The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016303	Candidatus Hamiltonella defensa (Bemisia tabaci) strain MEAM1, complete genome	1739504	249026	257422	1739504	lysis,portal,holin	Bacteriophage(42.86%)	10	NA	NA
WP_095591325.1|249026_250265_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	67.3	4.0e-158
WP_029589155.1|252610_252970_-	HNH endonuclease	NA	Q9B020	Phage_GMSE-1	77.9	1.6e-43
WP_052735025.1|253031_253511_-|lysis	lysis protein	lysis	Q2A0C4	Sodalis_phage	43.7	2.7e-22
WP_052735024.1|253596_253869_-	glycoside hydrolase family protein	NA	B6SCY8	Bacteriophage	66.7	5.4e-15
WP_046493798.1|253971_254469_-	lysozyme	NA	B6SD42	Bacteriophage	69.6	7.2e-58
WP_015873507.1|254465_254654_-|holin	holin	holin	B6SD41	Bacteriophage	69.6	2.8e-15
WP_046493773.1|255830_256013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157727281.1|256129_256444_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095591326.1|256707_257016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493753.1|257041_257422_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	42.9	4.4e-15
>prophage 2
NZ_CP016303	Candidatus Hamiltonella defensa (Bemisia tabaci) strain MEAM1, complete genome	1739504	280151	400012	1739504	head,tRNA,tail,plate,lysis,terminase	Escherichia_phage(17.02%)	119	NA	NA
WP_016857056.1|280151_280745_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016857057.1|281017_281635_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_046493270.1|281783_282341_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.3	3.0e-28
WP_016857059.1|282384_284304_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	34.2	1.5e-39
WP_016857060.1|284345_284672_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016857061.1|284675_285284_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_095591330.1|286459_288388_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.5	3.1e-109
WP_016856726.1|288558_289209_+	adenylate kinase	NA	NA	NA	NA	NA
WP_157727283.1|289217_289355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130651579.1|289359_289629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016856724.1|289883_292604_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_016856723.1|292708_293257_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_046493272.1|293307_294972_-	asparagine synthase B	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	39.5	4.7e-85
WP_046493291.1|294985_296701_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_016856718.1|297812_298628_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	8.8e-13
WP_016856717.1|298627_299620_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_016856716.1|299619_300519_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_016856715.1|300505_301468_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016856714.1|301464_302262_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_016856713.1|302254_302875_-	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_016856712.1|303073_303931_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.4	1.1e-40
WP_016856711.1|303976_304699_-	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_046493274.1|304699_306187_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016856709.1|306306_306795_+	transcription/translation regulatory transformer protein RfaH	NA	A0A068C9G5	Rhizobium_phage	26.0	2.8e-06
WP_095591331.1|307325_307883_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_016856706.1|307908_309069_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.2	1.9e-85
WP_029588919.1|309089_309782_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	39.5	3.5e-34
WP_016856703.1|309886_310744_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016856702.1|310745_311828_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_016856700.1|313303_313954_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_046493276.1|313950_314826_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_095591332.1|314827_316183_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_016856698.1|316182_316734_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.3	9.9e-08
WP_016856697.1|316730_317561_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_046493282.1|317560_318436_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_016856696.1|318436_319327_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.2	6.7e-14
WP_046493292.1|319323_320247_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016856694.1|320436_321243_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016856693.1|321253_322489_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016856692.1|322661_323411_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016856691.1|323464_324172_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_046493284.1|324460_326509_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_016856689.1|326585_327641_+	hemin-degrading factor	NA	NA	NA	NA	NA
