The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017063	Lactobacillus rhamnosus strain LR5 chromosome, complete genome	2972590	784415	828579	2972590	holin,terminase,capsid,portal,tail,protease,integrase	Lactobacillus_phage(80.0%)	66	764006:764065	826335:826410
764006:764065	attL	ATGGAGGATTAGCTCAGTTGGGAGAGCGTCTGCCTTACAAGCAGAGGGTCACAGGTTCGA	NA	NA	NA	NA
WP_095593589.1|784415_785543_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	98.9	1.5e-212
WP_025014108.1|785650_785914_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	41.3	8.5e-10
WP_095593590.1|786052_786274_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	68.6	5.3e-21
WP_095593591.1|786533_787205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095593592.1|787262_787928_-	LexA family transcriptional regulator	NA	O64370	Lactobacillus_phage	61.9	9.3e-69
WP_095593593.1|788096_788363_+	helix-turn-helix transcriptional regulator	NA	B8R673	Lactobacillus_phage	55.9	2.9e-13
WP_095593594.1|788363_789071_+	phage antirepressor KilAC domain-containing protein	NA	B4XYR8	Lactobacillus_phage	87.6	9.1e-115
WP_005712705.1|789067_789217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003564805.1|789213_789414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048487201.1|789488_789845_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	97.5	2.0e-62
WP_191982015.1|789965_790118_+	hypothetical protein	NA	A8YQL2	Lactobacillus_phage	97.9	7.6e-19
WP_095593595.1|790122_790326_+	hypothetical protein	NA	Q9T0Y8	Lactobacillus_phage	91.0	8.3e-29
WP_095593596.1|790342_790834_+	siphovirus Gp157 family protein	NA	A8YQL4	Lactobacillus_phage	96.3	3.0e-80
WP_095593597.1|790845_791559_+	ERF family protein	NA	A0A2D1GPH8	Lactobacillus_phage	50.0	4.8e-47
WP_095593598.1|791533_792202_+	hypothetical protein	NA	A0A2D1GP81	Lactobacillus_phage	92.8	5.6e-122
WP_095593599.1|792605_793412_+	replication protein	NA	Q6J1V6	Lactobacillus_phage	59.9	2.1e-75
WP_095593600.1|793398_794181_+	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	91.1	5.5e-129
WP_005712723.1|794177_794522_+	hypothetical protein	NA	B4XYS8	Lactobacillus_phage	91.6	3.6e-48
WP_093997718.1|794508_794763_+	hypothetical protein	NA	A8YQM4	Lactobacillus_phage	96.4	4.2e-38
WP_095593601.1|794759_795173_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	98.5	8.6e-73
WP_095593602.1|795185_795650_+	endonuclease	NA	A0A0P0IXF6	Lactobacillus_phage	98.0	7.2e-20
WP_095593603.1|795661_795847_+	hypothetical protein	NA	Q6J1V0	Lactobacillus_phage	88.5	3.3e-24
WP_095593604.1|795843_796602_+	site-specific DNA-methyltransferase	NA	B4XYT3	Lactobacillus_phage	98.4	3.1e-145
WP_095593605.1|796614_796971_+	hypothetical protein	NA	X2CY62	Lactobacillus_phage	39.6	7.0e-15
WP_095593606.1|796960_797251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191982016.1|797240_797417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095593607.1|797406_797610_+	hypothetical protein	NA	Q5GQT7	Synechococcus_phage	54.8	1.9e-09
WP_095593608.1|797606_797978_+	hypothetical protein	NA	C1KFE8	Lactobacillus_virus	77.5	2.8e-51
WP_095593723.1|798025_798322_+	hypothetical protein	NA	A0A2D1GPL5	Lactobacillus_phage	45.0	3.2e-13
WP_095593609.1|798318_798507_+	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	96.8	2.1e-26
WP_095593610.1|798562_798748_+	hypothetical protein	NA	A0A0P0I365	Lactobacillus_phage	61.4	6.8e-14
WP_095593611.1|798740_798959_+	hypothetical protein	NA	U5U734	Lactobacillus_phage	94.4	1.2e-33
WP_077069894.1|798960_799179_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IK26	Lactobacillus_phage	75.0	1.7e-24
WP_095593612.1|799531_799984_+	DUF1492 domain-containing protein	NA	A0A2D1GPD7	Lactobacillus_phage	71.3	1.6e-56
WP_095593614.1|800233_801307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095593615.1|801837_803055_+	hypothetical protein	NA	A8YQN3	Lactobacillus_phage	97.0	3.1e-235
WP_095593616.1|803041_803371_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	5.6e-51
WP_095593617.1|803373_803934_+	hypothetical protein	NA	Q96200	Lactobacillus_phage	72.1	2.9e-63
WP_095593618.1|803967_804303_+	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	53.5	1.9e-25
WP_003572621.1|804536_804755_+	hypothetical protein	NA	D2XR14	Bacillus_phage	41.1	1.2e-06
WP_095593619.1|804751_806443_+|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	52.2	2.8e-170
WP_095593620.1|806457_807624_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	41.6	8.9e-83
WP_095593621.1|807601_808330_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	44.0	2.7e-37
WP_095593622.1|808351_809521_+|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	51.5	5.9e-103
WP_080772348.1|809517_809664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095593623.1|809656_809947_+	hypothetical protein	NA	A0A1S5SF81	Streptococcus_phage	48.4	1.8e-16
WP_095593624.1|809939_810320_+	hypothetical protein	NA	M9QX19	Staphylococcus_phage	33.7	4.3e-10
WP_003572637.1|810316_810730_+	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	54.1	1.0e-33
WP_003572639.1|810726_811104_+	hypothetical protein	NA	A0A059T681	Listeria_phage	44.1	2.9e-19
WP_095593625.1|811118_811712_+|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	39.2	6.8e-31
WP_095593724.1|811729_811966_+	Ig-like domain-containing protein	NA	G0ZNE6	Cronobacter_phage	57.7	1.5e-10
WP_019913556.1|812040_812358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572647.1|812372_812522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095593626.1|812537_816506_+|tail	phage tail tape measure protein	tail	E9LUJ2	Lactobacillus_phage	35.8	2.4e-10
