The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023050	Listeria monocytogenes strain FDA971911-001-001 chromosome, complete genome	3086261	125862	132389	3086261	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|125862_126315_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|126320_126656_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_009927883.1|126872_127301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731177.1|127312_127729_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
WP_003728212.1|128008_128398_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003721744.1|128410_128923_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|128970_129273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|129314_129719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928420.1|129705_131574_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	4.5e-20
WP_003734720.1|131570_132389_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NZ_CP023050	Listeria monocytogenes strain FDA971911-001-001 chromosome, complete genome	3086261	689727	745111	3086261	capsid,terminase,protease,tail,transposase,portal,integrase,head,holin	Listeria_phage(53.12%)	65	682433:682450	742859:742876
682433:682450	attL	AGCCTTCTAAATCATTTT	NA	NA	NA	NA
WP_031641925.1|689727_690879_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	46.3	3.4e-87
WP_031641924.1|690900_691614_-	lipoprotein	NA	NA	NA	NA	NA
WP_031641923.1|691668_692169_-	hypothetical protein	NA	A0A1S7FYX8	Listeria_phage	31.1	7.1e-13
WP_031641922.1|692169_692520_-	helix-turn-helix domain-containing protein	NA	A0A059T669	Listeria_phage	49.0	2.3e-18
WP_031641921.1|692673_692871_+	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	52.3	7.5e-11
WP_031641920.1|692893_693220_+	DUF771 domain-containing protein	NA	A0A2H4J474	uncultured_Caudovirales_phage	41.5	4.9e-15
WP_031641918.1|694432_694789_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012951305.1|695199_695376_+	hypothetical protein	NA	A8ATL8	Listeria_phage	69.0	1.7e-14
WP_031641917.1|695389_695914_+	hypothetical protein	NA	A0A059T5F9	Listeria_phage	98.3	2.8e-97
WP_003731842.1|695926_696094_+	hypothetical protein	NA	A8ASN5	Listeria_phage	80.0	9.2e-18
WP_003731843.1|696105_696321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031645809.1|696399_696993_+	pentapeptide repeat-containing protein	NA	A8ATE4	Listeria_phage	88.6	6.0e-43
WP_060595899.1|697035_697749_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	2.7e-130
WP_088518278.1|697759_698704_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	98.1	1.1e-176
WP_009928035.1|698716_699397_+	hypothetical protein	NA	A8ATD7	Listeria_phage	96.5	1.1e-120
WP_031641750.1|699393_699603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951315.1|699652_699844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951316.1|699903_700422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951317.1|700418_700961_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	53.3	4.3e-48
WP_012951318.1|701242_701470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102578311.1|701495_701771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049961585.1|701767_702130_+	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	44.1	3.5e-14
WP_012951321.1|702224_702752_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	46.7	6.1e-31
WP_012951322.1|702720_704472_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	50.7	4.1e-156
WP_023552290.1|704478_704679_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_012951323.1|704681_705917_+|portal	phage portal protein	portal	A0A2H4JAR2	uncultured_Caudovirales_phage	42.1	3.6e-82
WP_012951324.1|705913_706480_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1D6Z2A7	Staphylococcus_phage	52.2	1.0e-44
WP_012951325.1|706543_707713_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	38.1	2.1e-44
WP_012951326.1|707761_708100_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	37.8	8.1e-13
WP_012951327.1|708069_708390_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012951328.1|708383_708749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951329.1|708751_709150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031641752.1|709170_709746_+|tail	phage major tail protein	tail	M1PRQ7	Streptococcus_phage	42.9	9.2e-33
WP_012951331.1|709835_710183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951333.1|710379_714579_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	33.0	1.2e-12
WP_012951334.1|714571_716815_+	minor structural protein GP75	NA	A0A059T682	Listeria_phage	29.4	1.6e-56
WP_031641753.1|716820_719112_+	phage minor structural protein	NA	A0A059T7Y6	Listeria_phage	38.2	8.8e-135
WP_031641433.1|719104_720166_+	hypothetical protein	NA	A8ATW1	Listeria_phage	68.6	1.6e-94
