The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	15896	195006	2237608	protease,integrase,transposase	unidentified_phage(17.02%)	158	78071:78130	142615:143982
WP_072538290.1|15896_16307_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	37.9	1.8e-14
WP_095582907.1|16482_17184_-	helix-turn-helix domain-containing protein	NA	C1KFS0	Lactobacillus_virus	38.8	8.4e-28
WP_003616378.1|17546_17771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016396056.1|17881_18586_-	mgtC family protein	NA	NA	NA	NA	NA
WP_013440320.1|19138_20317_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164328.1|21638_22472_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035164329.1|23675_24614_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	32.2	1.4e-17
WP_003616370.1|24907_25546_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	31.6	1.0e-19
WP_002880561.1|25542_26310_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_003616368.1|26312_26558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164330.1|26778_27933_-	lysin	NA	Q38317	Lactobacillus_phage	56.2	2.3e-59
WP_013440320.1|28164_29343_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538287.1|31490_32159_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	5.7e-50
WP_002880554.1|32375_32897_+	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	31.4	2.3e-14
WP_076612173.1|33032_34295_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_035164340.1|34757_35591_+	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_035164342.1|36203_38969_-	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	31.2	1.4e-30
WP_003616362.1|39117_39828_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_003616361.1|39916_40396_+	YcxB family protein	NA	NA	NA	NA	NA
WP_003616360.1|40486_40915_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_035164344.1|41053_41899_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002880537.1|41978_42167_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003616356.1|42632_43205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|49030_50209_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035160962.1|50511_50694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|50686_51034_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|51089_51323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|51279_52623_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_072538285.1|52726_52918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|52997_54176_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_095582911.1|54737_55706_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_035164377.1|55742_56621_+	ROK family protein	NA	NA	NA	NA	NA
WP_035164379.1|57179_57944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002880600.1|57940_58723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164381.1|58773_59259_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_035161030.1|59686_60406_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_035164383.1|60571_61486_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_035164385.1|61664_63107_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_013440320.1|63347_64526_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538245.1|64979_66029_+|transposase	IS30-like element ISL7 family transposase	transposase	H7BWC8	unidentified_phage	33.1	3.6e-43
WP_035164393.1|66086_68015_+	membrane protein	NA	NA	NA	NA	NA
WP_035164395.1|68014_68962_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.9	1.7e-76
WP_035164396.1|69079_70129_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_003616342.1|71929_72133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141305880.1|72262_74551_+	hypothetical protein	NA	A0A2H4J4H0	uncultured_Caudovirales_phage	29.0	1.3e-69
WP_013440320.1|74822_76001_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164983.1|76417_77467_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
78071:78130	attL	ATGACACTGTCAATTCTTTTGTGTAAATAAATCTTTCCGATAGGTTGATTCTTTAATTAT	NA	NA	NA	NA
WP_013440320.1|78133_79312_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003616334.1|79732_80200_-	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	28.5	6.0e-06
WP_035160830.1|80836_81166_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016396022.1|81128_81776_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_035160831.1|81797_82583_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	26.6	1.0e-10
WP_035164401.1|82575_82908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616326.1|83305_84640_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003616324.1|85897_86404_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003616322.1|86569_87403_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	37.9	4.6e-41
WP_035164403.1|87664_88240_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003616319.1|88243_88897_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003616318.1|88972_89800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160836.1|90159_90351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164411.1|90744_91041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|91101_92280_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538240.1|92702_93752_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
WP_035164414.1|94534_95080_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002879656.1|95477_96191_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_013438900.1|96240_96399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025895623.1|96456_97284_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	62.6	4.1e-98
WP_035164416.1|97363_97906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002879651.1|98094_99003_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_016396011.1|99121_99979_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	6.6e-51
WP_078256809.1|100274_102494_+	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A068F3I8	Mycobacterium_phage	34.2	9.0e-84
WP_003616304.1|102558_103008_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_003616303.1|103009_103558_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002879589.1|103550_104114_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003616300.1|104371_105373_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	35.2	2.5e-49
WP_002879587.1|105661_107059_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_035164396.1|107231_108281_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_003616298.1|108472_108904_+	peptide deformylase	NA	NA	NA	NA	NA
WP_072538280.1|108948_109374_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035164419.1|109363_109843_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_035165409.1|110165_110288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160850.1|110749_112345_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_035160853.1|112507_114085_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	7.2e-11
WP_035164420.1|114081_115644_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.5	6.7e-09
WP_035164422.1|115769_117677_-	DNA mismatch repair protein MutS	NA	F2QAG1	Chrysochromulina_ericina_virus	30.1	4.3e-18
WP_035164425.1|117757_118459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164426.1|118698_119607_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	43.3	2.0e-05
WP_035164427.1|119742_120867_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	40.5	6.4e-70
WP_002877686.1|121033_121972_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_035164429.1|122023_122947_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_035164431.1|123666_124893_-	MFS transporter	NA	NA	NA	NA	NA
WP_072538343.1|125214_125370_+	fumarate reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_003616285.1|125513_126434_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616283.1|126618_127104_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003616281.1|127784_128486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003612438.1|128519_128699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143434642.1|128780_130186_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.7	5.4e-42
WP_051975772.1|130317_131250_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_035164433.1|131294_132221_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	40.7	1.3e-57
WP_035165411.1|132383_134261_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	63.3	8.6e-221
