The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023054	Vibrio anguillarum strain VIB43 chromosome 1, complete sequence	3239943	110189	128130	3239943	transposase,integrase,protease	Leptospira_phage(62.5%)	22	110527:110542	130981:130996
WP_069212063.1|110189_111722_-|transposase	IS66-like element ISVa9 family transposase	transposase	S5VTP8	Leptospira_phage	39.5	9.4e-24
110527:110542	attL	TGCGTGGTTAACCAGT	NA	NA	NA	NA
WP_069212062.1|111781_112135_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.1	1.8e-15
WP_081245520.1|112131_112452_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_095661214.1|112503_113985_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	35.0	1.4e-61
WP_095661215.1|114071_114332_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	39.0	6.9e-12
WP_069211897.1|114344_115877_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_019283195.1|115936_116290_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_019283194.1|116286_116607_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019282914.1|116683_116803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282915.1|116796_117105_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_095661216.1|117129_118485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157731292.1|118481_119135_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_064624027.1|119230_120274_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_095661217.1|120294_121017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010316906.1|121588_121855_-	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
WP_029388401.1|121851_122451_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_095661218.1|122665_123844_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_010316903.1|123906_124581_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.8	4.4e-26
WP_013855492.1|124570_125539_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_013855491.1|125714_126572_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.7	1.5e-42
WP_010316900.1|126967_127288_+	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_019283013.1|127296_128130_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
130981:130996	attR	TGCGTGGTTAACCAGT	NA	NA	NA	NA
>prophage 2
NZ_CP023054	Vibrio anguillarum strain VIB43 chromosome 1, complete sequence	3239943	406211	471689	3239943	integrase,transposase,tRNA,protease	Indivirus(14.29%)	57	460160:460177	476467:476484
WP_029388402.1|406211_407519_+|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
WP_017047084.1|407605_408577_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	22.7	7.8e-08
WP_010320620.1|408849_409161_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_010320621.1|409182_409440_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_017045397.1|409661_410834_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_013857840.1|410950_411712_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_013857839.1|411699_412188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017045398.1|412231_412714_+	type 3 dihydrofolate reductase	NA	V9LZM6	Vibrio_phage	42.2	2.0e-33
WP_017045399.1|412760_413576_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	44.6	1.8e-05
WP_013857836.1|413587_413968_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_013857835.1|414028_414835_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017043800.1|414848_415841_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_019282297.1|415830_417126_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_029388238.1|417182_419552_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_019282296.1|419701_420556_+	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_013857830.1|422084_423215_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	34.3	3.7e-09
WP_010320634.1|423293_423566_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_013857828.1|423587_424643_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_026027213.1|424818_425538_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_026028230.1|425681_426602_+	glutaminase B	NA	NA	NA	NA	NA
WP_019282295.1|426683_427841_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017042394.1|427840_428440_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_013857823.1|428452_428884_-	DUF4426 domain-containing protein	NA	NA	NA	NA	NA
WP_029388237.1|429846_430665_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_019282293.1|430726_431428_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010320646.1|431453_432491_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_069211910.1|432501_433608_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_019282292.1|433706_434135_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017045507.1|434217_434781_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_043004432.1|434827_435781_-	glutathione synthase	NA	NA	NA	NA	NA
WP_019282290.1|435794_436526_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_013857813.1|436634_437342_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_019282289.1|437475_437976_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_010320654.1|438043_439198_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.5	9.3e-125
WP_095661221.1|439473_441537_+	transketolase	NA	NA	NA	NA	NA
WP_019282284.1|441600_442503_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017047513.1|442646_444602_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	28.3	1.3e-09
WP_026027970.1|444801_445827_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_026027969.1|445975_447139_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_013857804.1|447292_448369_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_094128468.1|448662_449526_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_017047512.1|449600_450233_-	amino acid transporter	NA	NA	NA	NA	NA
WP_017045436.1|450355_451252_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_017047511.1|451336_452047_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_019282286.1|452212_454078_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_029388402.1|454242_455550_+|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
WP_029388154.1|455604_457017_-	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_019281933.1|457441_458203_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017045440.1|458290_460123_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HRE7	Paramecium_bursaria_Chlorella_virus	44.4	1.4e-130
460160:460177	attL	AATAAAGTATCATACTAA	NA	NA	NA	NA
WP_095661222.1|460589_462281_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_095661223.1|462304_463087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095661224.1|463087_464095_-	response regulator	NA	NA	NA	NA	NA
WP_095661225.1|464096_466553_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_095661226.1|466557_466983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064624027.1|467352_468396_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_095661227.1|468784_469615_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_095661228.1|469598_471689_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
476467:476484	attR	TTAGTATGATACTTTATT	NA	NA	NA	NA
>prophage 3
NZ_CP023054	Vibrio anguillarum strain VIB43 chromosome 1, complete sequence	3239943	814302	821373	3239943		Faustovirus(16.67%)	9	NA	NA
WP_013857499.1|814302_815517_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.4	2.4e-30
WP_010320409.1|815573_815957_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	1.8e-53
WP_010320408.1|816019_816343_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	53.3	3.6e-26
WP_026028094.1|816409_816925_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_019282106.1|816946_818800_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	3.2e-111
WP_010320405.1|818811_819150_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_010320404.1|819200_819395_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_026028095.1|819579_820875_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.5	1.1e-33
WP_013857494.1|820947_821373_+	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	41.4	2.7e-21
>prophage 4
NZ_CP023054	Vibrio anguillarum strain VIB43 chromosome 1, complete sequence	3239943	856801	918565	3239943	transposase	Leptospira_phage(28.57%)	59	NA	NA
WP_076611988.1|856801_857971_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_019282089.1|858513_859101_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_095661212.1|859516_860666_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_069211897.1|862073_863606_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_019283195.1|863665_864019_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_019283194.1|864015_864336_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_013857456.1|865675_865996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019282087.1|866496_866724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095661254.1|866771_867140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282926.1|867136_867904_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_019282927.1|868042_868219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282928.1|868222_868666_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_019282929.1|868716_869160_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_095661255.1|869150_869624_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_081245535.1|869752_869968_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.3	7.7e-09
WP_095661212.1|870477_871628_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_122621519.1|871677_872157_+	HNH endonuclease	NA	A0A2D2W4Q9	Gordonia_phage	40.6	1.4e-05
WP_019283403.1|872224_873391_+	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	31.9	4.5e-42
WP_095661257.1|873478_876538_+	sensor histidine kinase	NA	A0A1B5FPD5	Escherichia_phage	33.5	1.5e-84