WP_003722523.1|720204_720570_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|720582_720864_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_012951337.1|720863_721709_+	peptidase M15	NA	A0A059T7Y8	Listeria_phage	93.3	4.8e-139
WP_003724378.1|722561_723233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724379.1|723262_723448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724380.1|723988_724522_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_014929420.1|724585_725503_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_021496183.1|725768_727649_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.1	8.3e-107
WP_003724383.1|727743_728472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724384.1|728611_729262_+	TalA family protein	NA	M4SLG0	Cyanophage	29.3	1.7e-14
WP_003740476.1|729304_731125_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.7	7.7e-49
WP_003727231.1|731359_732751_+	amino acid permease	NA	NA	NA	NA	NA
WP_088518281.1|732840_733680_+	VOC family protein	NA	NA	NA	NA	NA
WP_003721764.1|733762_734047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003724388.1|734144_735095_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003724389.1|735118_735760_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003727229.1|735802_738493_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003731019.1|738538_739186_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003731020.1|739195_739732_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003740477.1|739718_740711_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_003721771.1|740901_741111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727224.1|741178_741886_+	serine/threonine protein phosphatase	NA	A0A249Y183	Enterococcus_phage	28.2	1.3e-20
WP_003724396.1|741931_742495_-	DUF420 domain-containing protein	NA	NA	NA	NA	NA
WP_003724397.1|742614_743031_+	hypothetical protein	NA	NA	NA	NA	NA
742859:742876	attR	AAAATGATTTAGAAGGCT	NA	NA	NA	NA
WP_009928463.1|743073_743703_+	endonuclease III domain-containing protein	NA	NA	NA	NA	NA
WP_023550362.1|743699_744596_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003724400.1|744829_745111_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP023050	Listeria monocytogenes strain FDA971911-001-001 chromosome, complete genome	3086261	1161014	1168437	3086261		Hokovirus(33.33%)	8	NA	NA
WP_003730941.1|1161014_1161398_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003727002.1|1161419_1162403_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_026747136.1|1162417_1163431_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003721509.1|1163639_1165130_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_088518287.1|1165141_1165966_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.2	9.7e-68
WP_009929872.1|1165978_1166287_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_009929871.1|1166347_1166752_+	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_023550418.1|1166880_1168437_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	6.0e-18
>prophage 4
NZ_CP023050	Listeria monocytogenes strain FDA971911-001-001 chromosome, complete genome	3086261	1315339	1372178	3086261	tRNA,protease	Bacillus_virus(16.67%)	56	NA	NA
WP_003734523.1|1315339_1316479_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1316558_1316954_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1317104_1317320_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|1317443_1317977_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|1317992_1318658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|1318919_1319858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1319972_1321256_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1321440_1322700_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003726393.1|1322818_1323385_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003726394.1|1323419_1323989_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003727520.1|1324090_1324633_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003726396.1|1324642_1325506_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003727519.1|1325502_1326288_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.6	6.7e-26
WP_003727518.1|1326421_1327282_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003727517.1|1327554_1329633_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	5.4e-107
WP_003726401.1|1329695_1331000_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_023550485.1|1331282_1332185_+	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	29.5	1.8e-14
WP_031641425.1|1332205_1332745_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003727514.1|1332758_1334168_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	7.5e-44