WP_052109121.1|134278_134707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538278.1|134918_135659_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_078256810.1|135731_137075_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	8.2e-48
WP_013439920.1|137031_137265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|137320_137668_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035164409.1|137660_137843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538277.1|138094_139285_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_072538342.1|139480_140683_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013440320.1|141432_142611_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_013440320.1|143068_144247_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
142615:143982	attR	ATAATTAAAGAATCAACCTATCGGAAAGATTTATTTACACAAAAGAATTGACAGTGTCATAGCACATTATCCGTAAGTTCTAATAACAAACAGATCATTGAACAACTGTCTTATATATATAAGCCGGAAATTGTATCAAATGTAGGCGATAGTGAGGTTACATACTATATAGATATCCATTCTAGCACTGGAGAAAATGCGTTATTATTTGGAGAAAACATCGAAAATGGTTTAATAGATGTATCATACGGTAAATCAAGAAATGATTTAAAGACTTGGAAGAGTAACACAACCATTCTTCCGCCTATCTCTTTAGCACCATTAGTCAATGCTTTTACTTTCATTCATGGATGTGCACTATTATTAGATGGAAAAACGCATGTTATATTTGGTGACACTGTCAATTCTTTTGTGTAAATAAATCTTTCCGATAGGTTGATTCTTTAATTATGTTTTAATCGAAGTATGATTCCAACGTGTCTGTCACCTGACCAAAGCCTTTATGAGTCCGATTGGCATTCCGGTCGTTGTAGCCGATAGCCTGTACACCTAAGAAGTTGTCTAGGGACTCTTCAGTTGGAAATTCTGACTTTGGCTTTGTCTTGCGTTTGATCATGTTGTTTATCGACTCGATCATGTTCGTTGAGTAGATCGAGGGCCGAATCTGCTTAGGGTACTGGTAAAAGACCAGCAGGTCTTCCTCAATCTTCTGCAGATTCTTGATCATGCTTGAGTATTTTGAGTCGTATTTGTCATAGAAAGCGTGGAGAACCGTTTCTGCCTCTTTTAAGCTAGATTGCTTATGAACTTGCTTGAAGTCGTCCAGAGCCTCTTTACGATCGCTTACACGGACTTTTCCCTTGATATTTCGCATGACATGAACTAGGCAACGTTGGAATTTAGATTTTGGGTAATACTGCTTTAGCATGTCTTTAATGCCTACAAACCCATCTGATAGGAATAGCTCAACCTGCTCAAGGCCGCGTTCCTTGAAGTTGGAAATCATTTCACCCCAAATTTCGATATTCTCCACCGGGGCAATACGATAATCAATGATCTCCTTATGGCCATTAGGCTTAATCCCAACAGCCACATAGACTGCCTCACGCTGGTACGTATCTCTACGCAGAGGAATGTAAGTGGCGTCGAGATACACGCAGAAGAACTTGTCGCTCAGCTGACGTTGGTGATAGCTTTCGACCTGGCTGGCAACCTGCTTAGAGATGTTGGAGACAGTGCCAGCTGAGTAATAGCTGCCATACATTTTCTCAATCAAATCAGAGATCTCCCGGGTCGTTACGCCATGTGAATAGAGCTGAATCACGGTTGATTCTAGCGTATCAGTGTGTTGGCCGTATGCTGGGAGAG	NA	NA	NA	NA
WP_035174920.1|144417_144897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616417.1|146862_148173_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.7	2.0e-51
WP_003616418.1|148391_149138_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-27
WP_003616420.1|149157_150615_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003611175.1|150858_151557_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	49.8	1.0e-54
WP_003611191.1|151578_152226_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	49.8	1.2e-49
WP_072538165.1|152561_153611_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
WP_003616240.1|155435_155648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616238.1|155661_156276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164438.1|156309_156702_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035160962.1|156879_157062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|157054_157402_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|157457_157691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|157647_158991_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_003621366.1|159122_160022_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_003616234.1|160038_160593_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.0	7.8e-13
WP_052109123.1|160750_161908_-	cation transporter	NA	NA	NA	NA	NA
WP_072538165.1|162405_163455_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
WP_003616231.1|163752_163887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164442.1|164008_164920_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_035164444.1|165149_166268_+	LysM peptidoglycan-binding domain-containing protein	NA	D2KRB9	Lactobacillus_phage	45.0	1.7e-19
WP_035164446.1|166973_167735_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	5.3e-28
WP_035164448.1|167738_169322_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003611679.1|169710_170337_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003616220.1|170419_170791_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_035164450.1|170777_171476_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003611605.1|171586_172066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164452.1|172117_173581_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_013438965.1|173582_174527_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_076612173.1|174575_175838_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_035164454.1|176061_176829_+	ribonuclease	NA	A0A1L6Z550	Klebsiella_phage	35.3	1.1e-17
WP_016395982.1|176916_177873_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_095582943.1|178042_178879_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003616211.1|178862_179522_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035161045.1|179624_180617_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	31.9	9.7e-38
WP_016395955.1|180798_181479_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616207.1|181489_182323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616206.1|182362_183013_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_035164457.1|183050_184370_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_016395952.1|184517_185606_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003616200.1|185654_186290_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035164458.1|186423_187533_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_035160912.1|187529_188324_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_035164460.1|188289_189156_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035164461.1|189316_190939_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003616195.1|191088_192048_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_072538275.1|192166_193843_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_072538207.1|193956_195006_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	4.0e-42
>prophage 2
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	211526	283474	2237608	tRNA,integrase,transposase	Enterococcus_phage(14.29%)	56	249243:249302	258694:260061
WP_035164396.1|211526_212576_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_003611675.1|212880_213354_+	universal stress protein	NA	NA	NA	NA	NA
WP_003616675.1|213774_214716_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002877846.1|214833_215604_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	3.3e-25
WP_003616679.1|215606_216407_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003611688.1|216406_217219_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003616681.1|217474_219100_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_076612173.1|219457_220720_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_003616682.1|220813_221299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616684.1|221356_222757_+	serine/threonine protein phosphatase	NA	A0A2P0ZKZ2	Lactobacillus_phage	23.1	6.6e-08
WP_003616687.1|222853_224803_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	36.9	2.7e-15
WP_035160919.1|224836_226096_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_035164475.1|226461_228672_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.4	8.8e-249
WP_035160921.1|228743_229466_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	54.6	1.7e-47
WP_003616694.1|229484_230042_+	DUF59 domain-containing protein	NA	NA	NA	NA	NA
WP_035164477.1|230041_231358_+	DUF438 domain-containing protein	NA	NA	NA	NA	NA
WP_016395924.1|231457_232678_+	MFS transporter	NA	NA	NA	NA	NA
WP_002877868.1|232764_233103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164479.1|233127_235080_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.8	1.3e-70
WP_072538274.1|235385_237434_-	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	34.1	7.0e-67
WP_051975836.1|237583_237958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164487.1|238113_239052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078256811.1|239223_240471_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.0	1.6e-58
WP_052109125.1|240607_241561_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035164488.1|241730_241925_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078256813.1|241924_242236_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_035164491.1|242389_242704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164493.1|242700_243558_+	hypothetical protein	NA	A0A2H4JEH3	uncultured_Caudovirales_phage	23.9	6.9e-08