WP_016856688.1|327657_328479_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016856687.1|328475_329474_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_016856686.1|329464_330295_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.3	1.8e-13
WP_157727284.1|330451_330655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095591407.1|330914_331277_-	hypothetical protein	NA	U5P0R9	Shigella_phage	61.0	2.4e-31
WP_052734986.1|334759_335755_-	late control protein	NA	A0A088FRU7	Escherichia_phage	38.8	7.1e-57
WP_046492985.1|335745_335949_-|tail	tail protein	tail	A0A1W6JT40	Escherichia_phage	53.0	4.9e-13
WP_072052300.1|335945_336389_-|tail	phage tail protein	tail	A0A088FQM4	Escherichia_phage	43.4	1.2e-24
WP_095591333.1|336385_338899_-	hypothetical protein	NA	A0A0M3LPE0	Mannheimia_phage	33.7	3.3e-74
WP_016857830.1|338891_339014_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_016857831.1|339037_339286_-|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	42.3	1.2e-08
WP_157727285.1|339251_339452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493496.1|339974_341135_-|tail	tail protein	tail	D5LGY7	Escherichia_phage	54.1	1.4e-133
WP_040056153.1|341314_341626_+	membrane protein	NA	NA	NA	NA	NA
WP_029589100.1|341540_341876_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_016857835.1|342084_342318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016858128.1|344765_345302_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	36.1	4.3e-24
WP_046493298.1|345303_346185_-	hypothetical protein	NA	A0A088FQL4	Escherichia_phage	55.7	5.1e-83
WP_046493299.1|346181_346517_-|plate	phage baseplate protein	plate	V5YTB2	Pseudomonas_phage	57.7	1.3e-31
WP_046493301.1|346513_347092_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	36.7	3.9e-23
WP_029589149.1|347081_347594_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_046493304.1|347620_348070_-	phage virion morphogenesis protein	NA	A0A2P9JZJ5	Alteromonadaceae_phage	37.4	4.4e-22
WP_016858152.1|348069_348504_-	DUF1320 domain-containing protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	36.6	1.3e-15
WP_102135347.1|348511_348775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493305.1|348913_349834_-|head	head protein	head	C9DGP2	Escherichia_phage	56.9	2.4e-99
WP_029589140.1|350967_351261_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	47.3	4.0e-16
WP_046493308.1|351263_351560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	52.6	3.8e-22
WP_046493309.1|353242_354682_-|terminase	phage terminase large subunit	terminase	A0A0N9RQZ8	Pseudomonas_phage	36.2	3.7e-70
WP_016857916.1|355178_355376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016857915.1|355379_355784_-	hypothetical protein	NA	A0A2I7R6R1	Vibrio_phage	40.3	4.2e-16
WP_046493316.1|356394_356739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016857263.1|356900_359132_-	hypothetical protein	NA	I6NPA6	Burkholderia_phage	40.6	2.3e-63
WP_016857264.1|359157_359781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016857265.1|359801_359987_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	47.5	1.0e-09
WP_016857266.1|360066_360762_+	helix-turn-helix domain-containing protein	NA	A0A1B0Z078	Pseudomonas_phage	48.3	2.2e-60
WP_046493049.1|360791_361580_+	hypothetical protein	NA	A0A2H4J8P0	uncultured_Caudovirales_phage	27.4	2.7e-14
WP_016857268.1|361746_361953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016857269.1|362006_362390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046493046.1|362386_363523_+	DUF2800 domain-containing protein	NA	A0A1Q1PW76	Pseudoalteromonas_phage	46.2	2.0e-87
WP_095591334.1|364248_366156_+	XRE family transcriptional regulator	NA	A0A0S0N7U2	Pseudomonas_phage	36.8	6.5e-123
WP_016857273.1|366152_366377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016857274.1|366373_366700_+	VRR-NUC domain-containing protein	NA	Q4ZD25	Staphylococcus_phage	41.6	1.3e-12
WP_016857275.1|366696_368127_+	DEAD/DEAH box helicase	NA	A0A2I7R066	Vibrio_phage	55.2	4.1e-146
WP_016857276.1|368119_368410_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_046493241.1|369644_371021_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_016857279.1|371134_372778_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_016857280.1|372780_373050_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	50.7	2.2e-13
WP_016857281.1|373028_373376_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_016857282.1|373390_373531_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_046493245.1|373960_381040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016857719.1|381231_381816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029589083.1|381897_382929_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_046493246.1|383027_383417_+	hypothetical protein	NA	A0A1W6JP34	Morganella_phage	26.3	9.7e-18