WP_003726695.1|1334188_1334968_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_023550487.1|1335070_1335490_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003724130.1|1335512_1335824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726697.1|1335826_1336699_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003726698.1|1336740_1337337_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003727511.1|1337494_1337902_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_003727510.1|1338082_1340050_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	5.1e-123
WP_010958880.1|1340046_1342506_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.8	1.1e-101
WP_003726814.1|1342588_1343056_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_023550490.1|1343683_1345492_+	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_088518289.1|1345524_1347411_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	32.2	3.8e-43
WP_026747190.1|1347623_1348322_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	32.4	2.2e-12
WP_003723738.1|1348554_1350231_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_003726658.1|1350357_1351275_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003719566.1|1351396_1351630_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_012681271.1|1351740_1352964_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003727505.1|1352956_1354183_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003719570.1|1354384_1354753_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723435.1|1354823_1356158_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_023550496.1|1356301_1357597_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	62.1	2.2e-146
WP_003734519.1|1357630_1358155_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009928625.1|1358185_1358800_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_026747189.1|1358955_1359285_+	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003727501.1|1359378_1359606_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_009928628.1|1359752_1361747_+	transketolase	NA	NA	NA	NA	NA
WP_003726667.1|1361967_1362207_+	YneF family protein	NA	NA	NA	NA	NA
WP_003726668.1|1362255_1362987_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	58.0	2.3e-81
WP_003726669.1|1363008_1363515_-	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	1.4e-56
WP_003731336.1|1363524_1364829_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	1.2e-133
WP_012681273.1|1364818_1366024_-	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	46.6	7.0e-91
WP_003727498.1|1366001_1366376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723449.1|1366668_1367397_+	UMP kinase	NA	NA	NA	NA	NA
WP_003723450.1|1367396_1367954_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003727497.1|1368184_1368943_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
WP_003727496.1|1368956_1369745_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003726414.1|1369759_1370902_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_088518290.1|1370915_1372178_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 5
NZ_CP023050	Listeria monocytogenes strain FDA971911-001-001 chromosome, complete genome	3086261	1731927	1779190	3086261	terminase,plate,integrase,head,holin	Listeria_phage(100.0%)	74	1731374:1731393	1779224:1779243
1731374:1731393	attL	ATCCCACAAAAATCCCACAA	NA	NA	NA	NA
WP_069002483.1|1731927_1732293_+	hypothetical protein	NA	A8ATJ4	Listeria_phage	100.0	9.6e-60
WP_015987340.1|1732306_1732510_+	hypothetical protein	NA	A8ATJ3	Listeria_phage	100.0	2.1e-32
WP_015987339.1|1732537_1732759_+	helix-turn-helix transcriptional regulator	NA	A8ATJ2	Listeria_phage	100.0	1.4e-34
WP_015987338.1|1732821_1733787_-	PlyB054	NA	A8ATJ1	Listeria_phage	100.0	1.0e-185
WP_015987337.1|1733786_1734044_-|holin	phage holin	holin	A8ATJ0	Listeria_phage	100.0	2.0e-40
WP_015987336.1|1734054_1734270_-	LysM peptidoglycan-binding domain-containing protein	NA	A8ATI9	Listeria_phage	100.0	1.1e-28
WP_015987335.1|1734288_1734735_-	hypothetical protein	NA	A8ATI8	Listeria_phage	100.0	4.0e-68
WP_015987334.1|1734710_1735157_-	hypothetical protein	NA	A8ATI7	Listeria_phage	100.0	4.4e-75
WP_015987333.1|1735343_1735685_-	hypothetical protein	NA	A8ATI5	Listeria_phage	100.0	1.5e-46
WP_015987332.1|1735690_1736419_-	hypothetical protein	NA	A8ATI4	Listeria_phage	100.0	3.5e-138
WP_010991663.1|1736439_1737081_-	hypothetical protein	NA	A8ATI3	Listeria_phage	100.0	9.1e-114
WP_088518295.1|1737070_1738222_-|plate	baseplate J/gp47 family protein	plate	A8ATI2	Listeria_phage	99.7	7.2e-210
WP_010991665.1|1738214_1738577_-	DUF2634 domain-containing protein	NA	A8ATI1	Listeria_phage	100.0	1.4e-58
WP_010991666.1|1738573_1738912_-	hypothetical protein	NA	A8ATI0	Listeria_phage	100.0	5.4e-57