WP_052109126.1|243554_245042_+	hypothetical protein	NA	D2J048	Enterococcus_phage	37.3	3.8e-54
WP_035164495.1|245672_249254_+	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	28.2	1.0e-49
249243:249302	attL	GGAACTGTATAATTTTATGTGTAAGGATGAACAGTTCCTTAAACTAAATTCCAATTGGGT	NA	NA	NA	NA
WP_013440320.1|249368_250547_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_078256814.1|250661_251774_+	endonuclease	NA	NA	NA	NA	NA
WP_013440320.1|253177_254356_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_052109155.1|254479_255085_+|integrase	site-specific integrase	integrase	Q38608	Lactococcus_phage	34.9	5.7e-17
WP_035164499.1|255278_255539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002877879.1|256625_256835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002877881.1|256894_257131_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_013440320.1|257448_258627_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_016395916.1|258776_259979_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	Q9ZXE4	Bacillus_phage	41.6	3.6e-10
WP_035164501.1|260000_261542_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	38.4	2.1e-23
258694:260061	attR	ACCCAATTGGAATTTAGTTTAAGGAACTGTTCATCCTTACACATAAAATTATACAGTTCCTTGAAATTATTAGGAGGAGATTAATGAAGAGAAGATTTTTGACTGGACTTGCTACCGCAGCGATGCTGACTTCCGTCGCCGTTCCAGTGACCAATAACATGTTTCTCTCAAATCAGGCAGTTGAGGCATCAGCTACCAGCGATGCCTTTTTAAGCAAAGTCAGCCTGCAGGCGCAGAAGACGTCCAAGAAGTACGGCGTCTACGCCTCTTTGATGCTAGCCCAGGCTGCCTTGGAATCTGGCTGGGGGACTTCAACTCTGTCCACCCAGGCCAACAACTTCTTTGGAATGAAGGCTACTGGCTGGACCGGTGCAACCTATAGCGTCAAGACGGCTGAACAGGACTCAAAGGGCAAGACTTACTACATCACGGCTGCCTTCAGAAAGTACAGCAGCTACCAGGCATCTTTTGATGACTACGGCTTGAAGATGCGGACGACCCTGGGCAATTACGGCAGCTTGCGCTACAGCAAGACCTGGCTGGAAAATGCCTCAAGCGCTTCAGCTGCCGCTAAAGCCATCAAGGCTGCCGGCTACGCGACTGACAAGAACTACGCGACCAAGCTGATCAGCCACATCGGGACCTACAACTTGACCAAGTATGACCCGGTTTACTCCGGCACTAATTACACGGCCAAGGTAGCCAAGTCCGGGGCAACCTACCTCTACCCGACTGACTACTCTGTTTCACCGAAGAAGTCTTACGTGACCGCCGGCCAAACCGTAACGGTTACCAAGACCTACACTTACTACAACGGCAAGAAGCGGATGTACCTCAAGGGCCTGGGCTGGATCAACGGCGAAAGCCTGAACACTGGCAGCTCCCAAGCGCCAAGTGCTGACAATGCCGCCAGCGTTTCCGGGCAAATGAAGGTGCTGATGCACTCAGCAGCTATCTACACCAGTACTGGTGCCAAGAGCACGGCTAAGTCGGTCAAGGCTGGCAAGAGCGTGACGACTTACGGGTCAGTCACGATCAACGGGGCCAAGTACTACCGGGTCAAATCCGCCAGCGCTGACCAGTTCATCAAGGCAAGCAACTTTGATGGGACCAGCCGCAAGCTCAAGCGCAATGCCTACATCTACAACAATGCGGGCAAGCGGGTTGGCAAGACCAAGTGGCTCAAGGGAAGCACCCACACTGTCTACGGCGGCAGCGTGAAGATCAAGGGCAAGCAGTACTACATCGTTGGTCTTAACCAATATGTTAAGAAGGCCAACTTTTAAGCAGACGGGGAAGAAAACTGAATGAGATTTAGAAGATTTTTTACCGCGGCGGCGGCAACGGTAGCTTTCGGCCTGGCCTTTA	NA	NA	NA	NA
WP_016395914.1|261653_263492_+	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
WP_035164506.1|263596_264562_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003616713.1|264607_265357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002877893.1|265520_266210_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003616714.1|266461_267745_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002877895.1|267747_268365_+	membrane protein	NA	NA	NA	NA	NA
WP_035164509.1|268443_271446_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_035164511.1|271524_272586_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_002877898.1|272843_274109_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	5.1e-84
WP_095582917.1|274435_275638_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002877198.1|276137_276320_+	cytochrome c551	NA	NA	NA	NA	NA
WP_072538271.1|276526_277750_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.5	1.1e-96
WP_003616726.1|278201_278372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616729.1|278538_279189_+	HD domain-containing protein	NA	S4W232	Pandoravirus	25.7	1.2e-07
WP_072538167.1|280913_282281_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035164983.1|282424_283474_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
>prophage 3
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	292640	345205	2237608	bacteriocin,transposase	Planktothrix_phage(15.79%)	49	NA	NA
WP_013439040.1|292640_293684_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	4.7e-19
WP_003616760.1|293698_294652_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	3.5e-21
WP_072538195.1|294926_296150_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
WP_095582922.1|296356_296524_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_035164407.1|296638_297982_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|297938_298172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|298227_298575_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035164409.1|298567_298750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164517.1|298939_300253_-	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.5	7.5e-62
WP_016395897.1|300305_301619_-	aminopeptidase E	NA	R4TV59	Phaeocystis_globosa_virus	33.5	2.6e-62
WP_002877230.1|301715_302129_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_016395896.1|302355_302817_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_035164519.1|302895_304185_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	38.2	5.4e-73
WP_035164521.1|304369_305362_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	69.0	4.2e-134
WP_035164523.1|308287_308647_+	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	35.9	9.3e-07
WP_035164525.1|308716_310009_-	purine permease	NA	NA	NA	NA	NA
WP_013439051.1|310038_310608_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002877243.1|310962_312120_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	32.4	1.9e-61
WP_016395890.1|312119_313673_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.7	4.6e-18
WP_003616790.1|313995_314247_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_003616793.1|314233_314605_+	toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CZV4	Paenibacillus_phage	45.6	8.9e-21
WP_035164527.1|317304_318915_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	27.7	2.4e-17
WP_035164529.1|318949_319792_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013439055.1|319948_321421_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_035164531.1|321473_321692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002877258.1|321741_321957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002876658.1|322057_322870_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013439058.1|322921_323671_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.9e-31
WP_035161049.1|323667_324378_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_035164533.1|325641_326904_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_035164534.1|326996_327962_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616826.1|328122_329517_-	amino acid permease	NA	NA	NA	NA	NA
WP_035160948.1|329594_330527_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_035164536.1|330582_331044_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_035164538.1|331405_331852_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616833.1|331833_332856_+	asparaginase	NA	NA	NA	NA	NA
WP_035164541.1|332972_333803_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_035164542.1|333888_334365_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_035164544.1|334444_335878_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.3	1.5e-103
WP_003616841.1|335946_336501_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	39.1	3.1e-33
WP_035164396.1|336710_337760_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_035164545.1|339375_340233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160953.1|340225_340492_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_003616851.1|340588_341359_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_072538269.1|341534_341717_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_072538202.1|341754_342933_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_072538268.1|343350_344178_+	helix-turn-helix domain-containing protein	NA	C1KFS0	Lactobacillus_virus	36.2	6.4e-35
WP_072538267.1|344237_344648_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	37.1	1.5e-13
WP_035160955.1|344917_345205_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 5
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	434263	490067	2237608	tRNA,transposase	unidentified_phage(23.08%)	41	NA	NA
WP_003616967.1|434263_435052_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002878124.1|435157_435601_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002878121.1|435613_436009_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_072538240.1|436649_437699_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