WP_019283401.1|876530_878387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069211897.1|879616_881149_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_019283195.1|881208_881562_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_019283194.1|881558_881879_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_095661258.1|883849_884080_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	47.5	4.4e-10
WP_019281723.1|885562_886204_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_019281724.1|886237_887224_-	GTPase family protein	NA	NA	NA	NA	NA
WP_019281725.1|887330_887777_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_019281726.1|887827_888256_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_019281727.1|888252_888729_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_095661259.1|888842_889049_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	46.6	2.5e-09
WP_095661260.1|889195_891619_-	sialidase	NA	NA	NA	NA	NA
WP_019281730.1|891962_893099_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_019281731.1|893102_893966_-	ROK family protein	NA	NA	NA	NA	NA
WP_095661261.1|893953_894676_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_095661262.1|894566_894860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019281732.1|894890_895856_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_095661341.1|895909_896431_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_020327936.1|896436_897720_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_019281734.1|897757_898657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019281735.1|898787_899624_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019281736.1|899814_900966_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_019281737.1|900980_902048_+	YjhT family mutarotase	NA	NA	NA	NA	NA
WP_088720988.1|902241_903096_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_019282482.1|903086_904295_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_019282483.1|904284_904725_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_019282484.1|904783_905668_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_019282485.1|905657_906434_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_019282486.1|906451_906925_-	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_019282487.1|906947_908105_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_019282488.1|908104_909412_-	D-tagatose-bisphosphate aldolase, class II, non-catalytic subunit	NA	NA	NA	NA	NA
WP_019282489.1|909420_910197_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_019282490.1|910622_911390_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_019282493.1|912155_912578_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_019282494.1|912627_913071_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_019282495.1|913061_913535_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_019282496.1|913951_914812_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_019282497.1|914950_916984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095661263.1|916976_917384_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_095661264.1|917387_918565_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.8	5.6e-117
>prophage 5
NZ_CP023054	Vibrio anguillarum strain VIB43 chromosome 1, complete sequence	3239943	1056683	1210374	3239943	transposase,tRNA,bacteriocin	Leptospira_phage(27.59%)	114	NA	NA
WP_013857327.1|1056683_1058108_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017049487.1|1058365_1059517_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_010317358.1|1059596_1060106_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_013857325.1|1060212_1061937_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	25.8	1.9e-17
WP_026027491.1|1062075_1062333_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013857323.1|1062631_1063600_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.5	3.9e-68
WP_069211918.1|1063757_1064510_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_019282600.1|1064740_1065565_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_019282601.1|1065625_1067641_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	47.9	5.2e-139
WP_019282602.1|1068146_1069190_+	chitoporin	NA	NA	NA	NA	NA
WP_029388306.1|1069265_1070069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064624027.1|1070173_1071217_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_019282246.1|1071234_1071654_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_013857315.1|1071775_1072243_-	NfeD family protein	NA	NA	NA	NA	NA
WP_013857314.1|1072250_1073174_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_069212223.1|1073482_1074337_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_103261287.1|1074470_1074536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013857312.1|1074736_1075651_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_029388234.1|1075879_1076437_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_017045494.1|1076454_1076733_-	SelT/SelW/SelH family protein	NA	NA	NA	NA	NA
WP_013857309.1|1076817_1077369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017045495.1|1077343_1078210_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_019282244.1|1078467_1080375_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.3	1.7e-107
WP_013857306.1|1080693_1081338_+	adenylate kinase	NA	NA	NA	NA	NA
WP_019282243.1|1081453_1082419_+	ferrochelatase	NA	NA	NA	NA	NA
WP_069211897.1|1083053_1084586_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_019283195.1|1084645_1084999_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_019283194.1|1084995_1085316_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_029388402.1|1086269_1087577_-|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
WP_013857303.1|1088014_1088515_+	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
WP_017045499.1|1088596_1090261_-	asparagine synthase B	NA	A0A1X9VNR2	Mimivirus	40.8	5.3e-89
WP_019282279.1|1090533_1092120_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_026028126.1|1092219_1093434_-	ROK family protein	NA	NA	NA	NA	NA
WP_026028127.1|1093436_1094573_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_013857296.1|1095062_1096550_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_019282278.1|1096878_1098549_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	81.7	2.4e-275
WP_069212093.1|1098775_1103332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026027499.1|1103502_1104297_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_013857293.1|1104472_1105399_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_019282276.1|1105443_1106709_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_013857291.1|1106709_1107255_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_019282275.1|1107316_1107808_+|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
WP_013857289.1|1107841_1109356_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.7	3.2e-85
WP_017048031.1|1109438_1110764_-	Na+/H+ antiporter family protein	NA	NA	NA	NA	NA
WP_010318472.1|1110785_1111445_-	ribonuclease T	NA	L0N6K9	Acaryochloris_phage	25.3	6.5e-06
WP_010318471.1|1111647_1112529_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017043475.1|1112636_1113053_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_095661212.1|1113280_1114431_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_095661268.1|1115481_1115835_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	47.3	6.5e-13
WP_017037717.1|1115831_1116149_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_095661269.1|1116335_1126955_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_095661270.1|1127073_1128387_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_095661271.1|1128379_1130512_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	27.8	6.7e-12
WP_095661272.1|1130508_1132155_-	ABC transporter	NA	NA	NA	NA	NA
WP_076611988.1|1132405_1133575_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_095661273.1|1134000_1135549_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_095661274.1|1135848_1136070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081245520.1|1136137_1136458_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_069212062.1|1136454_1136808_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.1	1.8e-15
WP_069212063.1|1136867_1138400_+|transposase	IS66-like element ISVa9 family transposase	transposase	S5VTP8	Leptospira_phage	39.5	9.4e-24
WP_081245526.1|1138652_1140473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095661212.1|1140509_1141660_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_029388395.1|1141719_1142217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069211897.1|1144616_1146149_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_019283195.1|1146208_1146562_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_019283194.1|1146558_1146879_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_069212076.1|1146955_1147648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019283220.1|1147772_1148408_-	endonuclease III	NA	NA	NA	NA	NA
WP_029388436.1|1148435_1149128_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_013857283.1|1149120_1149759_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_069212075.1|1149767_1150814_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_069212074.1|1150813_1153144_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_013857280.1|1153152_1153740_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_010318463.1|1153741_1154323_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_017045634.1|1154480_1155188_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_019281795.1|1155327_1157409_-	TonB-dependent siderophore vanchrobactin receptor FvtA	NA	NA	NA	NA	NA
WP_019281793.1|1157573_1158914_+	vanchrobactin esterase VabH	NA	NA	NA	NA	NA
WP_019281792.1|1158935_1159130_+	MbtH family protein	NA	NA	NA	NA	NA
WP_019281791.1|1159235_1167722_+	vanchrobactin non-ribosomal peptide synthetase VabF	NA	A0A2K9L3I8	Tupanvirus	22.8	3.6e-56
WP_019281790.1|1167824_1169138_+	vanchrobactin export MFS transporter VabS	NA	NA	NA	NA	NA