WP_095593627.1|816502_818437_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	61.1	1.7e-216
WP_095593628.1|818437_821392_+|tail	phage tail protein	tail	A8YQK1	Lactobacillus_phage	76.2	0.0e+00
WP_032964527.1|821401_821731_+	hypothetical protein	NA	A8YQK2	Lactobacillus_phage	88.1	1.3e-47
WP_005688592.1|821727_821871_+	XkdX family protein	NA	A8YQK3	Lactobacillus_phage	97.9	3.5e-18
WP_095593629.1|821901_822288_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	96.9	2.1e-65
WP_095593631.1|822474_823470_+	hypothetical protein	NA	A0A0N7IR76	Lactobacillus_phage	93.1	7.5e-131
WP_095593632.1|823474_823978_+	hypothetical protein	NA	A0A0P0ID94	Lactobacillus_phage	37.6	7.9e-20
WP_095593633.1|823997_824444_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	95.3	2.4e-65
WP_095593634.1|824454_825600_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	51.8	2.7e-84
WP_095593635.1|825614_825818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005713236.1|826562_827216_-	hypothetical protein	NA	NA	NA	NA	NA
826335:826410	attR	ATGGAGGATTAGCTCAGTTGGGAGAGCGTCTGCCTTACAAGCAGAGGGTCACAGGTTCGAGCCCTGTATCCTCCAT	NA	NA	NA	NA
WP_005713641.1|827394_828579_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.0	1.1e-141
>prophage 2
NZ_CP017063	Lactobacillus rhamnosus strain LR5 chromosome, complete genome	2972590	944201	999484	2972590	tRNA,terminase,capsid,portal,integrase,head	Staphylococcus_phage(18.75%)	55	977889:977903	1004467:1004481
WP_047675481.1|944201_944666_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_005684561.1|944871_945768_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	7.7e-18
WP_047675478.1|945760_947020_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005688746.1|947208_947751_-	exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	41.0	8.2e-23
WP_047675560.1|947761_948520_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.7	2.4e-60
WP_047675474.1|949107_949971_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_005711866.1|950008_952123_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_005684568.1|952346_952886_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005688752.1|952899_953988_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	46.0	1.4e-37
WP_005684570.1|954081_954906_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.7	8.9e-13
WP_005684571.1|954895_955729_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047675472.1|955712_956786_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047675470.1|957239_957506_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_047675468.1|957766_957958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047675466.1|958150_960943_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.4	2.0e-72
WP_047675463.1|961018_961699_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047675461.1|961732_962872_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047675459.1|962861_963596_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.2	4.8e-26
WP_005684581.1|963856_964714_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_049171468.1|964710_965808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688773.1|965836_967201_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_014571238.1|967624_969436_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	37.2	2.0e-89
WP_047675456.1|969585_971391_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_005684586.1|971464_971956_+	VanZ family protein	NA	NA	NA	NA	NA
WP_005684587.1|972026_972758_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_049171465.1|974093_975047_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005684590.1|975049_975370_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_005688785.1|975366_975789_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_005688787.1|975758_976070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569400.1|976029_976497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688791.1|976493_976817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047675445.1|977223_978237_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
977889:977903	attL	TTCATATGCGCATCA	NA	NA	NA	NA
WP_029607003.1|978505_978967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005684599.1|979175_980540_+	amino acid permease	NA	NA	NA	NA	NA
WP_047675443.1|980571_981336_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_005713708.1|981332_982172_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_047675440.1|982172_983129_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_047675437.1|983125_984010_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_047675434.1|984220_986515_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_016380956.1|987179_988328_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	28.9	1.0e-30
WP_095593638.1|988426_989125_-	helix-turn-helix domain-containing protein	NA	A0A1W6JQE6	Staphylococcus_phage	38.0	4.0e-06
WP_016380958.1|989272_989551_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016380959.1|989618_989840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016380962.1|990190_990481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003571964.1|990477_990666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016382146.1|990649_991462_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	32.5	6.7e-13
WP_016380374.1|991465_993058_+	phage/plasmid primase P4 family protein	NA	A0A1B1P7L5	Bacillus_phage	27.6	1.0e-25