WP_010991667.1|1738912_1739719_-	hypothetical protein	NA	A8ATH9	Listeria_phage	100.0	5.4e-148
WP_010991668.1|1739718_1740084_-	hypothetical protein	NA	A8ATH8	Listeria_phage	100.0	3.2e-63
WP_010991669.1|1740083_1740647_-	LysM peptidoglycan-binding domain-containing protein	NA	A8ATH7	Listeria_phage	100.0	9.2e-94
WP_015987331.1|1740652_1745368_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	100.0	0.0e+00
WP_003731526.1|1745369_1745582_-	hypothetical protein	NA	A8ATH5	Listeria_phage	100.0	3.7e-32
WP_003731525.1|1745544_1745901_-	hypothetical protein	NA	A8ATH4	Listeria_phage	100.0	1.4e-60
WP_003731524.1|1745953_1746352_-	hypothetical protein	NA	A8ATH3	Listeria_phage	100.0	4.7e-68
WP_003731523.1|1746368_1747364_-	DUF3383 family protein	NA	A8ATH2	Listeria_phage	100.0	1.9e-182
WP_003731522.1|1747368_1747857_-	hypothetical protein	NA	A8ATH1	Listeria_phage	100.0	3.2e-87
WP_003731521.1|1747846_1748221_-	hypothetical protein	NA	A8ATH0	Listeria_phage	100.0	4.6e-65
WP_003731520.1|1748220_1748820_-	hypothetical protein	NA	A8ATG9	Listeria_phage	100.0	2.6e-110
WP_003731519.1|1748819_1749155_-	DUF4054 domain-containing protein	NA	A8ATG8	Listeria_phage	100.0	2.1e-53
WP_003731518.1|1749166_1749553_-	hypothetical protein	NA	A8ATG7	Listeria_phage	97.7	1.0e-64
WP_003731517.1|1749575_1750481_-	DUF2184 domain-containing protein	NA	A8ATG6	Listeria_phage	99.0	2.1e-164
WP_003731516.1|1750501_1750951_-	hypothetical protein	NA	A8ATG5	Listeria_phage	100.0	9.0e-76
WP_003731515.1|1750950_1752060_-	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	100.0	6.5e-176
WP_003731514.1|1752108_1752279_-	hypothetical protein	NA	A8ATG3	Listeria_phage	100.0	1.1e-26
WP_003731513.1|1752275_1753685_-|head	phage head morphogenesis protein	head	A8ATG2	Listeria_phage	100.0	7.8e-267
WP_003731512.1|1753677_1755063_-	DUF1073 domain-containing protein	NA	A8ATG1	Listeria_phage	100.0	1.1e-265
WP_003731511.1|1755076_1756537_-|terminase	phage terminase large subunit	terminase	A8ATG0	Listeria_phage	100.0	4.4e-289
WP_003731510.1|1756514_1757399_-	hypothetical protein	NA	A8ATF9	Listeria_phage	99.3	6.6e-139
WP_010990878.1|1757444_1757669_-	hypothetical protein	NA	A8ATN8	Listeria_phage	100.0	2.7e-36
WP_010991671.1|1757696_1757927_-	hypothetical protein	NA	A8ATN7	Listeria_phage	100.0	9.7e-34
WP_003731507.1|1758057_1758255_-	hypothetical protein	NA	A8ATN6	Listeria_phage	100.0	5.2e-28
WP_015987349.1|1758302_1759640_-	ParB N-terminal domain-containing protein	NA	A8ATN5	Listeria_phage	100.0	9.7e-259
WP_003731505.1|1759636_1759930_-	hypothetical protein	NA	A8ATN4	Listeria_phage	100.0	2.3e-48
WP_003731503.1|1760457_1761225_-	hypothetical protein	NA	A8ATN0	Listeria_phage	100.0	1.6e-141
WP_003731502.1|1761237_1761660_-	hypothetical protein	NA	A8ATM9	Listeria_phage	100.0	6.3e-71
WP_088518296.1|1761740_1762301_-	hypothetical protein	NA	A8ATM8	Listeria_phage	96.2	5.4e-102
WP_003731500.1|1762312_1762564_-	DUF3850 domain-containing protein	NA	A8ATM7	Listeria_phage	95.2	9.9e-40
WP_003731499.1|1762560_1762713_-	hypothetical protein	NA	A8ATM6	Listeria_phage	100.0	8.1e-21
WP_003731498.1|1762913_1763249_-	hypothetical protein	NA	A8ATZ5	Listeria_phage	93.1	4.6e-08
WP_003731496.1|1763456_1763840_-	preprotein translocase subunit YajC	NA	A8ATZ3	Listeria_phage	88.2	2.4e-53
WP_003731495.1|1763943_1764159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731494.1|1764155_1764365_-	hypothetical protein	NA	A8ATE0	Listeria_phage	98.6	4.8e-32
WP_003731493.1|1764361_1764886_-	hypothetical protein	NA	A8ASP1	Listeria_phage	47.8	1.1e-32
WP_003731492.1|1764902_1766264_-	hypothetical protein	NA	A8ATM0	Listeria_phage	96.5	2.5e-254
WP_003731491.1|1766260_1766683_-	hypothetical protein	NA	A8ATL9	Listeria_phage	100.0	1.2e-53
WP_003731490.1|1766694_1766871_-	hypothetical protein	NA	A8ATL8	Listeria_phage	100.0	2.0e-23
WP_003731489.1|1766830_1767211_-	hypothetical protein	NA	A8ATL7	Listeria_phage	100.0	3.1e-69
WP_003731488.1|1767251_1767872_-	hypothetical protein	NA	A8ATL6	Listeria_phage	100.0	1.1e-108
WP_003731487.1|1767892_1768330_-	RusA family crossover junction endodeoxyribonuclease	NA	A8ATL5	Listeria_phage	100.0	1.6e-77
WP_003731486.1|1768310_1768520_-	hypothetical protein	NA	A8ATL4	Listeria_phage	100.0	8.2e-32
WP_003731485.1|1768520_1768727_-	hypothetical protein	NA	A8ATL3	Listeria_phage	100.0	5.6e-33
WP_003731483.1|1768904_1769720_-	ATP-binding protein	NA	A8ATL1	Listeria_phage	100.0	4.8e-144
WP_003731482.1|1769643_1770561_-	DUF4373 domain-containing protein	NA	A8ATL0	Listeria_phage	100.0	2.2e-169
WP_003731481.1|1770572_1771310_-	MBL fold metallo-hydrolase	NA	A8ATK9	Listeria_phage	100.0	1.7e-135
WP_003731480.1|1771269_1772055_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	100.0	7.9e-144
WP_015987342.1|1772055_1773999_-	AAA family ATPase	NA	A8ATK7	Listeria_phage	100.0	0.0e+00