WP_019281789.1|1169287_1170325_+	isochorismatase	NA	NA	NA	NA	NA
WP_081245437.1|1170437_1172069_-	2,3-dihydroxybenzoate-AMP ligase VabE	NA	NA	NA	NA	NA
WP_019281787.1|1172072_1173260_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_069212073.1|1173436_1174213_+	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_019281786.1|1174272_1175349_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	42.1	1.6e-70
WP_029388129.1|1175590_1176541_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050934211.1|1176728_1178591_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	28.8	2.1e-09
WP_019281783.1|1178653_1179535_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_029388128.1|1179667_1180555_+	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	28.6	2.0e-18
WP_069212077.1|1180679_1181573_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019281855.1|1181629_1182538_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	60.8	9.3e-104
WP_157731298.1|1182742_1183858_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_069212183.1|1183860_1186932_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	22.5	1.1e-26
WP_019282885.1|1187212_1188304_-	alkene reductase	NA	NA	NA	NA	NA
WP_017044375.1|1188314_1188944_-	glutaredoxin, GrxB family	NA	NA	NA	NA	NA
WP_019282886.1|1189025_1190213_-	MFS transporter	NA	NA	NA	NA	NA
WP_019282887.1|1190293_1190962_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019282888.1|1191081_1192014_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029189720.1|1192716_1194747_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_026028983.1|1194988_1196395_+	sigma-54-dependent Fis family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	26.1	2.8e-06
WP_013857261.1|1196397_1196736_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_013857260.1|1196732_1197623_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	29.5	1.3e-25
WP_013857259.1|1197918_1198923_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_010320682.1|1198990_1199503_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_010320681.1|1199513_1200014_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_010320680.1|1200006_1200252_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_019282889.1|1200251_1200725_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_013857257.1|1200721_1201687_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_013857256.1|1201961_1202378_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_064624027.1|1202557_1203601_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_069212106.1|1203763_1206058_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	37.3	3.3e-121
WP_019283111.1|1206392_1207151_+	uridine phosphorylase	NA	NA	NA	NA	NA
WP_013857254.1|1207278_1208091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019283110.1|1208307_1210374_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	30.1	2.0e-61
>prophage 6
NZ_CP023054	Vibrio anguillarum strain VIB43 chromosome 1, complete sequence	3239943	1395822	1466268	3239943	transposase,tRNA,protease	Burkholderia_phage(14.29%)	60	NA	NA
WP_013857104.1|1395822_1396944_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_013857103.1|1397143_1397413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019281970.1|1397515_1398820_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_017043902.1|1398877_1399291_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_029388167.1|1400009_1401611_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_026027608.1|1401994_1402891_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_019281968.1|1402896_1404195_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_017043905.1|1404194_1405235_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_019281967.1|1405316_1406390_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_019281966.1|1406389_1407067_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_019281965.1|1407080_1407818_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	A0A2H4UVM0	Bodo_saltans_virus	24.0	1.3e-07
WP_017044649.1|1407799_1408573_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_017043909.1|1408569_1409205_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_019281964.1|1409256_1410042_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_029388165.1|1410301_1412527_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_013857087.1|1412606_1412828_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	3.3e-15
WP_010319243.1|1413301_1413622_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.2	1.6e-13
WP_013857086.1|1413664_1415935_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.7	6.4e-170
WP_006075347.1|1416077_1416296_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_013857085.1|1416377_1417076_-	arginyltransferase	NA	NA	NA	NA	NA
WP_019281962.1|1417078_1417795_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_029388164.1|1418000_1419281_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_013857082.1|1419341_1419593_-	YciN family protein	NA	NA	NA	NA	NA
WP_019281959.1|1420123_1422754_+	type I DNA topoisomerase	NA	A0A2P1ELA0	Moumouvirus	33.8	6.7e-86
WP_076611988.1|1422815_1423985_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_013857078.1|1424768_1425986_+	glucose-1-phosphate adenylyltransferase	NA	A0A1D7XFC1	Escherichia_phage	28.2	8.3e-07
WP_019282197.1|1425987_1427442_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_019282196.1|1427575_1428376_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_029388226.1|1428691_1429372_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_013857073.1|1429520_1430108_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_010319453.1|1430469_1431477_-	HTH-type transcriptional repressor PurR	NA	NA	NA	NA	NA
WP_069212048.1|1431746_1432394_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_069212047.1|1432681_1433395_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	30.3	2.4e-22
WP_013857069.1|1433520_1434345_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_017044660.1|1434433_1435225_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_019282193.1|1435227_1436565_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_088721158.1|1436524_1437277_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_019282192.1|1437273_1441731_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_019282191.1|1441810_1442788_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_019282190.1|1442790_1444296_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_029388225.1|1444310_1445063_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_019282189.1|1445202_1446174_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_019282188.1|1446268_1447012_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_069212046.1|1447112_1447979_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	48.8	2.3e-27
WP_019282187.1|1448255_1450031_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	26.2	1.2e-09
WP_026028832.1|1450151_1450730_+	thymidine kinase	NA	A0A2H4YFP5	Citrobacter_phage	54.7	3.3e-54
WP_019282186.1|1450792_1452181_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.8	4.2e-47
WP_019282185.1|1452344_1452977_-	YdcF family protein	NA	NA	NA	NA	NA
WP_019282184.1|1452969_1453800_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_019282183.1|1453832_1454723_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013857051.1|1454819_1455263_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_010318620.1|1455327_1455561_-	TIGR02647 family protein	NA	NA	NA	NA	NA
WP_026028023.1|1455863_1456718_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_010318622.1|1457358_1457535_+	trimethylamine N-oxide reductase system protein TorE	NA	NA	NA	NA	NA
WP_026028567.1|1457586_1458771_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_019282182.1|1458795_1461258_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	28.7	6.1e-73
WP_019282181.1|1461463_1463200_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_019282180.1|1463393_1464299_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_019282179.1|1464399_1464792_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_076611988.1|1465098_1466268_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
>prophage 7
NZ_CP023054	Vibrio anguillarum strain VIB43 chromosome 1, complete sequence	3239943	1643686	1661125	3239943	transposase	Vibrio_phage(88.24%)	23	NA	NA
WP_019283195.1|1643686_1644040_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_069211897.1|1644099_1645632_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_081317734.1|1645652_1646489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019281835.1|1646501_1646777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069212261.1|1646815_1647010_+	hypothetical protein	NA	G8IRU7	Vibrio_phage	73.0	3.9e-20
WP_017041960.1|1647039_1647258_+	hypothetical protein	NA	R9TRU5	Vibrio_phage	60.6	2.7e-09
WP_069212260.1|1647392_1648745_+	hypothetical protein	NA	G8IRU9	Vibrio_phage	25.2	9.5e-20
WP_103261276.1|1648885_1649089_+	DUF2523 domain-containing protein	NA	Q64EV1	Vibrio_phage	59.7	3.1e-15
WP_019281855.1|1649479_1650388_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	60.8	9.3e-104
WP_013867780.1|1651707_1651896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282269.1|1652173_1652416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019282270.1|1652494_1652785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095661283.1|1652876_1653245_+	phage protein	NA	Q9MCC4	Vibrio_phage	63.0	1.4e-37
WP_157731300.1|1653263_1654073_-	hypothetical protein	NA	A0A2I7RV58	Vibrio_phage	43.9	1.2e-06
WP_095661285.1|1655061_1656426_-	toxin	NA	R9TQ09	Vibrio_phage	67.6	5.0e-162
WP_095661286.1|1656428_1656773_-	DUF2523 domain-containing protein	NA	Q64EV1	Vibrio_phage	63.0	6.3e-21
WP_095661287.1|1656772_1658131_-	hypothetical protein	NA	G8IRU9	Vibrio_phage	29.0	1.4e-26
WP_095661288.1|1658268_1658490_-	hypothetical protein	NA	R9TRU5	Vibrio_phage	53.8	4.4e-07