WP_016380373.1|993378_993714_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_016380372.1|993718_993904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016380371.1|993900_994323_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	46.7	8.3e-23
WP_003574359.1|994439_994910_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_016382145.1|994906_996610_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	42.5	8.6e-119
WP_003574365.1|996575_996755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016382144.1|996759_997938_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.3	2.2e-60
WP_016382143.1|997927_999484_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.5	2.8e-39
1004467:1004481	attR	TGATGCGCATATGAA	NA	NA	NA	NA
>prophage 3
NZ_CP017063	Lactobacillus rhamnosus strain LR5 chromosome, complete genome	2972590	2293515	2361800	2972590	tRNA,protease,bacteriocin	Bacillus_phage(20.0%)	60	NA	NA
WP_047678740.1|2293515_2295009_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_047678750.1|2295559_2296390_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_047678753.1|2296403_2297420_-	membrane protein	NA	NA	NA	NA	NA
WP_049170284.1|2297416_2297803_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064535186.1|2297995_2299312_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_005686113.1|2300413_2301529_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_005686111.1|2301549_2302914_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_064535183.1|2302933_2303473_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.0	9.9e-37
WP_005686109.1|2304240_2304531_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_047677400.1|2304823_2306143_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.5	8.8e-63
WP_047677403.1|2306287_2307634_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	38.5	1.3e-72
WP_047677407.1|2307850_2308951_+	ABC transporter	NA	NA	NA	NA	NA
WP_047677409.1|2308947_2310144_+	ABC transporter	NA	NA	NA	NA	NA
WP_047677411.1|2310157_2311033_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	2.1e-12
WP_047677413.1|2311184_2313239_+	KUP/HAK/KT family potassium transporter	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	33.1	7.3e-64
WP_047677415.1|2313446_2316077_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.7	8.1e-84
WP_072137620.1|2316376_2316964_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005692313.1|2317135_2317807_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_047677417.1|2317964_2319083_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_005686095.1|2319101_2319386_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_095593672.1|2319631_2320747_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005716508.1|2320909_2321119_-	CsbD family protein	NA	NA	NA	NA	NA
WP_047677421.1|2321252_2322443_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_047677423.1|2322439_2323669_-	MFS transporter	NA	NA	NA	NA	NA
WP_047677425.1|2323696_2324440_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_047677427.1|2324432_2325650_-	MFS transporter	NA	NA	NA	NA	NA
WP_095593673.1|2325777_2326956_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005686089.1|2327155_2327413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686086.1|2327602_2327809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686084.1|2327998_2328253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764702.1|2328926_2330159_+	MFS transporter	NA	NA	NA	NA	NA
WP_047677431.1|2330228_2331485_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.9	1.6e-109
WP_047677433.1|2331565_2332402_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.5	2.1e-46
WP_005692296.1|2332850_2333036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570061.1|2333612_2334155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047677436.1|2334384_2335209_-	class C sortase	NA	NA	NA	NA	NA
WP_047677438.1|2335215_2336769_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_047677440.1|2336759_2338115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047677443.1|2338116_2341068_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014570066.1|2341342_2341900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047677445.1|2342068_2343277_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_047677447.1|2343469_2344525_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_047677449.1|2344819_2345467_+	helix-turn-helix transcriptional regulator	NA	B5LPU3	Bacillus_virus	42.3	3.4e-07
WP_029607595.1|2345597_2345930_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047677451.1|2345926_2346712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047677453.1|2346755_2347532_+	membrane protein	NA	NA	NA	NA	NA
WP_047677458.1|2347559_2347850_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_049171123.1|2347977_2349060_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005686876.1|2349360_2350716_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_049171125.1|2350895_2351306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047677460.1|2351366_2352746_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_049171127.1|2352758_2354951_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.5	1.3e-37