WP_095591257.1|1773985_1774327_-	hypothetical protein	NA	A8ATK6	Listeria_phage	99.1	1.0e-55
WP_003731477.1|1774344_1774572_-	hypothetical protein	NA	A8ATK5	Listeria_phage	100.0	1.8e-32
WP_003731476.1|1774749_1775040_-	hypothetical protein	NA	A8ATK4	Listeria_phage	100.0	4.6e-49
WP_049872582.1|1775189_1775384_-	hypothetical protein	NA	A8ATK3	Listeria_phage	100.0	9.4e-22
WP_003731474.1|1775358_1775652_-	helix-turn-helix domain-containing protein	NA	A8ATK2	Listeria_phage	100.0	2.3e-48
WP_003731473.1|1775666_1776191_-	hypothetical protein	NA	A8ATK1	Listeria_phage	100.0	5.5e-93
WP_003731472.1|1776267_1776453_-	helix-turn-helix transcriptional regulator	NA	A8ATK0	Listeria_phage	100.0	1.2e-29
WP_003731471.1|1776613_1777042_+	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	100.0	4.0e-73
WP_003731470.1|1777058_1777478_+	ImmA/IrrE family metallo-endopeptidase	NA	A8ATJ8	Listeria_phage	100.0	4.0e-78
WP_003731469.1|1777525_1777918_+	hypothetical protein	NA	A8ATJ7	Listeria_phage	100.0	2.3e-59
WP_003731468.1|1778014_1779190_+|integrase	site-specific integrase	integrase	A8ATJ6	Listeria_phage	100.0	6.2e-225
1779224:1779243	attR	ATCCCACAAAAATCCCACAA	NA	NA	NA	NA
>prophage 6
NZ_CP023050	Listeria monocytogenes strain FDA971911-001-001 chromosome, complete genome	3086261	1852276	1885142	3086261	capsid,terminase,protease,tail,portal,head,holin	Erysipelothrix_phage(67.74%)	39	NA	NA
WP_014929970.1|1852276_1853191_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D8ETE4	Propionibacterium_phage	44.0	3.9e-33
WP_025186379.1|1853180_1853594_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	57.0	1.5e-37
WP_003731143.1|1853642_1854062_-	DUF1617 family protein	NA	A0A1S5RCP5	Lactobacillus_phage	26.5	2.4e-06
WP_003731142.1|1854048_1854210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731141.1|1854222_1858287_-	hypothetical protein	NA	A0A1B1P770	Bacillus_phage	41.8	8.7e-85
WP_003731140.1|1858271_1858964_-	hypothetical protein	NA	A0A1L2BYA2	Clostridium_phage	29.0	1.7e-20
WP_003731139.1|1858979_1861541_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	74.1	3.9e-83
WP_003731138.1|1861608_1862253_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_003731137.1|1862504_1862888_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	64.2	5.4e-37
WP_003731136.1|1862897_1863488_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	72.2	4.1e-76
WP_029645088.1|1863489_1863798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731135.1|1863824_1864256_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	59.4	7.6e-40
WP_003731134.1|1864248_1864587_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	54.7	1.7e-23
WP_003731133.1|1864583_1864895_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	74.0	2.2e-36
WP_003731132.1|1864905_1866123_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	48.0	1.1e-102
WP_095591263.1|1866126_1866879_-|protease	Clp protease ClpP	protease	M1PLE5	Streptococcus_phage	55.7	1.9e-62
WP_014929974.1|1866775_1868137_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	74.0	2.7e-179
WP_100066221.1|1868204_1868465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088518322.1|1868596_1870189_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	84.8	7.2e-269
WP_003731127.1|1870249_1870474_-	hypothetical protein	NA	A0A2K5B284	Erysipelothrix_phage	48.6	2.0e-15
WP_023559365.1|1870463_1870652_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_003731125.1|1870635_1870830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731124.1|1870832_1871222_-	DUF4314 domain-containing protein	NA	E4ZFL7	Streptococcus_phage	71.0	3.1e-16
WP_003731123.1|1871310_1872561_-	site-specific DNA-methyltransferase	NA	A0A2I4R670	Erysipelothrix_phage	62.0	7.4e-144
WP_100066220.1|1872550_1872928_-	hypothetical protein	NA	A0A0B5HE03	Vibrio_phage	38.8	4.5e-12
WP_014929977.1|1873152_1873935_-	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_031641527.1|1873939_1874518_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	52.8	1.2e-53
WP_031641526.1|1874650_1875016_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	56.9	1.4e-31
WP_003731117.1|1875183_1875612_-	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	45.8	1.5e-27
WP_014929979.1|1875608_1876961_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	69.0	6.8e-159
WP_003731115.1|1876960_1877245_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	60.2	3.5e-25
WP_003731114.1|1877241_1877451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731113.1|1877588_1879832_-	hypothetical protein	NA	A0A1B0RXC5	Streptococcus_phage	49.7	4.8e-210
WP_014929980.1|1879824_1880169_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	51.4	4.1e-28
WP_014929981.1|1880161_1880932_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	50.8	2.7e-64