WP_095661342.1|1658519_1658714_-	hypothetical protein	NA	G8IRU7	Vibrio_phage	71.4	2.5e-19
WP_095661289.1|1658761_1659070_-	hypothetical protein	NA	G8IRU6	Vibrio_phage	53.2	5.1e-22
WP_095661290.1|1659071_1660310_-	replication protein	NA	G8IRU5	Vibrio_phage	57.2	2.6e-133
WP_095661291.1|1660302_1660521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095661292.1|1660756_1661125_+	hypothetical protein	NA	G8IRV4	Vibrio_phage	68.6	2.2e-40
>prophage 8
NZ_CP023054	Vibrio anguillarum strain VIB43 chromosome 1, complete sequence	3239943	1848575	1879328	3239943	plate,transposase	Shigella_phage(50.0%)	23	NA	NA
WP_064624027.1|1848575_1849619_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_088721225.1|1850682_1852231_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013856705.1|1852652_1853657_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013856704.1|1853861_1854344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013856703.1|1854327_1855116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282908.1|1855244_1855772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282907.1|1855725_1856436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088732546.1|1856758_1857936_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.5	2.3e-115
WP_013856699.1|1858313_1860203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013856698.1|1860218_1860857_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_019282546.1|1860859_1864312_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_013856696.1|1864313_1865456_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_019282547.1|1865463_1866780_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_019282548.1|1866779_1867247_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_029189804.1|1867246_1868194_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_019282549.1|1868227_1868923_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013856691.1|1868925_1870059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282550.1|1870055_1872251_-	MFS transporter	NA	NA	NA	NA	NA
WP_013856689.1|1872260_1873415_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_019282551.1|1873557_1876164_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.3	2.9e-81
WP_019282552.1|1876172_1877156_-	type VI secretion system protein	NA	NA	NA	NA	NA
WP_069211972.1|1877137_1878919_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_013856685.1|1878911_1879328_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 9
NZ_CP023054	Vibrio anguillarum strain VIB43 chromosome 1, complete sequence	3239943	2142858	2180383	3239943	transposase	Acinetobacter_phage(28.57%)	33	NA	NA
WP_076611988.1|2142858_2144028_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_157731304.1|2144632_2145565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095661212.1|2145536_2146687_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_095661307.1|2148120_2148471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069212230.1|2148955_2149819_-	DMT family transporter	NA	NA	NA	NA	NA
WP_019282198.1|2149978_2150587_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_029388227.1|2150613_2151990_-	GntP family permease	NA	NA	NA	NA	NA
WP_013856467.1|2152150_2152684_+	gluconokinase	NA	NA	NA	NA	NA
WP_019282200.1|2152680_2154492_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_026027817.1|2154562_2155570_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095661308.1|2155864_2156368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094145483.1|2156437_2157004_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_081245303.1|2157180_2158776_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_081245304.1|2158772_2159474_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_026027818.1|2159759_2161418_+	putative transporter	NA	NA	NA	NA	NA
WP_013856459.1|2161525_2162110_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017050939.1|2162215_2162659_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_095661309.1|2164113_2164434_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|2164430_2164784_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	3.1e-15
WP_069211897.1|2164843_2166376_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_081245306.1|2166874_2168287_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_013856454.1|2168276_2168933_-	response regulator	NA	W8CYM9	Bacillus_phage	32.3	6.0e-28
WP_081245307.1|2168936_2169590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081245308.1|2169593_2170391_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_081245310.1|2171123_2172623_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	27.8	4.0e-19
WP_013856449.1|2172633_2173242_-	delta-VPH	NA	NA	NA	NA	NA
WP_064624027.1|2173564_2174608_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_081245312.1|2174718_2175204_+	VOC family protein	NA	NA	NA	NA	NA
WP_095661212.1|2175532_2176683_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_069212266.1|2176711_2178064_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_017045291.1|2178057_2178603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017045290.1|2178703_2179012_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064624027.1|2179339_2180383_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP023054	Vibrio anguillarum strain VIB43 chromosome 1, complete sequence	3239943	2526909	2533533	3239943		Staphylococcus_phage(66.67%)	7	NA	NA
WP_026027639.1|2526909_2527380_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	8.4e-32
WP_013856195.1|2527588_2528698_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.3	9.7e-63
WP_013856194.1|2528786_2529443_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.5	5.1e-35
WP_017047324.1|2529444_2530542_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.1	1.8e-48
WP_010320136.1|2530548_2530998_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_019282316.1|2531129_2532380_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.5	3.6e-98
WP_069211885.1|2532393_2533533_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	6.5e-62
>prophage 11
NZ_CP023054	Vibrio anguillarum strain VIB43 chromosome 1, complete sequence	3239943	3139876	3198142	3239943	transposase	Leptospira_phage(26.67%)	46	NA	NA
WP_019281855.1|3139876_3140785_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	60.8	9.3e-104
WP_019281823.1|3141157_3142084_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017046673.1|3142250_3143189_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013855660.1|3143191_3144169_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_026027967.1|3144368_3145925_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019281822.1|3146033_3147749_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	4.1e-20
WP_088718017.1|3149539_3149947_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_019281821.1|3150016_3152035_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	38.0	2.4e-115
WP_013855653.1|3152174_3152786_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017042454.1|3152804_3153911_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_019281820.1|3153922_3157045_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010319855.1|3157167_3157419_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_019281819.1|3157611_3159096_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_013855649.1|3159239_3160130_+	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_095661333.1|3160195_3161590_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_017042451.1|3161728_3162217_-	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_013855646.1|3162225_3162780_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_069212130.1|3162779_3163418_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013855644.1|3163634_3164252_-	cytochrome c4	NA	NA	NA	NA	NA
WP_081245214.1|3164419_3165133_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_029388134.1|3165886_3168679_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.7	1.3e-71
WP_029388133.1|3169413_3170460_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_095661334.1|3170648_3171440_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_076611988.1|3171548_3172718_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A9YX10	Burkholderia_phage	32.8	1.7e-41
WP_019281814.1|3173046_3173799_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.3	3.4e-27
WP_019281813.1|3173859_3174267_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_019281812.1|3174270_3174507_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
WP_013855638.1|3174558_3176193_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	G9E4X0	Ostreococcus_lucimarinus_virus	28.4	3.9e-36
WP_069212131.1|3176189_3176795_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_010319838.1|3176804_3177587_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017048499.1|3177636_3179181_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	64.3	1.2e-15
WP_081245215.1|3179373_3180279_+	DMT family transporter	NA	NA	NA	NA	NA
WP_069212132.1|3180359_3182426_+	GGDEF and EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.1	4.8e-15
WP_017046104.1|3183084_3183417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019281810.1|3183420_3184359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019281809.1|3184393_3185464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282931.1|3186130_3186556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095661335.1|3186856_3188007_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.1	4.4e-50
WP_095661212.1|3189086_3190236_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_069212063.1|3193121_3194654_-|transposase	IS66-like element ISVa9 family transposase	transposase	S5VTP8	Leptospira_phage	39.5	9.4e-24
WP_069212062.1|3194713_3195067_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.1	1.8e-15