WP_003620886.1|439985_440132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011678031.1|440246_440870_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_035160995.1|442201_442693_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_035164587.1|443477_444659_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003616980.1|444645_445701_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_035164589.1|446221_447829_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013440320.1|448079_449258_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003616985.1|449374_450487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164591.1|450501_451569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035161000.1|451635_452337_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616992.1|452499_453639_+	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_002878102.1|453642_455070_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002878101.1|455120_455855_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003616997.1|455854_456955_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003616998.1|456951_457653_+	glycosyl transferase	NA	A0A1V0SL98	Klosneuvirus	29.2	9.6e-08
WP_002878098.1|457757_458588_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.9	5.2e-69
WP_035161001.1|458793_461460_+	calcium-translocating P-type ATPase, PMCA-type	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	28.8	9.2e-75
WP_035164593.1|462504_463023_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.6	5.6e-13
WP_003614813.1|463062_463524_+	SprT family protein	NA	NA	NA	NA	NA
WP_002878090.1|463757_464381_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003617011.1|464394_465048_+	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	48.6	1.2e-28
WP_035164595.1|465137_467399_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.1	5.7e-126
WP_035164597.1|467409_469425_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.7	1.6e-100
WP_035161006.1|469421_470567_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_003617020.1|470578_470884_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_072538259.1|470883_472326_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016395794.1|472331_473762_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_035161060.1|473797_474724_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.9	1.1e-14
WP_035161007.1|474784_475498_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_035164599.1|475500_476856_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	47.9	8.4e-109
WP_035161025.1|477038_477896_+	Mrr restriction system protein	NA	NA	NA	NA	NA
WP_003617037.1|478175_478811_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_035164983.1|480413_481463_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_072538167.1|483269_484637_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_072538257.1|484747_485926_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_035164600.1|488344_488905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538245.1|489017_490067_-|transposase	IS30-like element ISL7 family transposase	transposase	H7BWC8	unidentified_phage	33.1	3.6e-43
>prophage 6
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	493573	626163	2237608	protease,tRNA,transposase	Streptococcus_phage(11.54%)	115	NA	NA
WP_143434646.1|493573_494978_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.0	3.7e-43
WP_035162311.1|495041_495809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025895527.1|495924_496212_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003617057.1|496233_496497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013438997.1|496787_498071_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.9e-58
WP_072538253.1|500428_500869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538252.1|500951_501143_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013440320.1|501180_502359_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538342.1|502514_503717_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035164983.1|505229_506279_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_072538167.1|508838_510206_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003617067.1|511157_512372_+	MFS transporter	NA	NA	NA	NA	NA
WP_002880222.1|512699_512930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538168.1|512895_514647_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078256816.1|515119_515473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617074.1|515827_516709_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.4	9.8e-50
WP_035164610.1|516913_518254_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_035164612.1|518399_519071_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003617081.1|519114_519621_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_035162323.1|521619_522948_+	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	40.1	4.6e-59
WP_003617088.1|523696_524053_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_035164396.1|524178_525228_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_003617090.1|525430_525916_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_035164614.1|526124_527936_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.7	6.0e-94
WP_035164615.1|528072_530127_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_003611502.1|532181_532631_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003617099.1|532633_533779_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_035162383.1|533903_536633_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_035164618.1|537026_538649_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.5	3.2e-46
WP_003617107.1|538708_538831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035162331.1|538992_539358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164620.1|541121_542321_-	MFS transporter	NA	NA	NA	NA	NA
WP_002878038.1|542455_543169_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_003617115.1|543435_544221_+	glutamate racemase	NA	NA	NA	NA	NA
WP_035164622.1|544298_545720_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003617119.1|545733_546819_+	M42 family peptidase	NA	NA	NA	NA	NA
WP_016395747.1|547026_547596_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_016395746.1|547925_548552_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	42.8	7.2e-39
WP_003617126.1|548551_549208_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	9.9e-39
WP_003617127.1|549750_550491_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	1.1e-33
WP_003617129.1|550512_551352_+	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002878013.1|551351_551993_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002878011.1|552004_552673_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_035164628.1|552714_553560_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003617134.1|553765_555277_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_035164629.1|555280_557446_+	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
WP_035164631.1|557454_558852_+	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_035164632.1|558848_559766_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_072538342.1|560209_561412_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003617141.1|561512_562148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617143.1|562164_562410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164635.1|562557_563055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164637.1|563121_564042_+	ribokinase	NA	NA	NA	NA	NA
WP_003617149.1|564057_564708_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003617150.1|564720_565413_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_076612173.1|565601_566864_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_002877998.1|566969_567905_+	inosine-uridine nucleoside N-ribohydrolase	NA	NA	NA	NA	NA
WP_002877995.1|567913_568636_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072538250.1|568748_570026_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.9	7.0e-57
WP_013440320.1|570057_571236_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003617152.1|571671_574074_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_072538249.1|574202_574517_+	sortase	NA	NA	NA	NA	NA
WP_003617156.1|574656_576003_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002877987.1|576111_576684_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.3	6.0e-08
