_005687165.1|802581_803613_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_005687160.1|803764_804667_-	sortase	NA	NA	NA	NA	NA
WP_005687159.1|805039_805870_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	28.2	1.1e-18
WP_005687156.1|805973_807905_-	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_005687154.1|808207_808609_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_005687152.1|809249_811400_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.4	4.9e-119
WP_024129339.1|811809_812574_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_005687147.1|812730_813624_+	LCP family protein	NA	NA	NA	NA	NA
WP_047677329.1|813722_814748_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.6	4.0e-71
WP_157738303.1|815023_816037_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005688202.1|816566_817787_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	47.8	1.3e-100
WP_005688200.1|817794_818532_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.8	3.7e-58
WP_005688196.1|820298_821288_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_005688194.1|821508_822510_-	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_015764803.1|823906_825322_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_005686263.1|825655_826564_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014569018.1|826670_828167_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_005686262.1|828236_829478_-	O-antigen ligase domain-containing protein	NA	NA	NA	NA	NA
WP_005686261.1|829566_830358_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_032952311.1|830383_831334_-	DUF1792 domain-containing protein	NA	NA	NA	NA	NA
WP_014569018.1|832129_833626_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP006804	Lactobacillus rhamnosus DSM 14870 chromosome, complete genome	3013149	1127937	1224429	3013149	bacteriocin,transposase,protease,tRNA	Bacillus_phage(16.67%)	86	NA	NA
WP_005686132.1|1127937_1129344_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.3	8.0e-54
WP_005686130.1|1129487_1130363_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005686127.1|1131349_1132744_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_005686125.1|1132868_1133438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686122.1|1134073_1135567_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005686120.1|1136117_1136948_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005686116.1|1137974_1138361_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005686114.1|1138553_1139870_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_005686113.1|1140182_1141298_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_095691933.1|1141318_1142683_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_005686110.1|1142702_1143242_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.0	4.4e-37
WP_005686109.1|1143911_1144202_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005686107.1|1144496_1145816_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.8	1.8e-63
WP_005686106.1|1145960_1147307_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.7	4.8e-72
WP_005686104.1|1147523_1148624_+	ABC transporter	NA	NA	NA	NA	NA
WP_031546649.1|1148620_1149817_+	ABC transporter	NA	NA	NA	NA	NA
WP_005686102.1|1149830_1150706_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	2.1e-12
WP_005686100.1|1150857_1152912_+	KUP/HAK/KT family potassium transporter	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	33.1	7.3e-64
WP_005686099.1|1153118_1155749_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.5	1.2e-82
WP_077167350.1|1156048_1156636_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005686097.1|1156807_1157479_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_005686096.1|1157635_1158754_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_005686095.1|1158772_1159057_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_005686094.1|1159302_1160418_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005686092.1|1160580_1160790_-	CsbD family protein	NA	NA	NA	NA	NA
WP_005686089.1|1162100_1162358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686086.1|1162547_1162754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686084.1|1162953_1163208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095691935.1|1163881_1164669_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003582473.1|1165043_1165592_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_003582479.1|1165601_1165823_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_005688109.1|1165864_1167763_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.2	1.0e-104
WP_005688111.1|1167968_1168640_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031547128.1|1168644_1169892_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005688112.1|1169869_1170613_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.5e-27
WP_003587210.1|1170859_1171327_-	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	29.2	1.6e-06
WP_031547132.1|1171447_1172131_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.9	8.1e-60
WP_005688133.1|1172145_1172328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003589707.1|1172448_1172727_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003589709.1|1172728_1173088_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003589711.1|1173241_1174111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031547137.1|1174113_1175352_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_094515910.1|1176190_1176978_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015764702.1|1177066_1178299_+	MFS transporter	NA	NA	NA	NA	NA
WP_005687875.1|1178368_1179625_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.6	7.8e-109
WP_005687874.1|1179706_1180543_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	1.3e-46
WP_005687872.1|1180991_1181177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687870.1|1181750_1182293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687869.1|1182521_1183346_-	class C sortase	NA	NA	NA	NA	NA
WP_005687867.1|1183352_1184906_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_005687865.1|1184896_1186252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031547018.1|1186253_1189205_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_005687861.1|1189479_1190037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687860.1|1190205_1191414_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_031547020.1|1191606_1192662_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_005687856.1|1192953_1193604_+	helix-turn-helix transcriptional regulator	NA	B5LPU3	Bacillus_virus	42.3	3.4e-07
WP_005687855.1|1193734_1194067_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005687853.1|1194063_1194849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687851.1|1195695_1195986_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_107755086.1|1197496_1198390_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	1.9e-37