WP_081245520.1|3195063_3195384_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_095661336.1|3195563_3195869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081245520.1|3195972_3196293_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_069212062.1|3196289_3196643_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.1	1.8e-15
WP_095661337.1|3196702_3198142_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.8	1.6e-20
>prophage 1
NZ_CP023055	Vibrio anguillarum strain VIB43 chromosome 2, complete sequence	1152744	42964	147373	1152744	plate,transposase	Bacillus_virus(21.43%)	83	NA	NA
WP_064624027.1|42964_44008_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_019283061.1|44718_45645_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	6.5e-20
WP_019283062.1|45644_46607_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017044976.1|46698_47358_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_019283063.1|47362_48412_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	6.2e-35
WP_010318639.1|48408_49212_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_026027756.1|49198_50098_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017044979.1|50097_50901_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_019283064.1|50910_51972_-	solute-binding protein	NA	NA	NA	NA	NA
WP_019283065.1|52184_52937_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_069211907.1|52982_54209_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	9.1e-46
WP_069211908.1|54654_55890_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_017043597.1|56029_56686_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_050934249.1|56902_58639_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_019283066.1|58892_59774_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_019283067.1|59773_61327_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_019283068.1|61472_62078_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_019283069.1|62091_63123_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013868285.1|63206_63812_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019283070.1|63976_66274_-	glycoside hydrolase	NA	NA	NA	NA	NA
WP_019283071.1|66349_67177_-	DUF2861 family protein	NA	NA	NA	NA	NA
WP_013868288.1|67169_67823_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	2.3e-24
WP_069211909.1|67819_69265_-	DUF3404 domain-containing protein	NA	NA	NA	NA	NA
WP_019283072.1|69358_71056_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_064624027.1|71251_72295_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_019283171.1|72729_73818_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_064624027.1|74302_75346_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_095661350.1|75333_75813_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_013868294.1|75859_77338_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013868295.1|77340_77778_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_019282041.1|77784_79554_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_029388193.1|79517_80540_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_019282043.1|80544_82017_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_064624027.1|82156_83200_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_017044997.1|83602_84937_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_026028435.1|84939_85713_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_029388110.1|85736_88355_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.9	3.8e-89
WP_019281680.1|88351_89920_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_019281679.1|89916_90576_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_019281678.1|90585_91983_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_017045001.1|92000_95546_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_019281677.1|95603_96899_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_095661351.1|97066_100264_+	type VI secretion system tip protein VgrG	NA	A0A0X8WP64	Ralstonia_phage	32.1	3.6e-17
WP_019281674.1|100268_100850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019281676.1|101351_101672_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_095661352.1|101668_101935_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_095661353.1|102787_103938_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	2.6e-50
WP_069212062.1|104126_104480_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_069212063.1|104539_106072_+|transposase	IS66-like element ISVa9 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.3e-70
WP_019283474.1|106161_106911_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013868314.1|106968_107925_-	AEC family transporter	NA	NA	NA	NA	NA
WP_019283475.1|108051_108660_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019283476.1|108808_109666_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017048120.1|109860_111246_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_013868318.1|111310_112000_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_064624027.1|112451_113495_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_019283163.1|113507_116057_+	chitinase	NA	B0FDP2	Orgyia_leucostigma_nucleopolyhedrovirus	47.2	1.4e-144
WP_019283164.1|116155_116623_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019283165.1|116619_117483_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.0	3.9e-11
WP_017045015.1|117482_118340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283166.1|118665_120552_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.8	2.0e-15
WP_010316838.1|120713_121448_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019282367.1|121454_122291_+	arginase	NA	NA	NA	NA	NA
WP_013868327.1|122397_124275_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_019282365.1|124588_125344_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_019282364.1|125433_126138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282363.1|126235_128080_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	7.8e-33
WP_019282362.1|128591_129563_+	amidinotransferase	NA	NA	NA	NA	NA
WP_026028163.1|129552_130509_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	34.9	1.4e-14
WP_017042894.1|130628_131051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029189691.1|131239_132121_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017049270.1|132129_132777_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_019282361.1|132782_133604_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_019282360.1|133609_134302_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_019282359.1|134309_134792_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_026028425.1|134869_136630_-	PTS ascorbate-specific subunit IIBC	NA	NA	NA	NA	NA
WP_026027147.1|137020_137776_+	HTH-type transcriptional regulator UlaR	NA	A0A077SK06	Escherichia_phage	25.5	1.5e-14
WP_019282357.1|137899_138967_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_019282356.1|139068_141066_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_013868346.1|141447_142779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019282355.1|142844_143696_+	maltose operon protein	NA	NA	NA	NA	NA
WP_013868348.1|143844_146310_-	glycogen debranching protein	NA	NA	NA	NA	NA
WP_064624027.1|146329_147373_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023055	Vibrio anguillarum strain VIB43 chromosome 2, complete sequence	1152744	236922	316417	1152744	protease,transposase	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_069212063.1|236922_238455_+|transposase	IS66-like element ISVa9 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.3e-70
WP_019282684.1|238889_239921_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017048182.1|240165_240609_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_069212190.1|240664_240952_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_019282681.1|240960_242217_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_010319355.1|242278_242722_-	cell division protein DedD	NA	A0A292GIT0	Xanthomonas_phage	41.0	3.5e-24
WP_081245341.1|243570_244557_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_029388322.1|244587_244986_+	OsmC family protein	NA	NA	NA	NA	NA
WP_017043150.1|245136_245757_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_019282679.1|245753_246668_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
WP_019282678.1|246745_247642_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_010319645.1|247881_248760_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013868424.1|248919_249555_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_019282677.1|249851_250787_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069212191.1|250919_252893_-	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_019282676.1|253155_253947_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_019282675.1|253939_254272_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_019282673.1|254584_256909_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	2.2e-16
WP_019282672.1|256985_258380_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_019282671.1|258459_259317_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017048193.1|259553_261101_+	response regulator	NA	NA	NA	NA	NA
WP_017045093.1|261151_261925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019282670.1|261947_263963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282669.1|264030_264999_+	sugar ABC transporter ATPase	NA	NA	NA	NA	NA
WP_076611988.1|265973_267143_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_019282667.1|268005_268263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081317724.1|270781_271267_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_019282665.1|271306_272557_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_019282664.1|273063_275286_+	hemolysin	NA	NA	NA	NA	NA
WP_019282663.1|275551_276493_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_069212133.1|276577_277438_+	lipase chaperone	NA	NA	NA	NA	NA