WP_003617158.1|576765_578058_-	amino acid permease	NA	NA	NA	NA	NA
WP_016395736.1|578164_578851_+	lysozyme M1	NA	NA	NA	NA	NA
WP_035164643.1|578847_580092_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	26.6	7.4e-35
WP_035164645.1|580084_581404_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_130137277.1|581735_582140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617168.1|582123_582390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016395734.1|582371_583655_+	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	35.6	7.8e-64
WP_003611533.1|583767_585018_+	aluminum resistance protein	NA	NA	NA	NA	NA
WP_035164648.1|585090_587178_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_016395733.1|587217_587460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164650.1|589171_590626_+	amino acid permease	NA	NA	NA	NA	NA
WP_002877973.1|590708_590903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003617178.1|591004_592147_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	35.0	2.3e-27
WP_003617179.1|592188_592668_-	GtrA family protein	NA	NA	NA	NA	NA
WP_035164652.1|592660_593107_-	flavodoxin	NA	NA	NA	NA	NA
WP_003617182.1|593253_594081_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003617184.1|594083_594998_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_013439216.1|595121_596036_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	49.2	1.1e-75
WP_003617187.1|596096_596378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078256817.1|596506_597463_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035164654.1|597842_599225_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	31.5	5.8e-65
WP_035164655.1|599385_600201_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_035164656.1|600222_600699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016395728.1|600695_601163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003617197.1|601263_602127_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_035164657.1|602126_603698_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	30.7	6.5e-12
WP_002877937.1|603799_603988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003617202.1|604009_605647_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003617207.1|605936_606215_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_035162369.1|606330_608526_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.4	7.4e-123
WP_002877932.1|608694_608895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002877930.1|609001_609268_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_035162372.1|609267_610995_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_072538248.1|611202_612252_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	8.1e-43
WP_035164660.1|612418_612823_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_035162386.1|612925_613675_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_072538247.1|613897_615121_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.5	1.9e-96
WP_129335323.1|615378_615453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617215.1|615434_616295_+	competence protein	NA	NA	NA	NA	NA
WP_003617218.1|616307_616952_-	dithiol-disulfide isomerase	NA	NA	NA	NA	NA
WP_035161747.1|617032_617635_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_002877053.1|617738_618371_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_035164662.1|618367_619165_+	NAD kinase	NA	NA	NA	NA	NA
WP_035164664.1|619179_620073_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.9	7.7e-10
WP_035164666.1|620158_620347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164668.1|620418_621246_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_072538167.1|621379_622747_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035164670.1|622853_623864_-	lactonase family protein	NA	NA	NA	NA	NA
WP_003614100.1|624028_624409_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003617232.1|624418_625609_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002877038.1|625605_626163_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	768295	885358	2237608	protease,tRNA,transposase	unidentified_phage(11.11%)	95	NA	NA
WP_035164755.1|768295_771091_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.4	1.8e-81
WP_002879123.1|771090_771300_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	37.5	7.8e-06
WP_002879120.1|771315_771873_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003617480.1|772082_772781_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016396337.1|772780_773944_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	29.0	4.6e-31
WP_003617482.1|773998_774340_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_003617483.1|774344_775472_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_072538342.1|775617_776820_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003617485.1|777176_777836_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_002879102.1|777835_778489_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_035164757.1|778502_780893_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.2	2.0e-57
WP_003611409.1|781061_782411_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	51.8	7.0e-124
WP_035164760.1|782450_784130_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003617492.1|784119_784353_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002879096.1|784532_785087_-	peptide deformylase	NA	NA	NA	NA	NA
WP_003617497.1|785308_787180_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_003617499.1|787278_788481_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_002879092.1|788470_788812_+	YlbG family protein	NA	NA	NA	NA	NA
WP_002879091.1|788808_789360_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003617502.1|789360_789855_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	40.5	6.1e-25
WP_013440320.1|790862_792041_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003617506.1|792387_793146_+	competence protein	NA	NA	NA	NA	NA
WP_072538340.1|793147_795358_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_016396325.1|795388_796378_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_002879085.1|796470_796722_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_002879084.1|796925_797195_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_016396324.1|797396_799238_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002879080.1|799224_800052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538240.1|800189_801239_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
WP_003617518.1|801492_802683_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.9	3.6e-31
WP_035164762.1|802865_804191_+	trigger factor	NA	NA	NA	NA	NA
WP_003617523.1|804342_805596_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.8	1.1e-131
WP_035164764.1|805585_806188_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_035164765.1|806236_807844_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016396318.1|808245_808908_+	nitroreductase	NA	NA	NA	NA	NA
WP_072538165.1|809054_810104_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
WP_003617535.1|810433_812083_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003612584.1|812141_812519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538242.1|812946_814200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013440320.1|814269_815448_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_013440026.1|815842_816502_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	48.7	3.8e-46
WP_016396315.1|816795_817788_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.7	6.7e-39
WP_003617542.1|817961_818918_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	59.6	2.0e-112
WP_003617545.1|818931_819420_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	40.9	1.2e-25
WP_035164772.1|819453_821841_+	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.6	2.6e-36
WP_003617549.1|822240_823101_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035161910.1|823137_824193_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.2e-27
WP_016396312.1|824189_824903_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_072538240.1|825086_826136_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
WP_016396311.1|826324_827722_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.9	6.7e-53
WP_072538195.1|834497_835721_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
WP_052109133.1|836000_836327_-	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