WP_168163043.1|2355245_2355401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047678343.1|2355580_2356876_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_047678346.1|2356880_2357669_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_141746984.1|2359066_2359309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047678349.1|2360016_2360262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047678352.1|2360510_2360810_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_047678355.1|2360987_2361146_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_049171132.1|2361614_2361800_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 4
NZ_CP017063	Lactobacillus rhamnosus strain LR5 chromosome, complete genome	2972590	2477033	2545183	2972590	tRNA,transposase,protease	Streptococcus_phage(58.82%)	60	NA	NA
WP_005691256.1|2477033_2479184_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	50.3	1.4e-110
WP_024129392.1|2479245_2479791_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.8	9.4e-11
WP_047678044.1|2479790_2481098_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	22.9	7.5e-06
WP_005711034.1|2481218_2481698_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_005686613.1|2481981_2482383_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_005686616.1|2482475_2482739_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_031546611.1|2482745_2484320_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_047678041.1|2484397_2487925_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_095593675.1|2488000_2488558_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003662706.1|2488991_2489999_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_029607654.1|2490406_2491777_+	peptidoglycan binding domain-containing protein	NA	NA	NA	NA	NA
WP_005686623.1|2491905_2492442_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047678039.1|2492588_2494040_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047678037.1|2494103_2494700_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005686626.1|2494868_2495534_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_047678035.1|2495830_2496529_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_047678034.1|2496608_2498045_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_095593676.1|2498109_2502576_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_047678030.1|2502871_2503399_-	QueT transporter family protein	NA	NA	NA	NA	NA
WP_081262725.1|2503533_2503689_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_005686632.1|2504315_2504564_-	antitoxin	NA	NA	NA	NA	NA
WP_047677957.1|2504675_2505815_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.3	8.2e-33
WP_005686634.1|2505801_2506176_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_005686635.1|2506344_2507853_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	38.8	1.7e-70
WP_047677959.1|2508126_2509515_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_005686637.1|2509661_2510426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095593677.1|2510628_2511270_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014571608.1|2511285_2511960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047677953.1|2512215_2512644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057821197.1|2517212_2517455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016376174.1|2517496_2517820_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	42.3	1.2e-16
WP_010491213.1|2517837_2518209_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	52.0	1.7e-27
WP_016387575.1|2518286_2518550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010491209.1|2518560_2518800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010491207.1|2518834_2519083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016376177.1|2519102_2519390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095593678.1|2519386_2520754_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	61.3	5.2e-151
WP_095593679.1|2520764_2521040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031546588.1|2521036_2521297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095593680.1|2521612_2522803_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	43.7	3.5e-95
WP_010491196.1|2522792_2523119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606383.1|2524071_2524293_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.6	1.7e-27
WP_016366471.1|2524296_2524794_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	45.2	1.3e-35
WP_095593681.1|2524855_2525248_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	73.6	6.5e-46
WP_016387580.1|2525231_2527697_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	64.7	0.0e+00
WP_095593682.1|2527683_2529777_+	conjugal transfer protein	NA	A0A1S5SF30	Streptococcus_phage	50.8	1.1e-144
WP_095593683.1|2529773_2530769_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	60.0	1.2e-109
WP_014571616.1|2530778_2531312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095593684.1|2531308_2532232_+	conjugal transfer protein	NA	A0A2K5B2A4	Erysipelothrix_phage	38.4	5.3e-06
WP_095593685.1|2533057_2534476_-|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_095593686.1|2534961_2536155_-	MFS transporter	NA	NA	NA	NA	NA
WP_049145604.1|2536201_2537626_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.7	2.3e-69