WP_003731110.1|1881142_1883080_-	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	68.6	7.7e-265
WP_003731109.1|1883140_1883683_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	77.2	8.9e-78
WP_003731108.1|1883684_1884827_-	DUF2800 domain-containing protein	NA	M1Q218	Streptococcus_phage	57.8	1.5e-122
WP_010821424.1|1884827_1885142_-	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	41.5	6.6e-09
>prophage 7
NZ_CP023050	Listeria monocytogenes strain FDA971911-001-001 chromosome, complete genome	3086261	1966219	1974505	3086261		Synechococcus_phage(33.33%)	8	NA	NA
WP_003726209.1|1966219_1966786_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
WP_003726210.1|1966782_1967832_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|1967850_1969278_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_009918191.1|1969262_1971482_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_003726212.1|1971474_1972158_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1972161_1972407_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003726214.1|1972418_1973132_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.0e-40
WP_003729814.1|1973212_1974505_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 8
NZ_CP023050	Listeria monocytogenes strain FDA971911-001-001 chromosome, complete genome	3086261	2501670	2543227	3086261	capsid,terminase,tail,plate,portal,integrase,holin	Listeria_phage(93.75%)	67	2498767:2498782	2535826:2535841
2498767:2498782	attL	TGCAAAAATCACTTTC	NA	NA	NA	NA
WP_012951563.1|2501670_2501904_-	hypothetical protein	NA	A8ATC5	Listeria_phage	98.7	1.6e-36
WP_023548524.1|2502300_2502468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031641270.1|2502732_2503578_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	94.7	1.6e-137
WP_003722522.1|2503577_2503859_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003727799.1|2503871_2504237_-	hypothetical protein	NA	A8ASL3	Listeria_phage	97.9	1.7e-11
WP_003722524.1|2504264_2504423_-	hypothetical protein	NA	Q9T1A1	Listeria_phage	100.0	6.0e-19
WP_003731746.1|2504427_2504745_-	hypothetical protein	NA	Q9T1A2	Listeria_phage	92.4	1.7e-49
WP_088518304.1|2504756_2505830_-|plate	phage baseplate upper protein	plate	Q9T1A3	Listeria_phage	90.5	1.1e-180
WP_014931687.1|2505829_2506858_-	hypothetical protein	NA	Q9T1A4	Listeria_phage	98.8	2.1e-189
WP_031645706.1|2506858_2507884_-	phage minor structural protein	NA	Q9T1A5	Listeria_phage	93.3	3.9e-191
WP_031645707.1|2507892_2508711_-|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	93.4	3.8e-149
WP_088518305.1|2508712_2514097_-	tape measure protein	NA	Q9T1A7	Listeria_phage	97.8	0.0e+00
WP_003722531.1|2514107_2514713_-	hypothetical protein	NA	Q9T1A8	Listeria_phage	100.0	1.3e-109
WP_003727791.1|2514718_2515141_-|tail	phage tail assembly chaperone	tail	Q9T1A9	Listeria_phage	100.0	4.1e-70
WP_003727790.1|2515195_2515528_-	hypothetical protein	NA	Q9T1B0	Listeria_phage	99.1	1.8e-49
WP_009925981.1|2515457_2515892_-|tail	tail protein	tail	Q9T1B1	Listeria_phage	97.9	3.0e-76
WP_003737937.1|2515894_2516302_-	hypothetical protein	NA	A8ASK1	Listeria_phage	99.3	2.0e-66
WP_029508830.1|2516301_2516640_-	hypothetical protein	NA	A0A0B5CTV8	Listeria_phage	95.5	5.4e-57
WP_055310957.1|2516639_2517002_-	hypothetical protein	NA	A0A059T658	Listeria_phage	95.0	1.5e-60
WP_009925044.1|2517001_2517397_-	hypothetical protein	NA	A0A059T5E3	Listeria_phage	82.4	2.2e-54
WP_009925045.1|2517398_2517557_-	hypothetical protein	NA	A8ASJ7	Listeria_phage	92.3	9.6e-17
WP_088518306.1|2517556_2518456_-|capsid	phage major capsid protein	capsid	Q9T1B7	Listeria_phage	99.3	5.0e-166
WP_009925047.1|2518479_2519049_-	scaffold protein	NA	A0A0B5CTV7	Listeria_phage	97.9	1.2e-80
WP_039381673.1|2519127_2520267_-	hypothetical protein	NA	A8ASJ4	Listeria_phage	96.0	1.3e-200
WP_060577779.1|2520267_2522037_-|portal	phage portal protein	portal	A8ASJ3	Listeria_phage	91.2	7.8e-264
WP_031645718.1|2522049_2523381_-|terminase	PBSX family phage terminase large subunit	terminase	A8ASJ2	Listeria_phage	98.9	3.5e-261
WP_031645719.1|2523349_2523892_-|terminase	terminase small subunit	terminase	A8ASJ1	Listeria_phage	98.3	1.2e-90
WP_010990212.1|2523949_2524213_-	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	78.2	1.7e-34
WP_009911405.1|2524239_2524539_-	phage protein	NA	A0A2H4JBC0	uncultured_Caudovirales_phage	40.7	3.8e-14
WP_003735131.1|2524933_2525368_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	99.3	4.3e-75
WP_046377523.1|2525512_2525917_-	endodeoxyribonuclease	NA	A8AU00	Listeria_phage	99.3	2.1e-71
WP_014601286.1|2525882_2526023_-	BH0509 family protein	NA	A8ATZ9	Listeria_phage	100.0	2.6e-18
WP_088518307.1|2526019_2526325_-	response regulator	NA	A8ATZ8	Listeria_phage	92.1	3.4e-42