WP_035164776.1|836558_837764_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002879186.1|837887_838802_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003617563.1|839035_840733_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.7	2.0e-75
WP_002879191.1|840952_841426_+	arginine repressor	NA	NA	NA	NA	NA
WP_016396308.1|841437_842637_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.0	3.6e-47
WP_016396307.1|842765_843740_+	amidohydrolase	NA	NA	NA	NA	NA
WP_035164778.1|843741_844692_+	dihydrofolate reductase	NA	A0A1V0SBV6	Catovirus	30.3	3.2e-30
WP_035162491.1|844765_846535_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.1	4.3e-81
WP_003617587.1|846591_847530_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_016396303.1|847802_849605_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003614004.1|849673_850996_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_035164780.1|851048_852983_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	28.8	1.1e-24
WP_035164782.1|853019_853949_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_035164784.1|853959_854754_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003614010.1|854868_855060_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016396298.1|855127_856693_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_016396297.1|856778_858680_+	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	46.8	2.2e-107
WP_003617601.1|858676_858868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002879208.1|859292_859856_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_016396294.1|859951_860350_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_002877626.1|860425_861199_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	56.4	1.1e-76
WP_035162488.1|861213_862461_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	62.8	4.6e-138
WP_002877611.1|862483_863560_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	66.4	7.1e-127
WP_003617612.1|863677_863878_-	YjzD family protein	NA	NA	NA	NA	NA
WP_052109134.1|864012_867492_+	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	29.9	1.2e-103
WP_035164789.1|867700_868660_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_035162484.1|868699_870469_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	35.7	2.1e-11
WP_003617623.1|871151_871574_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003617625.1|871764_872643_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_078256820.1|872635_873532_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.4	1.5e-37
WP_002877582.1|873542_873896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164791.1|873885_874620_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.4	9.7e-11
WP_003617634.1|874609_875212_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.3	4.8e-16
WP_002877577.1|875211_875931_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_013439397.1|876152_876857_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_035164793.1|876966_877362_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003617639.1|877414_878092_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_078256821.1|878180_879386_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_078256822.1|879462_880770_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002877566.1|880973_881249_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	69.7	5.8e-25
WP_003617644.1|881365_882619_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_035164983.1|882796_883846_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_072538167.1|883990_885358_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
>prophage 8
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	922286	1068595	2237608	tRNA,transposase	Bacillus_phage(18.52%)	114	NA	NA
WP_035164818.1|922286_922793_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_035162649.1|922855_923800_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_035164819.1|923940_926202_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1X9SH80	Bradyrhizobium_phage	34.9	4.3e-09
WP_003613864.1|926230_926668_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_035164822.1|926952_928239_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0SLE3	Klosneuvirus	26.7	1.4e-28
WP_035164824.1|928254_930099_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035162636.1|930171_930687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164826.1|930920_932696_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_003617737.1|932771_933845_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003611786.1|934127_935087_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_025895646.1|935159_935405_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_035164828.1|935417_936362_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_035162626.1|936345_937068_+	3-oxoacyl-ACP reductase FabG	NA	W8CYX9	Bacillus_phage	36.7	4.6e-05
WP_003617746.1|937077_938298_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_035165465.1|938300_938771_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002877460.1|938772_939216_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_035164829.1|939208_940591_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003611769.1|940577_941426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617752.1|941418_942186_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_035165467.1|942195_942960_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_003611788.1|942969_943635_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003611793.1|943883_944504_-	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_035162611.1|944682_945066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164832.1|945320_946091_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_035164834.1|946213_948916_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003611165.1|954733_955609_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_035164836.1|955645_957238_-	asparagine synthase B	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	40.1	6.4e-100
WP_035164838.1|960957_962571_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002878518.1|962661_962904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035161066.1|963688_964453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157737584.1|964864_966022_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003614957.1|966328_967213_+	phosphate ABC transporter substrate-binding protein	NA	Q58MA7	Prochlorococcus_phage	24.5	1.8e-06
WP_003614665.1|967232_968141_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003614664.1|968143_969019_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_013439457.1|969021_969777_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	2.2e-18
WP_003614960.1|969795_970434_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002878532.1|970519_971197_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.2e-32
WP_035164842.1|971196_972855_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	35.1	2.3e-31
WP_003614970.1|973603_974260_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_155114309.1|974336_974480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538238.1|974569_975112_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072538245.1|975307_976357_+|transposase	IS30-like element ISL7 family transposase	transposase	H7BWC8	unidentified_phage	33.1	3.6e-43
WP_016396711.1|977326_977878_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_035164846.1|978238_979789_-	YfcC family protein	NA	NA	NA	NA	NA
WP_035164848.1|980035_980803_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.9	3.3e-09
WP_035164851.1|980792_981611_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	2.0e-12
WP_035164853.1|981589_982366_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_003614981.1|982362_982977_-	membrane protein	NA	NA	NA	NA	NA
WP_003614982.1|983366_984476_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003614984.1|984763_985792_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_003614986.1|985798_986380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035172629.1|986479_987301_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_072538166.1|988132_989356_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	1.3e-97
WP_072538337.1|989949_990270_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_095439307.1|990439_990913_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_072538236.1|991719_992943_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.0	1.1e-96