WP_019282662.1|277511_280268_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_017043657.1|280463_280709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282661.1|281215_281977_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_050934241.1|282164_284609_+	peptidase M9	NA	NA	NA	NA	NA
WP_017045107.1|284848_286030_+	DUF3103 domain-containing protein	NA	NA	NA	NA	NA
WP_081245206.1|286217_287141_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026027432.1|287168_288104_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	42.9	1.2e-69
WP_029388317.1|288126_289077_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_013868453.1|289083_289845_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.4	6.8e-15
WP_029388316.1|290174_291368_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_019282658.1|291655_293128_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.7	2.1e-129
WP_019282657.1|293829_294786_-	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_019282656.1|294760_295969_-	MFS transporter	NA	NA	NA	NA	NA
WP_029388315.1|296246_297404_-	class C beta-lactamase	NA	NA	NA	NA	NA
WP_019282654.1|297546_298416_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.8	2.7e-15
WP_076611988.1|298865_300035_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_019283284.1|300337_302038_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.3	2.3e-31
WP_069212156.1|302105_302936_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	39.5	4.6e-33
WP_019283285.1|303202_303925_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_019283170.1|304408_304900_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019283169.1|305013_305907_+	DMT family transporter	NA	NA	NA	NA	NA
WP_127170331.1|306648_306843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095661356.1|306783_307752_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	5.7e-43
WP_029388267.1|308199_311079_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.4	9.0e-270
WP_013868476.1|311160_311541_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017043957.1|311598_312906_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.1	2.5e-102
WP_019282412.1|313301_313925_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_019282411.1|314204_315350_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_019282410.1|315427_316417_+|protease	trypsin-like serine protease	protease	D2TEK9	Emiliania_huxleyi_virus	29.8	2.3e-15
>prophage 3
NZ_CP023055	Vibrio anguillarum strain VIB43 chromosome 2, complete sequence	1152744	349950	536943	1152744	integrase,protease,transposase,tRNA	Staphylococcus_prophage(23.44%)	206	348918:348933	403268:403283
348918:348933	attL	CATTACCAACAAGCAA	NA	NA	NA	NA
WP_064624027.1|349950_350994_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_029388106.1|351022_351733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019281643.1|351732_352449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020699786.1|352487_353174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019281641.1|353170_353896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019281640.1|353892_354618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019281639.1|355351_355747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026027797.1|356367_356919_+	PTS system glucitol/sorbitol-specific transporter subunit IIC	NA	NA	NA	NA	NA
WP_019281637.1|356932_357925_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_013868507.1|357935_358298_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_013868508.1|358356_359136_+	sorbitol-6-phosphate dehydrogenase	NA	W8CYX9	Bacillus_phage	44.1	5.0e-05
WP_019281636.1|359231_359588_+	glucitol operon activator	NA	NA	NA	NA	NA
WP_013868510.1|359670_360447_+	DNA-binding transcriptional repressor	NA	A0A077SK06	Escherichia_phage	26.5	5.6e-17
WP_017045367.1|360639_361203_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_017045368.1|361199_362171_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_019281635.1|362177_362534_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_019281634.1|362866_363556_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_019281633.1|363648_364152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019281632.1|364249_366088_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_019281631.1|366090_366993_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.9	9.4e-40
WP_013868527.1|367094_367229_-	TIGR02808 family protein	NA	NA	NA	NA	NA
WP_019281630.1|367241_367820_-	cytochrome c	NA	NA	NA	NA	NA
WP_013868529.1|367852_368308_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_019281629.1|368381_370871_-	periplasmic nitrate reductase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.3	3.2e-13
WP_013868531.1|370867_371173_-	chaperone NapD	NA	NA	NA	NA	NA
WP_017045373.1|371175_371670_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_019281628.1|371885_373610_+	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_013868534.1|373596_374229_+	response regulator	NA	NA	NA	NA	NA
WP_019281627.1|374295_375663_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_019281626.1|375960_377088_-	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	35.6	3.7e-33
WP_013868537.1|377262_377805_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_019281625.1|378400_379078_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_017045377.1|379131_380028_-	phosphate ABC transporter substrate-binding protein	NA	H6WG65	Cyanophage	28.0	8.0e-07
WP_019281624.1|380019_380478_+	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
WP_029388103.1|380538_382554_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	23.2	4.1e-27
WP_019281622.1|382916_384929_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.5	3.1e-51
WP_019281619.1|387180_388137_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103261216.1|388794_389385_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.6	6.0e-11
WP_157731309.1|389290_389689_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	46.6	1.6e-28
WP_103261217.1|390043_390178_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_019281615.1|390325_390871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095661361.1|391217_392368_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	69.3	7.1e-109
WP_095661362.1|393125_393314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019281657.1|393481_393937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010319593.1|395623_397552_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	3.8e-123
WP_080569453.1|397555_398107_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	39.0	1.2e-13
WP_010319591.1|398210_398405_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_010319590.1|398446_398800_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017043784.1|398862_399825_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.8	7.6e-56
WP_019283194.1|400038_400359_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|400355_400709_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_069211897.1|400768_402301_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_069212263.1|402471_402960_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_019282910.1|402967_403939_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	6.4e-18
403268:403283	attR	TTGCTTGTTGGTAATG	NA	NA	NA	NA
WP_095661363.1|404159_404252_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_019283287.1|404321_405314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283286.1|405303_405462_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_157731311.1|405665_405821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081245536.1|405761_406730_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.5e-43
WP_029388418.1|408238_408616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069212199.1|408762_409227_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_081245536.1|409252_410221_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.5e-43
WP_095661364.1|410161_410401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017042813.1|410953_411301_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	46.6	6.8e-23
WP_095661365.1|411749_411929_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_019283223.1|411930_412872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095661356.1|412903_413872_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	5.7e-43
WP_095661398.1|413953_414079_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_019281855.1|415153_416062_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	60.8	9.3e-104
WP_019283195.1|417135_417489_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_019283194.1|417485_417806_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_081245536.1|418550_419519_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.5e-43
WP_095661366.1|419459_419657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069212233.1|419656_420586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029388116.1|420709_421912_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_069212063.1|422105_423638_-|transposase	IS66-like element ISVa9 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.3e-70
WP_069212062.1|423697_424051_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_081245520.1|424047_424368_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019282621.1|425389_425689_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_019282620.1|425685_425928_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_081245536.1|426022_426991_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.5e-43
WP_019283453.1|427231_427747_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.4	6.0e-15
WP_043005158.1|429657_430251_+	cell division protein Fic	NA	NA	NA	NA	NA
WP_019283451.1|430407_430785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127170333.1|430726_430960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081245536.1|430900_431869_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.5e-43