WP_088518308.1|2526356_2526839_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	92.5	1.0e-77
WP_088518309.1|2526835_2527081_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	90.7	1.5e-32
WP_088518310.1|2527073_2527409_-	hypothetical protein	NA	A8ATZ5	Listeria_phage	89.7	2.1e-08
WP_085400849.1|2527408_2527597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003727764.1|2527593_2527779_-	hypothetical protein	NA	A0A059T5G1	Listeria_phage	100.0	4.1e-27
WP_003725081.1|2527775_2527964_-	SAM--benzoic acid carboxyl methyltransferase	NA	D7RWG4	Brochothrix_phage	49.1	4.4e-08
WP_088518311.1|2527967_2528486_-	hypothetical protein	NA	A8ASP1	Listeria_phage	52.6	9.8e-34
WP_023548475.1|2528482_2528851_-	hypothetical protein	NA	Q8W5X1	Listeria_phage	87.7	1.1e-55
WP_023548473.1|2528847_2529027_-	hypothetical protein	NA	A0A059T5G0	Listeria_phage	93.2	6.0e-23
WP_023548471.1|2529023_2529704_-	hypothetical protein	NA	A8ATD7	Listeria_phage	97.8	3.3e-122
WP_023548469.1|2529716_2530661_-|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	98.4	1.7e-177
WP_023548467.1|2530671_2531385_-	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	96.6	7.2e-128
WP_088518312.1|2531381_2532314_-	DnaD domain-containing protein	NA	A8ATY7	Listeria_phage	98.1	9.7e-165
WP_079441179.1|2532333_2533149_-	recombinase RecT	NA	A8ATY6	Listeria_phage	98.5	1.0e-149
WP_077915324.1|2533151_2534111_-	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	99.4	2.7e-178
WP_003733629.1|2534346_2534535_-	hypothetical protein	NA	Q9T175	Listeria_phage	80.6	1.2e-21
WP_003733630.1|2534642_2534858_-	hypothetical protein	NA	Q9T176	Listeria_phage	67.6	9.7e-20
WP_003733631.1|2534854_2535388_-	hypothetical protein	NA	Q9T177	Listeria_phage	87.6	5.5e-80
WP_088518313.1|2535510_2536290_-	phage antirepressor Ant	NA	A0A059T6E7	Listeria_phage	96.5	3.4e-139
2535826:2535841	attR	TGCAAAAATCACTTTC	NA	NA	NA	NA
WP_088518314.1|2536353_2536584_+	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	97.4	2.0e-34
WP_003727748.1|2536588_2536750_-	hypothetical protein	NA	A0A059T7X7	Listeria_phage	98.1	1.2e-19
WP_003769995.1|2536781_2537063_-	hypothetical protein	NA	Q9T180	Listeria_phage	96.8	1.4e-39
WP_003733634.1|2537059_2537296_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	100.0	3.3e-37
WP_003769996.1|2537335_2537620_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	98.9	1.6e-46
WP_003735007.1|2537631_2537826_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	100.0	1.3e-26
WP_003731220.1|2537829_2538081_-	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	100.0	7.6e-40
WP_009911345.1|2538229_2538538_+	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	98.0	7.8e-47
WP_009911346.1|2538568_2539060_+	bacteriophage gp35-type protein	NA	A8ATX4	Listeria_phage	98.8	1.1e-90
WP_025370648.1|2539082_2539301_+	zinc-ribbon domain-containing protein	NA	A0A059T6E3	Listeria_phage	97.2	1.3e-32
WP_003770013.1|2539316_2540039_+	hypothetical protein	NA	A0A059T7P9	Listeria_phage	84.6	7.4e-88
WP_003770015.1|2540060_2540936_+	hypothetical protein	NA	A0A0B5D0D1	Listeria_phage	94.5	2.2e-150
WP_009911646.1|2540999_2542358_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	97.1	2.0e-251
WP_031641942.1|2542348_2542825_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|2542879_2543227_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 9
NZ_CP023050	Listeria monocytogenes strain FDA971911-001-001 chromosome, complete genome	3086261	2687550	2695392	3086261		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|2687550_2688522_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003731212.1|2688529_2689498_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|2689499_2690375_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003725409.1|2690482_2692213_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	9.5e-174
WP_077915067.1|2692254_2693316_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009918601.1|2693332_2694316_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	3.1e-52
WP_003722610.1|2694432_2695392_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 1
NZ_CP023051	Listeria monocytogenes strain FDA971911-001-001 plasmid pCFSAN059932, complete sequence	61922	0	56221	61922	transposase	Streptococcus_phage(22.73%)	58	NA	NA
WP_013315188.1|1868_3209_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	38.6	1.1e-31
WP_003728505.1|3383_4118_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003728504.1|4322_4667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728503.1|4654_5935_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.9	5.2e-92
WP_003728502.1|5985_6282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728501.1|6259_7234_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.0	2.4e-33
WP_003728500.1|7973_9608_+	plasmid replication protein	NA	NA	NA	NA	NA