WP_013440320.1|993684_994863_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538235.1|994883_995939_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	6.2e-43
WP_003614991.1|996631_996982_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003614992.1|996978_998052_+	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	40.7	3.2e-34
WP_003614993.1|998035_999373_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003614994.1|999362_1000454_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_003614996.1|1000465_1001002_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_078256824.1|1001423_1001693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003615002.1|1001990_1002188_-	DUF2255 family protein	NA	NA	NA	NA	NA
WP_003613477.1|1002180_1002588_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016396698.1|1002963_1003623_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003626333.1|1003603_1004278_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003613446.1|1007773_1008634_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002880222.1|1008799_1009030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538230.1|1008995_1010747_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_072538232.1|1010994_1011252_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_078256844.1|1011725_1012007_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072538230.1|1012193_1013945_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002880222.1|1013910_1014141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164867.1|1014975_1015617_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_095582925.1|1015709_1017644_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.9	1.0e-123
WP_003615024.1|1017658_1020142_+	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	29.4	2.1e-89
WP_003615025.1|1020256_1021192_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_003615026.1|1021397_1022423_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003615027.1|1022433_1023516_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_078256826.1|1023605_1024655_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.8e-42
WP_003615028.1|1024845_1025805_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_035161077.1|1025860_1026772_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_072538229.1|1026905_1030445_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_035164875.1|1030471_1034155_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	26.4	6.4e-26
WP_035164877.1|1034183_1036976_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	33.3	7.1e-62
WP_002878598.1|1036968_1037463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164878.1|1037524_1038823_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	28.6	2.1e-53
WP_002878410.1|1038913_1039561_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_002878412.1|1039582_1040212_+	endonuclease III	NA	NA	NA	NA	NA
WP_003615040.1|1040246_1041050_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_120490347.1|1041084_1041570_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_003615044.1|1041563_1041992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003613508.1|1042152_1043154_-	D-2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	33.8	2.3e-39
WP_016396676.1|1043202_1045131_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_035164880.1|1045277_1047590_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003615052.1|1047576_1048209_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	36.9	9.5e-23
WP_013439504.1|1048369_1048930_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_003615059.1|1049005_1049470_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_016396673.1|1049987_1051112_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_016396672.1|1051121_1052354_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_035164882.1|1052508_1052865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164884.1|1052857_1054537_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_002876847.1|1054548_1055001_+	signal peptidase II	NA	NA	NA	NA	NA
WP_016396669.1|1055002_1055917_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002876844.1|1055918_1056974_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_035161086.1|1056973_1060165_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002876842.1|1060258_1060540_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_002876840.1|1060539_1061883_+	PFL family protein	NA	NA	NA	NA	NA
WP_002876831.1|1061949_1063641_-	fibronectin/fibrinogen-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	40.2	1.9e-09
WP_003611707.1|1063793_1064255_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	58.1	4.8e-40
WP_035161089.1|1064321_1065734_+|transposase	transposase	transposase	A0A2I7RKG5	Vibrio_phage	34.0	1.4e-10
WP_072538167.1|1067227_1068595_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
>prophage 9
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	1073408	1147223	2237608	integrase,transposase	unidentified_phage(26.67%)	60	1073270:1073329	1151872:1153116
1073270:1073329	attL	TTTCGCCGATTGTAAAATTAAACTGAACACTGTTCCGATCCAGTAAGAAAAATCGTTTTC	NA	NA	NA	NA
WP_035164983.1|1073408_1074458_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_003615090.1|1074656_1075280_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003615092.1|1075338_1075680_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035161094.1|1075869_1076388_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_035161096.1|1076792_1077803_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_035164888.1|1077802_1079086_+	dihydroorotase	NA	NA	NA	NA	NA
WP_035164889.1|1079154_1080231_-	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	29.6	1.6e-06
WP_003615100.1|1080453_1081602_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.5	1.7e-41
WP_016396656.1|1081721_1082909_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_078256827.1|1082932_1083511_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016396652.1|1084702_1086013_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003614608.1|1086766_1087435_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	5.7e-50
WP_072538226.1|1087403_1089110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016396650.1|1089472_1089793_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_035164892.1|1089856_1090522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164894.1|1090542_1091202_-	DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_016396647.1|1091625_1092825_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_013440320.1|1094695_1095874_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_013440320.1|1097502_1098681_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164895.1|1100217_1100796_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	38.7	9.0e-28
WP_025895793.1|1100937_1101639_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_078256828.1|1101687_1102614_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_095582947.1|1102625_1104053_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035164396.1|1104793_1105843_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_035164897.1|1105929_1106679_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_035164899.1|1107043_1110244_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_051975822.1|1111703_1112198_+	DUF554 family protein	NA	NA	NA	NA	NA
WP_035165474.1|1112357_1113647_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016396610.1|1113793_1114531_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003615159.1|1114853_1115495_+|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	34.9	2.3e-24
WP_035164396.1|1115852_1116902_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_072538225.1|1116932_1117409_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035164903.1|1117713_1118628_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.8	7.8e-26
WP_016396608.1|1118624_1119485_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016396607.1|1119701_1120166_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_035164905.1|1120309_1120735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016396605.1|1120747_1121146_+	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	35.9	2.4e-11
WP_003615174.1|1121848_1122601_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	9.3e-33