WP_082093623.1|383945_385001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157727286.1|385276_385462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072052320.1|385452_385644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095591335.1|386051_386285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016857836.1|386350_387379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157727286.1|387667_387853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059108268.1|387843_388053_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	54.4	3.0e-10
WP_095591336.1|388447_389974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157727325.1|389980_390343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016857906.1|390730_390892_-	hypothetical protein	NA	A0A192Y7L1	Salmonella_phage	64.1	3.0e-05
WP_046493767.1|391277_391544_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_046493765.1|391587_392055_-|lysis	lysis protein	lysis	Q2A0C4	Sodalis_phage	48.1	3.6e-19
WP_082093638.1|392140_392482_-	lysozyme	NA	B6SCY8	Bacteriophage	66.2	2.9e-18
WP_046493763.1|392864_393119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095591337.1|393257_393734_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	42.7	9.4e-15
WP_095591338.1|394135_395635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046493619.1|395892_396129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052734987.1|396434_397496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082093603.1|397614_397776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016858254.1|398080_398401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016858271.1|398940_399198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082093602.1|399173_399572_+|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	32.0	9.6e-05
WP_072052300.1|399568_400012_+|tail	phage tail protein	tail	A0A088FQM4	Escherichia_phage	43.4	1.2e-24
>prophage 3
NZ_CP016303	Candidatus Hamiltonella defensa (Bemisia tabaci) strain MEAM1, complete genome	1739504	469777	583063	1739504	portal,lysis,capsid,head,tRNA,tail,integrase,protease,holin	Enterobacteria_phage(23.08%)	104	481204:481263	503774:504164
WP_095591342.1|469777_471703_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.0	5.9e-116
WP_029588995.1|471762_472389_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_015874311.1|472540_473017_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_016857215.1|473431_474262_+	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_016857214.1|474277_474769_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_016857213.1|475069_476473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016857212.1|477046_477592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130651582.1|477749_478001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095591343.1|480009_481203_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	48.7	6.3e-92
WP_046493225.1|481177_481405_-	hypothetical protein	NA	A0A1V0E5M4	Salmonella_phage	51.4	5.1e-11
481204:481263	attL	GTATTTTCTCCATGAGGGTTGGTCCAGTGTGATGTTTGACGCTGAGGGGATTGATTTTGA	NA	NA	NA	NA
WP_095591344.1|481979_482663_-	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	59.3	8.9e-75
WP_046493232.1|483032_483353_+	hypothetical protein	NA	Q3LZQ4	Bacteriophage	81.5	1.1e-14
WP_157727289.1|483357_483621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095591345.1|483867_484518_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	36.8	1.6e-28
WP_059108296.1|484617_484842_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	50.9	2.1e-09
WP_050879637.1|484891_485374_+	hypothetical protein	NA	R9TRN6	Vibrio_phage	31.3	8.3e-11
WP_050879636.1|485600_486152_+	ash family protein	NA	NA	NA	NA	NA
WP_046493793.1|486297_487203_+	replication protein	NA	K7PGT1	Enterobacteria_phage	40.2	3.4e-37
WP_046493792.1|487199_488057_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	61.0	2.0e-84
WP_016858231.1|488268_489012_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016858045.1|489317_489527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046493493.1|489822_490146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493898.1|490477_490657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016857815.1|496799_497816_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	31.3	7.6e-30
WP_052734989.1|497870_498830_-	murein hydrolase activator NlpD	NA	A0A0K2CNY2	Brevibacillus_phage	32.4	2.7e-08