WP_014569708.1|1198341_1198878_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005686876.1|1198973_1200329_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_005686874.1|1200508_1200919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031547267.1|1200979_1202359_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_005686870.1|1202371_1204564_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.5	2.8e-37
WP_014569018.1|1205445_1206942_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_005686865.1|1208059_1208836_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_133065326.1|1208996_1209239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686864.1|1209949_1210195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031546828.1|1210444_1210744_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005686855.1|1210921_1211080_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_005686851.1|1211548_1211734_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_005686849.1|1211793_1211979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686847.1|1212364_1212550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686845.1|1212599_1213406_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005686843.1|1213726_1214167_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_005686841.1|1214221_1215649_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.7	6.1e-33
WP_005686839.1|1215821_1216154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095691936.1|1216444_1216786_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005686835.1|1216960_1217914_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005686833.1|1218383_1219118_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005686831.1|1219147_1220293_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_005686829.1|1220317_1220635_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_005686828.1|1220684_1222064_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_005686826.1|1222239_1222983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005688202.1|1223208_1224429_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	47.8	1.3e-100
>prophage 4
NZ_CP006804	Lactobacillus rhamnosus DSM 14870 chromosome, complete genome	3013149	1710198	1773681	3013149	transposase,protease,tRNA	Bacillus_phage(20.0%)	52	NA	NA
WP_014568881.1|1710198_1711695_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_095691950.1|1711909_1712620_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_005685728.1|1712897_1713683_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005685727.1|1714014_1714275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005685725.1|1714285_1714462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005685724.1|1714796_1715573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005685723.1|1715584_1716766_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	31.3	5.5e-32
WP_005685722.1|1717146_1718214_+	transporter	NA	NA	NA	NA	NA
WP_005685721.1|1718206_1718896_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	6.1e-39
WP_005685720.1|1718882_1720076_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005685719.1|1720237_1721473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095691951.1|1721572_1729378_-	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_005685716.1|1729661_1730831_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_005685715.1|1730897_1731680_-	carbon-nitrogen family hydrolase	NA	M1I0M9	Paramecium_bursaria_Chlorella_virus	26.4	1.1e-07
WP_005685714.1|1731709_1732549_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005685712.1|1733270_1734356_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005685711.1|1734732_1734909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005685710.1|1734901_1735099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570246.1|1735298_1736498_-	amidohydrolase	NA	NA	NA	NA	NA
WP_005685707.1|1736983_1737748_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_005685704.1|1738298_1738517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570247.1|1738816_1740436_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	6.0e-13
WP_031546893.1|1740562_1742464_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_005716635.1|1742504_1743893_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_014570250.1|1744243_1745011_-	protein jag	NA	NA	NA	NA	NA
WP_005685695.1|1745028_1745865_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_005685694.1|1745894_1746251_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003568442.1|1746845_1746986_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_014570251.1|1747203_1748661_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_005685692.1|1749385_1750735_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_031546891.1|1750908_1752048_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	34.4	5.9e-15
WP_014568869.1|1752541_1752754_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_014568870.1|1752750_1753869_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_005690389.1|1753900_1755862_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.8	8.1e-145
WP_014568871.1|1755924_1758537_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	33.2	3.2e-112
WP_005690384.1|1759229_1759460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014568872.1|1759863_1760067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005685679.1|1760188_1760281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005690380.1|1760390_1760822_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	44.8	3.7e-26
WP_005685677.1|1760948_1761245_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005709832.1|1761274_1761865_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	59.7	3.1e-52
WP_003568467.1|1761956_1762193_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005685670.1|1762586_1763093_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_031546884.1|1763403_1764882_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_014568875.1|1764874_1765894_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005707490.1|1765933_1766128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014568877.1|1766619_1767636_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_014568879.1|1768671_1769349_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_049166548.1|1769740_1770616_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014568883.1|1770974_1771238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095691997.1|1771378_1772167_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014569018.1|1772184_1773681_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP006804	Lactobacillus rhamnosus DSM 14870 chromosome, complete genome	3013149	1945865	1964619	3013149	transposase	Staphylococcus_phage(50.0%)	20	NA	NA
WP_095691957.1|1945865_1946786_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	1.5e-21