WP_017045788.1|432025_432523_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_019283269.1|432519_432792_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_019283270.1|432831_432993_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_069212067.1|433541_433961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283291.1|435695_436217_+	GNAT family N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	33.1	1.1e-08
WP_019283194.1|436548_436869_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|436865_437219_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_069211897.1|437278_438811_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_081245536.1|439134_440103_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.5e-43
WP_095661367.1|440043_440283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081245540.1|440410_440701_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_081245536.1|440764_441733_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.5e-43
WP_017048303.1|441965_442475_+	ATPase AAA	NA	A0A097BYE2	Leuconostoc_phage	32.0	1.8e-08
WP_019283473.1|442592_442955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069211897.1|443703_445236_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_019283195.1|445295_445649_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_019283194.1|445645_445966_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_157731313.1|446282_446450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283218.1|446997_447783_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_017045717.1|449178_449658_+	membrane protein	NA	NA	NA	NA	NA
WP_010320663.1|449799_450078_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_017040620.1|450074_450359_-	DNA-damage-inducible protein J	NA	NA	NA	NA	NA
WP_095661212.1|451368_452519_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_095661368.1|452517_452760_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_013868597.1|452879_453110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095661369.1|453347_453701_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	56.5	4.3e-25
WP_001232701.1|453711_454029_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	46.2	5.3e-14
WP_019282132.1|453944_454136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017045395.1|454177_454594_+	VOC family protein	NA	NA	NA	NA	NA
WP_019282910.1|454606_455578_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	6.4e-18
WP_095661399.1|455777_455891_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_019283194.1|456010_456331_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|456327_456681_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_069211897.1|456740_458273_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_081245520.1|458971_459292_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_069212062.1|459288_459642_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_069212063.1|459701_461234_+|transposase	IS66-like element ISVa9 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.3e-70
WP_019283323.1|461535_461790_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_009836584.1|461782_462046_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_095661356.1|462336_463305_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	5.7e-43
WP_095661370.1|463245_463473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019282910.1|463584_464556_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	6.4e-18
WP_095661371.1|464746_464869_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_081245536.1|466258_467227_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.5e-43
WP_095661372.1|467167_467476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283461.1|467463_467739_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_157731315.1|468522_468696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127170334.1|468652_469123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069212063.1|469286_470819_-|transposase	IS66-like element ISVa9 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.3e-70
WP_069212062.1|470878_471232_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_095661340.1|471228_471558_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_069211897.1|471562_473095_-|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_019283195.1|473154_473508_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_019283194.1|473504_473825_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_095661212.1|474492_475643_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_069212150.1|475667_476015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282044.1|476640_477108_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	61.6	1.7e-53
WP_019282045.1|477114_479253_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	62.6	5.7e-261
WP_081245477.1|479280_480360_-	NTP reductase large subunit	NA	E1A2R4	Aeromonas_phage	57.8	1.8e-85
WP_081245520.1|481857_482178_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_069212062.1|482174_482528_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_069212063.1|482587_484120_+|transposase	IS66-like element ISVa9 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.3e-70
WP_019283469.1|484374_485211_-	glycosyl transferase	NA	A0A0S1TKJ6	Elephant_endotheliotropic_herpesvirus	28.3	3.9e-16
WP_081265645.1|485355_485472_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_017049506.1|485505_485901_+	DUF3465 domain-containing protein	NA	NA	NA	NA	NA
WP_069212065.1|486056_486554_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_019282910.1|486561_487533_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	6.4e-18
WP_069212180.1|488836_489022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017044157.1|489838_490438_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_081245536.1|490471_491440_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.5e-43
WP_095661373.1|491380_491581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069212064.1|491684_492317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029388429.1|492901_493183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283272.1|493356_493734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019283271.1|493724_493949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081245536.1|494066_495035_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.5e-43
WP_095661374.1|494975_495185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029388480.1|495650_496400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283456.1|497054_497576_+	hypothetical protein	NA	L7TH90	Pseudomonas_virus	42.1	4.9e-09
WP_029388428.1|497716_498067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064624027.1|499292_500336_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_095661375.1|500356_501316_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.0	8.2e-42
WP_157731317.1|501256_501451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019282910.1|501944_502916_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	6.4e-18
WP_017044325.1|503253_503544_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017044326.1|503536_503758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095661376.1|505584_506658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095661212.1|506891_508041_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_019283194.1|509042_509363_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|509359_509713_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_069211897.1|509772_511305_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_095661400.1|511361_511745_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_157731319.1|511953_512142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081245536.1|512082_513051_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.5e-43
WP_081245536.1|513402_514371_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	7.5e-43
WP_081317708.1|514452_514578_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_069211916.1|514606_514960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017048742.1|515121_515421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081245537.1|515955_516924_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.8	2.3e-44
WP_157731321.1|516864_517023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069212157.1|517057_517375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029388222.1|517509_518025_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	49.7	5.0e-46
WP_019282174.1|518165_518639_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017046620.1|519234_519699_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017049509.1|519866_520166_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017045808.1|520173_520416_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_095661212.1|520658_521808_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_019282469.1|521981_523163_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_019282470.1|523191_523812_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_038148427.1|524127_525075_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_019282471.1|525067_525268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019282472.1|525260_527144_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069212003.1|527153_528239_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_017046433.1|528235_529279_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_095661212.1|530603_531754_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_026027861.1|531886_532522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013867852.1|532863_533403_+	cytochrome b	NA	NA	NA	NA	NA
WP_019283319.1|533399_533969_+	YceI family protein	NA	NA	NA	NA	NA
WP_019283318.1|534065_535850_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	7.8e-30
WP_064624027.1|535899_536943_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP023055	Vibrio anguillarum strain VIB43 chromosome 2, complete sequence	1152744	570958	629033	1152744	integrase,protease,transposase	Leptospira_phage(23.08%)	52	602356:602415	637769:639744