WP_100103738.1|498840_499326_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_016857812.1|499334_500060_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016857811.1|500062_500377_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016857810.1|500504_500885_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_016857809.1|500894_501464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095591346.1|501481_502576_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_046493065.1|502714_503773_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	46.8	8.9e-90
WP_046493225.1|503747_503975_-	hypothetical protein	NA	A0A1V0E5M4	Salmonella_phage	51.4	5.1e-11
WP_157727290.1|504075_504471_-	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	58.5	4.5e-31
503774:504164	attR	GTATTTTCTCCATGAGGGTTGGTCCAGTGTGATGTTTGACGCTGAGGGGATTGATTTTGATGGCATTGGCCTGAACAAGGTATTCCCGGCCATCGAGACGAGGGGCGGGGTAGATGATGCCCGCGCGGACCCATCGGCGGACTTGTTCGATGCAACGGGGGCGAGGCTGTTTTTGATTCCACTCTTTAAGCGTGATTTCCATGGGGTGTTTCCTTTAAAATTGAGATAAAAAAAACCCATTCATTCGAATGGGGCGAGATTGAGGACGAAAGAAATTCGCCAAAAAAGAACCAGGGTGTGGGTCAGGACAGGATTTCGTTCAACCTTTTTTCAAGAGCGCGCACTTTGTCGGTGTAGGTCAGCAGAAGGCGACGTAATTCGGCAGGGTCGT	NA	NA	NA	NA
WP_016857985.1|504698_505346_-	hypothetical protein	NA	A0A0R6PHV6	Moraxella_phage	38.2	2.5e-34
WP_046493236.1|505373_506027_-	exonuclease	NA	A0A0U2BXF3	Paracoccus_phage	47.8	9.5e-50
WP_016857986.1|506044_506620_-	hypothetical protein	NA	G9L666	Escherichia_phage	47.6	2.1e-37
WP_095591347.1|507669_508077_+	DUF1640 domain-containing protein	NA	Q3LZQ4	Bacteriophage	81.6	1.3e-12
WP_157727291.1|508081_508363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040056181.1|508843_509440_-	helix-turn-helix domain-containing protein	NA	Q76H56	Enterobacteria_phage	31.6	2.1e-16
WP_029589125.1|509548_509773_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	65.7	5.0e-19
WP_050879637.1|509847_510330_+	hypothetical protein	NA	R9TRN6	Vibrio_phage	31.3	8.3e-11
WP_050879636.1|510555_511107_+	ash family protein	NA	NA	NA	NA	NA
WP_046493793.1|511253_512159_+	replication protein	NA	K7PGT1	Enterobacteria_phage	40.2	3.4e-37
WP_095591349.1|512155_513007_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	61.4	6.9e-85
WP_046493771.1|513003_513213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046493753.1|513209_513590_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	42.9	4.4e-15
WP_046493754.1|513586_513925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016858311.1|514066_514312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095591350.1|514692_515091_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016858197.1|515090_515327_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046493773.1|515443_515626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015873507.1|516802_516991_+|holin	holin	holin	B6SD41	Bacteriophage	69.6	2.8e-15
WP_046493798.1|516987_517485_+	lysozyme	NA	B6SD42	Bacteriophage	69.6	7.2e-58
WP_052735024.1|517587_517860_+	glycoside hydrolase family protein	NA	B6SCY8	Bacteriophage	66.7	5.4e-15
WP_052735025.1|517945_518425_+|lysis	lysis protein	lysis	Q2A0C4	Sodalis_phage	43.7	2.7e-22
WP_029589155.1|518486_518846_+	HNH endonuclease	NA	Q9B020	Phage_GMSE-1	77.9	1.6e-43
WP_095591325.1|521190_522429_+|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	67.3	4.0e-158
WP_095591351.1|522531_523389_+	peptidase S14	NA	K7PH05	Enterobacteria_phage	57.5	1.3e-86
WP_016858055.1|523401_524688_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	67.1	3.7e-146
WP_082665831.1|524738_524948_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016858053.1|525048_525432_+|head	phage head closure protein	head	U5P0R0	Shigella_phage	32.4	3.0e-11
WP_016858052.1|525418_525946_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	53.8	1.5e-42
WP_059108330.1|525942_526386_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	56.1	2.9e-42
WP_157727292.1|526461_526788_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_095591353.1|526856_528356_+|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	60.8	1.5e-159
WP_059108327.1|528355_528712_+|tail	phage tail protein	tail	U5P076	Shigella_phage	69.5	2.1e-43
WP_095591354.1|528708_529062_+|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	50.0	4.1e-23
WP_095591355.1|529116_530985_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	51.3	2.4e-162
WP_095591323.1|533971_534379_+	hypothetical protein	NA	U5P0R9	Shigella_phage	54.9	1.8e-35
WP_095591406.1|536282_536906_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	47.9	1.4e-37
WP_095591356.1|537079_537526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157727293.1|537506_537659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095591357.1|537658_538864_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	79.6	9.9e-186
WP_095591358.1|539325_539913_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.2	1.3e-18
WP_016856947.1|539922_540882_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.1	3.1e-09