WP_095593687.1|2537635_2538457_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_016376168.1|2538491_2538875_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_095593688.1|2538966_2540646_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_016387451.1|2541883_2542012_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_095593689.1|2541969_2542512_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_013727997.1|2542936_2543845_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_158293643.1|2544135_2544321_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_095593690.1|2544395_2545183_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP017063	Lactobacillus rhamnosus strain LR5 chromosome, complete genome	2972590	2549870	2610137	2972590	tRNA,transposase,protease,integrase	unidentified_phage(15.38%)	60	2559188:2559203	2573805:2573820
WP_095593693.1|2549870_2550658_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162288598.1|2550835_2552164_-	MFS transporter	NA	NA	NA	NA	NA
WP_095593696.1|2552432_2553116_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.8e-60
WP_095593697.1|2553195_2555898_-	family 15 glucoamylase	NA	NA	NA	NA	NA
WP_095593698.1|2556023_2556944_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.1	6.9e-22
WP_095593700.1|2558284_2558551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095593701.1|2558611_2559076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095593702.1|2559095_2561105_-	AAA family ATPase	NA	NA	NA	NA	NA
2559188:2559203	attL	TTTGTTTTTCCCGATT	NA	NA	NA	NA
WP_158293644.1|2561101_2561275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095593703.1|2561271_2562648_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_095593704.1|2562644_2565890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095593705.1|2566121_2567042_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	3.1e-22
WP_019899267.1|2567335_2567734_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_019899265.1|2567754_2568012_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010490992.1|2568361_2568634_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095593706.1|2568685_2569948_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005691061.1|2570078_2570330_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_005686643.1|2570426_2571686_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_080751304.1|2571763_2571997_-	ATP-dependent nuclease subunit B	NA	NA	NA	NA	NA
WP_162288597.1|2571944_2572091_-	Malolactic regulator	NA	NA	NA	NA	NA
WP_005686647.1|2572178_2573783_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	48.8	7.1e-139
WP_095593707.1|2574213_2575401_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
2573805:2573820	attR	AATCGGGAAAAACAAA	NA	NA	NA	NA
WP_047677951.1|2575502_2575847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047677949.1|2575886_2576243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047677947.1|2576491_2577367_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_047677945.1|2577593_2578274_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_005685261.1|2578317_2578764_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_047677941.1|2579253_2580102_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_047677939.1|2580091_2581444_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.5	3.5e-30
WP_005685256.1|2581455_2581908_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005716692.1|2581979_2583038_+	YdcF family protein	NA	NA	NA	NA	NA
WP_005714120.1|2583100_2583481_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_029607672.1|2583632_2584067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047677935.1|2584155_2584485_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005691037.1|2584581_2585556_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.1	2.0e-43
WP_047677933.1|2585653_2587042_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.6	1.5e-28
WP_005691032.1|2587375_2588581_-	VanZ family protein	NA	NA	NA	NA	NA
WP_005685246.1|2588577_2589426_-	pur operon repressor	NA	A0A1V0SKE5	Klosneuvirus	26.4	1.1e-05
WP_005685245.1|2589647_2590298_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.2	1.1e-16
WP_005685244.1|2590294_2591056_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005685242.1|2591151_2592030_-	cation transporter	NA	NA	NA	NA	NA
WP_047677931.1|2592085_2592964_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005685240.1|2593212_2593464_-	Veg family protein	NA	NA	NA	NA	NA
WP_047678238.1|2593920_2594805_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_047678241.1|2594797_2595367_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_047678243.1|2595363_2596143_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047678245.1|2596149_2596641_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005691013.1|2596855_2597854_+	tagatose 1,6-diphosphate aldolase	NA	NA	NA	NA	NA
WP_047678248.1|2598264_2599146_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_049171026.1|2599281_2599986_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_047678250.1|2599972_2600884_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_047678253.1|2600937_2602764_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	30.0	5.4e-18
WP_047678255.1|2602750_2604664_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	1.6e-20
WP_005699686.1|2604827_2605040_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	44.8	2.3e-05
WP_047678258.1|2605090_2605537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047678260.1|2605595_2607578_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.3	3.5e-95
WP_080751322.1|2607770_2607902_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_047678272.1|2607993_2608872_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_080751323.1|2608894_2609077_-	Malolactic regulator	NA	NA	NA	NA	NA
WP_158293645.1|2609564_2610137_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