WP_003728499.1|9882_10638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023553716.1|10671_11259_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.7	2.5e-33
WP_003755398.1|11350_12148_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	63.2	3.3e-81
WP_003728496.1|12116_13343_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	60.6	4.7e-135
WP_013315183.1|13554_13671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728495.1|13686_13923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731844.1|13885_14275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728493.1|14277_15195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728492.1|15592_15832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728491.1|15843_16284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728490.1|16276_17617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728489.1|17627_17999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012952172.1|18018_18783_+	Fic family protein	NA	A0A0G3Y4Q5	Ostreid_herpesvirus	29.4	2.6e-06
WP_003728487.1|18896_19427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728486.1|19463_19799_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	35.0	2.8e-05
WP_011011011.1|19972_20371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012952173.1|21083_21428_+	TnpV protein	NA	NA	NA	NA	NA
WP_072235488.1|21469_21877_+	hypothetical protein	NA	H2DE57	Erwinia_phage	46.0	1.4e-11
WP_002389568.1|22442_23123_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	90.7	2.6e-119
WP_003728481.1|23746_25111_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.5	1.9e-07
WP_003728480.1|25356_26226_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003750113.1|26585_26906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728477.1|27096_27861_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003728476.1|28323_30207_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	5.6e-87
WP_043993356.1|30326_30968_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.0e-101
WP_003728474.1|31452_33306_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003728473.1|33298_34510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728472.1|34760_35324_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	2.0e-40
WP_168169377.1|35915_36263_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_031641532.1|36283_37582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003725288.1|37981_38338_-	glyoxalase	NA	NA	NA	NA	NA
WP_009917198.1|39263_39608_-	quaternary ammonium compound efflux SMR transporter BcrC	NA	NA	NA	NA	NA
WP_003725293.1|39625_39943_-	quaternary ammonium compound efflux SMR transporter BcrB	NA	NA	NA	NA	NA
WP_003725294.1|39954_40494_-	efflux transporter transcriptional regulator BcrA	NA	NA	NA	NA	NA
WP_031644247.1|40934_41174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728469.1|43247_46163_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.7	1.9e-174
WP_003728468.1|46166_46721_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	53.4	7.0e-38
WP_003728467.1|47000_47360_+	Cd(II)-sensing metalloregulatory transcriptional repressor CadC	NA	E4ZFI8	Streptococcus_phage	50.0	3.1e-26
WP_003728466.1|47359_49495_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	64.5	1.6e-247
WP_003728465.1|49687_50029_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003728464.1|50022_50265_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003728463.1|50325_50577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728462.1|50707_51034_+	hypothetical protein	NA	A0A2K9V3N4	Faecalibacterium_phage	40.8	3.2e-06
WP_003731676.1|51033_51696_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_003769263.1|51714_52092_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	55.1	2.2e-14
WP_023553717.1|52490_52739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728519.1|52860_53109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728518.1|53109_53535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728517.1|53538_54261_+	CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_003731678.1|54276_54993_+	AP2 domain-containing protein	NA	O03945	Lactobacillus_phage	31.0	3.8e-20
WP_003728514.1|55966_56221_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	46.4	1.6e-13
>prophage 2
NZ_CP023051	Listeria monocytogenes strain FDA971911-001-001 plasmid pCFSAN059932, complete sequence	61922	59550	60973	61922		Ralstonia_phage(50.0%)	4	NA	NA
WP_003728511.1|59550_60159_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.9	1.0e-21
WP_003728510.1|60148_60376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731679.1|60495_60774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728509.1|60736_60973_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	53.4	6.7e-14