WP_095591359.1|540881_542171_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_016856945.1|542188_543565_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_016856944.1|543629_545933_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_016856941.1|546614_547658_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016856940.1|547667_548528_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016856939.1|548663_549152_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_046493553.1|550759_552205_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_046493554.1|552306_552822_+	DedA family protein	NA	NA	NA	NA	NA
WP_016856936.1|552837_553599_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_046493571.1|553651_554260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016856934.1|554256_555888_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	A0A2P0VMP1	Tetraselmis_virus	24.5	8.2e-26
WP_016856933.1|555911_556166_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_046493572.1|556169_556382_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_046493555.1|556414_557134_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	34.3	3.4e-32
WP_016856930.1|557141_558092_-	type I pantothenate kinase	NA	NA	NA	NA	NA
WP_029588951.1|558398_559751_+	chromosomal replication initiator protein DnaA	NA	A0A0A8IKB2	Aurantimonas_phage	38.2	3.0e-05
WP_046493556.1|559767_560874_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.3	1.7e-43
WP_016856926.1|560892_561972_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_016856925.1|561996_564411_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	58.7	2.4e-13
WP_046493557.1|564567_565308_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016856923.1|565462_566254_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_016856922.1|566344_567742_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016856921.1|567765_568827_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_102135339.1|569084_569885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016858098.1|575854_577459_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.0	4.1e-62
WP_046493265.1|577549_578836_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016856949.1|578911_580363_+	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_016856950.1|580453_583063_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.1	4.5e-183
>prophage 4
NZ_CP016303	Candidatus Hamiltonella defensa (Bemisia tabaci) strain MEAM1, complete genome	1739504	635813	687637	1739504	portal,tRNA,tail,integrase,holin,terminase	Bacteriophage(77.5%)	53	646064:646119	685052:685107
WP_016857190.1|635813_636836_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_046493009.1|637007_637724_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016857130.1|637864_638542_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_016857131.1|638555_639368_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	51.8	2.9e-72
WP_016857132.1|639487_640591_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_046493036.1|640624_641146_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_016857134.1|641248_642082_-	RIO1 family serine kinase	NA	NA	NA	NA	NA
WP_095591361.1|642192_644337_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_016857136.1|644392_645616_-	acetate kinase	NA	NA	NA	NA	NA
646064:646119	attL	CTTCTAAGCCGTAGGTCACTGGTTCGAATCCAGTAGGGCGTACCAATAAAATCAAT	NA	NA	NA	NA
WP_016857137.1|646133_647306_-|integrase	site-specific integrase	integrase	Q9T1R0	Acyrthosiphon_pisum_secondary_endosymbiont_phage	97.9	1.6e-225
WP_029588974.1|647758_649144_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	93.2	3.8e-258
WP_072052301.1|649154_649487_-	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	52.4	1.2e-24
WP_072052302.1|649536_649749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016857140.1|649814_650591_-	hypothetical protein	NA	B6SD57	Bacteriophage	68.7	7.9e-96
WP_016857141.1|650948_651419_-	KilA-N domain-containing protein	NA	Q3LZN6	Bacteriophage	51.5	9.9e-33
WP_016857142.1|651525_651822_+	hypothetical protein	NA	Q3LZN5	Bacteriophage	67.3	1.1e-21
WP_157727294.1|651830_652295_-	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	94.7	1.4e-44
WP_102135324.1|656103_656574_-	HNH endonuclease	NA	R9ZY26	Cellulophaga_phage	45.9	6.4e-08
WP_102135323.1|656473_656608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029588976.1|656897_657680_-	ORF6N domain-containing protein	NA	B6SCX2	Bacteriophage	58.8	1.9e-73
WP_016857146.1|657728_657950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016857147.1|657954_658407_+	hypothetical protein	NA	Q3LZQ4	Bacteriophage	89.3	3.2e-20
WP_016857148.1|658492_658687_-	hypothetical protein	NA	Q3LZQ3	Bacteriophage	66.2	8.5e-15
WP_016857149.1|658757_659312_-	DUF2815 family protein	NA	Q3LZQ2	Bacteriophage	89.1	2.9e-92
WP_082093606.1|659327_660647_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	90.4	6.7e-228