WP_031547123.1|1947136_1948693_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_095691958.1|1949535_1950210_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	3.3e-58
WP_095691959.1|1950259_1951046_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_005688360.1|1951553_1952708_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_095691959.1|1952716_1953504_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016370636.1|1953567_1953864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002819873.1|1954121_1954403_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003606251.1|1954392_1954899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606249.1|1954888_1955167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080978442.1|1955189_1955417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095691960.1|1957161_1957948_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011669024.1|1958038_1958893_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003645003.1|1958913_1959654_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	3.0e-36
WP_011669022.1|1959646_1960336_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003645001.1|1960316_1960979_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_016370641.1|1961325_1962075_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_049166487.1|1962271_1962952_+	VIT family protein	NA	NA	NA	NA	NA
WP_016372605.1|1962984_1963689_+	VIT family protein	NA	NA	NA	NA	NA
WP_095691961.1|1963935_1964619_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	5.2e-59
>prophage 6
NZ_CP006804	Lactobacillus rhamnosus DSM 14870 chromosome, complete genome	3013149	2744667	2799649	3013149	tail,capsid,integrase,portal,head,terminase,tRNA	Staphylococcus_phage(22.22%)	57	2738371:2738386	2793755:2793770
2738371:2738386	attL	AGCACAACGCCGGATG	NA	NA	NA	NA
WP_005684560.1|2744667_2745132_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_005684561.1|2745337_2746234_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	1.1e-24
WP_005684562.1|2746226_2747486_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014569383.1|2747673_2748216_-	exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	41.0	8.2e-23
WP_031545838.1|2748227_2748986_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	48.1	4.8e-61
WP_005684565.1|2749167_2750031_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_005684567.1|2750067_2752182_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_005684568.1|2752406_2752946_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005684569.1|2752959_2754048_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	46.0	1.4e-37
WP_005684570.1|2754141_2754966_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.7	8.9e-13
WP_005684571.1|2754955_2755789_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005684572.1|2755772_2756846_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005684573.1|2757298_2757565_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005684574.1|2757825_2758017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031545846.1|2758147_2760940_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.5	5.3e-73
WP_005684576.1|2761015_2761696_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005684578.1|2761729_2762869_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005684579.1|2762858_2763593_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	9.7e-27
WP_005684581.1|2763856_2764714_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_005684582.1|2764710_2765808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005684583.1|2765836_2767201_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_005684584.1|2767629_2769441_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1GV45	Paramecium_bursaria_Chlorella_virus	38.1	6.2e-91
WP_005684585.1|2769590_2771396_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_005684586.1|2771469_2771961_+	VanZ family protein	NA	NA	NA	NA	NA
WP_005684587.1|2772031_2772763_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005684588.1|2773139_2774009_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_005684589.1|2774005_2774959_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005684590.1|2774961_2775282_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_005684592.1|2775278_2775701_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_005684594.1|2775670_2775982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005684595.1|2775941_2776409_+	ComGF family competence protein	NA	NA	NA	NA	NA
WP_005684596.1|2776405_2776729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005684598.1|2778437_2778893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005684599.1|2779107_2780472_+	amino acid permease	NA	NA	NA	NA	NA
WP_005684600.1|2780504_2781269_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_005684602.1|2781265_2782105_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_005684603.1|2782105_2783062_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_005684604.1|2783058_2783943_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_049166470.1|2784155_2786450_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_013245598.1|2787116_2788265_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	29.6	9.2e-32
WP_048481301.1|2788428_2789001_-	helix-turn-helix domain-containing protein	NA	E9LUL4	Lactobacillus_phage	38.0	7.3e-06
WP_013245601.1|2789136_2789412_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013245602.1|2789481_2789703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013245604.1|2789813_2790005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013245605.1|2790049_2790325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013245606.1|2790321_2790510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043925799.1|2790493_2791321_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	31.8	2.6e-12
WP_095691979.1|2791313_2792738_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	38.1	3.0e-64
WP_013245609.1|2793010_2793352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013245610.1|2793434_2793809_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	39.8	4.9e-11
2793755:2793770	attR	AGCACAACGCCGGATG	NA	NA	NA	NA
WP_013245611.1|2793933_2794404_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	29.3	1.6e-06
WP_013245612.1|2794400_2796104_+|terminase	terminase	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	41.7	7.3e-118
WP_013245613.1|2796069_2796249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013245614.1|2796253_2797438_+|portal	phage portal protein	portal	E9LUI2	Lactobacillus_phage	32.9	2.2e-52
WP_013245615.1|2797424_2798978_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.8	1.9e-40
WP_003586097.1|2799033_2799324_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_013245616.1|2799307_2799649_+|head	phage head closure protein	head	I7AUE6	Enterococcus_phage	38.4	1.2e-08