WP_076611988.1|570958_572128_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_017042819.1|572390_572582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283373.1|572732_573299_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_026028966.1|573493_574576_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_019283374.1|574832_575300_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_017042822.1|575289_575535_+	DUF3389 domain-containing protein	NA	NA	NA	NA	NA
WP_010320751.1|575614_577303_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019283375.1|577459_579064_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	26.8	7.2e-51
WP_019283376.1|579331_579727_-	DUF296 domain-containing protein	NA	NA	NA	NA	NA
WP_013867811.1|579723_580308_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013867810.1|580407_581028_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_019283377.1|581030_581699_+	thiol:disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_019283378.1|581773_582271_+	urease	NA	NA	NA	NA	NA
WP_013867807.1|582330_582519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019283379.1|585134_587147_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.7	3.9e-17
WP_013867804.1|587466_587679_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.2	7.6e-17
WP_064624027.1|588286_589330_-|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_013867802.1|590432_590801_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_081245432.1|590781_591096_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_019283275.1|591385_592936_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_017046914.1|592947_594324_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_013867798.1|594475_595930_+	DUF3404 domain-containing protein	NA	NA	NA	NA	NA
WP_013867797.1|595904_596564_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	1.2e-28
WP_019283274.1|596560_597445_+	DUF2861 family protein	NA	NA	NA	NA	NA
WP_013867795.1|597505_598696_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_013867794.1|598741_598897_+	YoaH family protein	NA	NA	NA	NA	NA
WP_069212063.1|599026_600559_-|transposase	IS66-like element ISVa9 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.3e-70
WP_069212062.1|600618_600972_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_081245520.1|600968_601289_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283194.1|602034_602355_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_019283195.1|602351_602705_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
602356:602415	attL	AACGTATGCTCAGTGCTCCCGAAATCTATCTCTATCGCGAAAGCGTCGATTTTAGAAAGT	NA	NA	NA	NA
WP_069211897.1|602764_604297_+|transposase	IS66-like element ISVa11 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	4.2e-72
WP_095661212.1|604522_605672_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.5e-50
WP_019283126.1|606046_606457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081245520.1|607007_607328_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_069212062.1|607324_607678_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_095661379.1|607737_609270_+|transposase	IS66-like element ISVa9 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	3.9e-70
WP_019283130.1|610418_610631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611988.1|611480_612650_-|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_069212146.1|614122_615010_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029189956.1|615053_617744_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013867790.1|617963_618545_+	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_019282713.1|618716_619721_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_069212145.1|619704_620664_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7R1N2	Vibrio_phage	24.1	2.5e-14
WP_013867787.1|620766_621138_+	DUF3319 domain-containing protein	NA	NA	NA	NA	NA
WP_019282715.1|621145_621457_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_069212144.1|621726_622011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095661380.1|622340_623491_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	69.3	7.1e-109
WP_069211915.1|624023_624944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069211914.1|625149_625683_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069211913.1|625679_625949_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_095661382.1|627856_629033_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.1	3.1e-115
637769:639744	attR	ACTTTCTAAAATCGACGCTTTCGCGATAGAGATAGATTTCGGGAGCACTGAGCATACGTTTCATGACAGCGCACCGATAAGCTCTGCGAGATAGGTCGCTGGCGTGCCTTGTGGGATGCTCAGTTCAACATCATTGACGAGCAGCGTCATATTGGCAACGACAACGTGAGTGGCTTGATACTTTGTGGTCTTTTCAACGACTTCTGCTTTAACAAAGCCAACCGTGTTCGGTTTTTCGATGTGCTTTAACTGTTGGCGCTTAGCGTAAAAAGTGGAGAGGCTCAGTCCGTTACGTTCACAGAATAATCGTTGTGATAGTTGGCTGGATTCATAGTGTTCGAACAGGGTTCGCCATTCTTGGTTAGTGCGTCGTTTGGCCATTTCAAATCTCCTTTGGGTTGGAGGTTTGATCTTATTATTCGGGCTAGGTGATTAGAATGCGGGGTTTATGACGCGCTTACAAACCACCGTAGAAATGAAGAGATTTGAATAAGTTACGTACAAAAACGATGCTTACCAAAACCTAAATTTCACAGCAATCTTAGCCAAAGAAAACCACTTACAGAATCAACAACAAAGAAAGCGCCCTTTCAGCAACCGCTAAACTTTTTGCTTCACCAGACTTTCAGTGCTGAATATCAGCAAGTGAATCAGTCAAAAATGCATTTCAATTGAATCGATTTGAAACCGATAAAACTCAGCACAAACCAGATCCAAAACTTAATTGAGGCAACCCAAGAACCTTGAAAACGATCAATCTCAGATTGTTCAAGAATCCATTTCGACCAAGCCAACTTGCCGAAAACACGGAACGAATTCTCAATGAAATCGTAGCTTTGACCTTAAAAACGCATCAAACACATAACGCCCGGCTAAGGGGTTGACAACGCACCACCGAACTAAAAAAACATACTGTAAATACTGAATTTCAATTTTGCACTAAAGCCGCCACGCGTTGACAATCCCTCTTGAGCCGTTTGTTAGGCCAACCAATTGACACCGACACTTTCACAACCCAAGAACAAGTCTTTTTGTAAAACTCAAACAAACTAAACCATTAATTTATAAACTAAAACTCTAACTTTGCAAAGAAACAAAAAACTCAAATTGAGCGGTTTGGAAGAAAAGTGACTAACGTAGCATGCTCGGCGGACGTTTGAATGCTGAAAGTTATTTTGCCGATGAATTCACAGCGAAAAGTAACCCAACGCGATCAAGAAACAAAAAATATGTGATGATTATTTATTGCTTAAGTTCAGCCATGAGAACATGGAATTTACCGTTCAATTTCAACTCGATTTAGCTGATAAAAACTCACTTTGCCTAACGCCCGGCTAAGGGGTTGACAACGCACCGCCGAACTCAAAAAAACACACTGTCAACTCTGAACTTCAATTTTGCACTAAAGTCGCCAAGCGTTGGCAATCCCTCTTGAGCCGTTTGTTAGGCCAACTGATTGACACCGACACTTTCAAAACTAAAGAACGAACTTTTTTATAAACTTAAAACAAACTAACCGATTAATTTATAAACCAAAATGCCAAGTCAGCAAAGAAACAAAAAACTCAAATTTAGCGATTTGGAAGAAAAGTGATGAGCGTAGCATGCTCGGCGGACGTTTGGATGCTGAAGGTTATTTCACCGATGAATTCACAACGAAAAGCAACCCAACACGATCAAGAAACAACAAATATGTGATGACGATTTATTGCTTAAGTCCAGCCATGAGAACATGGAATTCGCCGTTCAATTCAAACCCGATTTAGCTGATAAAAACTCACTTTGCCTAACGCCCGGCTAAGGGGTTGACAACGCACCGCCGAACTTAAAAAACACACTGTAAACATTGAACTGCAATTTTGCACTAAAGTCGCCACGCGTTGGCAATCCCTCTTGAGCCGTTTGTTATGCAAATTCAATGAGATAAACTGACTTTACACGACCAAAATCCACGATTGCAATGGTTGAGTGATTCA	NA	NA	NA	NA
>prophage 5
NZ_CP023055	Vibrio anguillarum strain VIB43 chromosome 2, complete sequence	1152744	875704	928881	1152744	integrase,transposase	Staphylococcus_phage(18.18%)	37	899659:899674	934855:934870
WP_081245537.1|875704_876673_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.8	2.3e-44
WP_019281648.1|878012_878870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019281649.1|878870_880640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019281651.1|881513_882137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069212164.1|882136_883228_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_069212165.1|883392_884049_-	amino acid adenylation	NA	NA	NA	NA	NA
WP_019281653.1|884118_885012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069212166.1|885014_886457_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_095661388.1|886483_889648_-	DUF1998 domain-containing protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.1	4.3e-23
WP_069212063.1|889623_891156_-|transposase	IS66-like element ISVa9 family transposase	transposase	S5VTD3	Leptospira_phage	35.1	1.3e-70
WP_069212062.1|891215_891569_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_081245520.1|891565_891886_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_095661389.1|891965_895193_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	28.9	4.3e-18
WP_157731323.1|895193_896939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064624027.1|897199_898243_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_095661391.1|898212_899601_-	hypothetical protein	NA	NA	NA	NA	NA
899659:899674	attL	TTAGCCATTTTTATAC	NA	NA	NA	NA
WP_019283227.1|899979_901212_-	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	32.5	6.6e-20
WP_019283228.1|901208_902804_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	29.4	9.1e-30
WP_103261257.1|902966_906386_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	25.3	2.5e-16
WP_019283230.1|906460_907945_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_019283231.1|908135_909320_+	TniQ family protein	NA	NA	NA	NA	NA
WP_019283232.1|909320_911243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019283233.1|911214_912273_+	type I-F CRISPR-associated protein Csy3	NA	A0A2I7RCY7	Vibrio_phage	24.6	5.9e-09
WP_019283234.1|912275_912875_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_081245287.1|913954_914254_-	type VI secretion system PAAR protein	NA	NA	NA	NA	NA
WP_081245289.1|914263_915052_-	glycosyl hydrolase family 26	NA	NA	NA	NA	NA
WP_095661392.1|915256_916873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019281887.1|916862_917651_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_019281888.1|917650_919630_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.8	2.4e-35
WP_019281889.1|919769_920288_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_019281890.1|920532_920862_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019281891.1|920963_921506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081245513.1|921490_922873_+	DEAD/DEAH box helicase family protein	NA	I4AZM6	Saccharomonospora_phage	31.3	4.8e-35
WP_019281855.1|923091_924000_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	60.8	9.3e-104
WP_069212102.1|925391_926345_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_019281668.1|926341_928216_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_095661393.1|928212_928881_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
934855:934870	attR	GTATAAAAATGGCTAA	NA	NA	NA	NA