WP_046493013.1|660618_661527_-	hypothetical protein	NA	B6SCY0	Bacteriophage	70.3	1.3e-108
WP_052734988.1|662094_662877_-	LexA family transcriptional regulator	NA	Q9T1U7	Acyrthosiphon_pisum_secondary_endosymbiont_phage	88.8	1.4e-127
WP_016858029.1|663174_665430_+	ATPase	NA	Q9T1U5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	92.3	0.0e+00
WP_046493018.1|665902_666349_+	antitermination protein Q	NA	B6SD12	Bacteriophage	100.0	1.7e-79
WP_157727295.1|666771_667584_+	toxin	NA	B6SD13	Bacteriophage	100.0	7.6e-158
WP_016857352.1|667669_668305_+	hypothetical protein	NA	B6SD14	Bacteriophage	100.0	9.3e-119
WP_016857351.1|668339_668519_+|holin	holin	holin	B6SD15	Bacteriophage	100.0	1.2e-26
WP_029589018.1|668535_668820_+|holin	phage holin, lambda family	holin	B6SD16	Bacteriophage	98.9	1.1e-47
WP_016857349.1|668830_669271_+	lysozyme	NA	B6SD17	Bacteriophage	100.0	8.0e-77
WP_016857347.1|669487_669874_+	hypothetical protein	NA	B6SD18	Bacteriophage	100.0	5.4e-61
WP_130651570.1|669758_670034_+	hypothetical protein	NA	B6SD19	Bacteriophage	98.9	3.3e-44
WP_016857345.1|670095_670509_+	hypothetical protein	NA	B6SD20	Bacteriophage	99.3	4.4e-69
WP_029589016.1|670525_671935_+|terminase	PBSX family phage terminase large subunit	terminase	B6SD21	Bacteriophage	99.8	2.0e-275
WP_046493024.1|671934_674103_+|portal	portal protein	portal	B6SD22	Bacteriophage	99.9	0.0e+00
WP_016857342.1|674147_675044_+	phage scaffold protein	NA	B6SD23	Bacteriophage	100.0	2.6e-151
WP_016857341.1|676382_676574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016857340.1|676554_677034_+	packaged DNA stabilization protein p27	NA	B6SCV9	Bacteriophage	90.6	1.8e-74
WP_082093607.1|676987_678421_+	hypothetical protein	NA	Q9T1S0	Acyrthosiphon_pisum_secondary_endosymbiont_phage	91.6	9.4e-260
WP_016857338.1|678420_678951_+	hypothetical protein	NA	B6SCW1	Bacteriophage	85.2	3.2e-72
WP_016857337.1|678950_679418_+	DUF2824 family protein	NA	B6SCW2	Bacteriophage	94.8	1.6e-83
WP_016857336.1|679395_680025_+	hypothetical protein	NA	B6SCW3	Bacteriophage	93.6	5.3e-82
WP_016857335.1|680036_681425_+	DNA transfer protein	NA	B6SCW4	Bacteriophage	95.0	2.0e-243
WP_046493028.1|681424_683302_+	hypothetical protein	NA	B6SCW5	Bacteriophage	89.1	7.6e-310
WP_016858042.1|683330_684356_+|tail	tailspike protein p36	tail	B6SCW6	Bacteriophage	66.4	9.8e-102
WP_046493031.1|684334_684802_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	67.6	2.3e-50
WP_046493316.1|686276_686621_+	hypothetical protein	NA	NA	NA	NA	NA
685052:685107	attR	CTTCTAAGCCGTAGGTCACTGGTTCGAATCCAGTAGGGCGTACCAATAAAATCAAT	NA	NA	NA	NA
WP_046493314.1|686747_687233_+	M15 family metallopeptidase	NA	A0A2D1GMU0	Marinobacter_phage	55.2	4.6e-41
WP_016857915.1|687232_687637_+	hypothetical protein	NA	A0A2I7R6R1	Vibrio_phage	40.3	4.2e-16
>prophage 5
NZ_CP016303	Candidatus Hamiltonella defensa (Bemisia tabaci) strain MEAM1, complete genome	1739504	1017701	1026768	1739504	tRNA	uncultured_Caudovirales_phage(33.33%)	8	NA	NA
WP_029589045.1|1017701_1019108_+	Si-specific NAD(P)(+) transhydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	6.0e-33
WP_029589044.1|1019219_1019765_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.8	1.6e-50
WP_016857475.1|1019857_1021765_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	4.2e-146
WP_016857474.1|1021892_1023008_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	30.4	8.9e-24
WP_016857473.1|1023086_1024262_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.4	1.5e-85
WP_016857472.1|1024502_1024766_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016857471.1|1024969_1025284_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_016857470.1|1025364_1026768_+|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	24.2	2.7e-09
>prophage 6
NZ_CP016303	Candidatus Hamiltonella defensa (Bemisia tabaci) strain MEAM1, complete genome	1739504	1197191	1204121	1739504		Planktothrix_phage(16.67%)	9	NA	NA
WP_016856830.1|1197191_1197950_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G9BWD6	Planktothrix_phage	30.1	2.9e-18
WP_016856829.1|1198207_1199185_+	arabinose-5-phosphate isomerase KdsD	NA	A0A0A0Q3B9	Pectobacterium_bacteriophage	35.8	1.2e-19
WP_016856828.1|1199200_1199758_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	69.7	1.7e-47
WP_016856827.1|1199771_1200386_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016856826.1|1200360_1200906_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_016856825.1|1200905_1201631_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	7.6e-24
WP_016856824.1|1201711_1202182_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_016856823.1|1202279_1203134_+	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	29.8	5.8e-07
WP_016856822.1|1203200_1204121_+	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	39.5	6.9e-46