WP_035161164.1|1122623_1124498_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_076612173.1|1124563_1125826_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_003615177.1|1126507_1127053_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003615178.1|1127045_1127966_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_002880312.1|1129330_1129537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164396.1|1130226_1131276_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_003615189.1|1131484_1132042_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035164907.1|1132267_1132804_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_003614261.1|1132835_1133423_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.4	9.1e-28
WP_035164909.1|1133539_1134721_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_035164911.1|1134757_1135537_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_035161170.1|1135539_1136469_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_035164914.1|1136492_1137647_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003615201.1|1137707_1138421_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_035164916.1|1138933_1140307_+	aspartate kinase	NA	NA	NA	NA	NA
WP_072538223.1|1140308_1141295_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_016396593.1|1141341_1142610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016396592.1|1142618_1142969_-	VWA domain containing CoxE-like protein	NA	NA	NA	NA	NA
WP_035164918.1|1143331_1144663_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035164920.1|1144790_1145225_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_035164922.1|1145237_1145678_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072538195.1|1145999_1147223_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
1151872:1153116	attR	TTTCGCCGATTGTAAAATTAAACTGAACACTGTTCCGATCCAGTAAGAAAAATCGTTTTCACTGGATTAGAGCACAAAAAATCCATTTCAACCATCTGGTAGAATATGAATTACCACAAACATTTCTAGAGAGGTTAAAATGGATCATTCATATTCTAACACTAAACCACACCAAAAGGGCAAGCACCTTACGCTAAACGACCGGACTACAATCCAGGAGCTGCACTCTAAGGGCTACTCTAATCGTGCTATAGCTAGAGAACTTAACTGCTCACCAAGCACGGTCGGATATGAGCTCAAAAGAGGCACAGTATCCGTGTATACCGGCAATGTGAAGCGGTATAAAGCTGTCGAAGGGCAAAGCACTTACGAACTACATAGAAGCGAATGCGGCCGCAAGAGCTTGTTTCTTCGCAGACATAAGTTCATCGACTATGTTTCCCACTGCTTCCATAATCGAGGCTGGTCTCTTGATGCTTGCGTGGGTTATGCTTTGGCCAAGGGAATCTTCCAGAAGGATCAGGTCGTATCAACCAAAACTCTGTATAACTACGTTGACTTGGGCCTAATGGATATCAAGAACGGTGATCTTCCAGAGAAGGTCAAGCGCAATACTAAGACTCGTCGTGCCCGTGTAAACAAGCGTATCCTGGGACGAAGCATCGATGAACGTAGTCCTAGAATCGAAAGCCGTAAGGACTTTGGTCACTGGGAATGCGATCTGGTTCTTGGACACAAGACTAAGGACGACGATGTGTTGCTTACTCTGTGCGAACGAAAGACGCGTCAGTTCTTCATGATCAAGATCGAGGATAAGACCTCAGCTAGAGTTATGAAGGCATTTGATAAGCTTCGAGAGTACTACGGATCCAAATGGAATCAAATCTTTAAGTCTATCACAACCGACAACGGATCTGAGTTCGCAGATCTATCCGATCTTGAACAAGTTTCCAAGACTCTTGTGTACTACGCTCACCCTTATACATCCTGTGATAAAGGCAGCGTAGAACGGCACAACGGGCTTATCAGACGCTATATTCCCAAGGGAGACCGTATGGATAAGTATAGTGTGGAAGATATTGCTAAGATCGAGGTATGGTGCAACTCTCTTCCTCGGAAGATCTTAAACTACAAGACTCCAGAAGAGTACTTTGACACCGAACTTGACCGCATTTACCGGCGTAGATAGTCAAAATCTGCCAGATGTTATGGTAAGTGTTCAATTTATTCTTGCAATTGGCGAAA	NA	NA	NA	NA
>prophage 10
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	1152010	1289978	2237608	protease,tRNA,integrase,transposase	unidentified_phage(18.18%)	108	1151873:1151932	1224446:1225687
1151873:1151932	attL	TTCGCCGATTGTAAAATTAAACTGAACACTGTTCCGATCCAGTAAGAAAAATCGTTTTCA	NA	NA	NA	NA
WP_035164983.1|1152010_1153060_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_035165481.1|1157809_1158001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164933.1|1158050_1158899_-	microcin c7 resistance mccf related protein	NA	NA	NA	NA	NA
WP_072538220.1|1158943_1160368_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003615224.1|1160360_1161335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164935.1|1161334_1162075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002880372.1|1162184_1162382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615228.1|1162529_1163141_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_003615229.1|1163219_1163972_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003614258.1|1164044_1164956_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_035164937.1|1165114_1166545_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003615231.1|1166645_1168166_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_035161204.1|1168169_1169093_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	1.4e-27
WP_003615234.1|1169413_1169872_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003615236.1|1169954_1170374_+	3-beta hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_035164938.1|1170435_1171347_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_072538219.1|1172099_1173206_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.0	3.0e-88
WP_035164940.1|1175104_1176277_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_035164942.1|1176579_1182309_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	30.8	6.4e-09
WP_035161211.1|1182563_1183067_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035164945.1|1183147_1183648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035161213.1|1184081_1184696_+	DedA family protein	NA	NA	NA	NA	NA
WP_016396563.1|1185063_1186080_+	aspartate--ammonia ligase	NA	NA	NA	NA	NA
WP_035164946.1|1186155_1187454_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	28.6	2.1e-53
WP_051112117.1|1187519_1188527_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.2	6.8e-15
WP_035164949.1|1188569_1191593_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.4	2.8e-136
WP_035164951.1|1191596_1193480_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_035164953.1|1195117_1195708_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_052109140.1|1195776_1196088_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035164955.1|1196308_1197145_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003615265.1|1197188_1197755_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002878604.1|1197824_1198016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164956.1|1198402_1199641_-	peptidase T	NA	NA	NA	NA	NA
WP_035164957.1|1199684_1200482_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002878610.1|1200474_1201167_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016396558.1|1201312_1201753_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_035164960.1|1201752_1202559_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_072538218.1|1202604_1202937_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	44.2	1.3e-15
WP_035164407.1|1203948_1205292_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|1205248_1205482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|1205537_1205885_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035160962.1|1205877_1206060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615282.1|1206377_1206710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|1208564_1209743_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_013440320.1|1211791_1212970_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_011543955.1|1214612_1215236_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_013440320.1|1217498_1218677_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_013440320.1|1218747_1219926_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164983.1|1223317_1224367_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_035164968.1|1225270_1226653_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	33.7	8.1e-51
1224446:1225687	attR	TGAAAACGATTTTTCTTACTGGATCGGAACAGTGTTCAGTTTAATTTTACAATCGGCGAATTTATAATGGTCAATATTCTCTCTGTCTTTCACATGCCGACAGATTAAATAATCCTCTTCAATTTCTTCAGCAACTAGGTCTGGATCTTCTGCTTCAATTTGACCATCTTCTAGTAGTTTAACCATAGCCAAAATAAGAAGATATACGGTAGTTAGGCGCTGTTGACCGTCGATAATTTGAAGTTTGCTGCTGTAATCTCCGCCAATTTCAACAATGCTACCGAAGAAGTGGGTGTCTCTATCCTCTTTTACCATATCAACCAAATCATCAAAAAGTTGTTGGCAGTTTGGAACCTTCCAATCATAATTTCTTTGGTATACAGGAATTTTCAGCTTAGTTTTTGAACCGTCAAACATCTCATAAATTGGTATCGCGGTACCCTTCATTTTCATTTCCTCACATTCTCTATAGATACTTATATGATAGCATTTTACTTCCTTAATGGCCTCTTAGACTCTACCAAAAAACTCTCCCTAAAGCATTAGAGAGAGTCATCATATCCTTGCCACTACATCATCGTCTGCTCAATGTTAGAGAATATTGGGTCAGATTATATCAAATTGTGTCATTTGATATTATTTTGCCGAGTGTCTGCTTTAACAGCTTTAATATCTAGACCGACCTTTTTCAAGCAATACCTAGCAAGTAAGTATCACAAACGCTCCCTTGATATGGTTTTCAAGAAAACTGGAGGACAACTTTACAGTCCGTCAACCGAAGCTCTATACACAGACACAAATATTACTCGTTTGCCAAGTGGCTCCTCAAATGAGAGGAGACCATTTGGCTGGATGCAACACAGCATCCACTATCCAGTTCGCAAATGAGACGTTCGGGAATACTTTTCTTACTATCTGCATTGCACCGTTGATGTCCGCATTGACCAACAAACACTTGTTGGTTCTAAACATGCCGCGGTGAATGCGCCGATTGGCTGGGCTCAGCCCTTGCTTCTTTCTGCTCTTATTGCCATTGTTCCAGCACGGCTTTTCGCCGTCAAGAGCACTAGTCTGACTTGTATACGATTCATTTGTGCAGATAACCGTGATACCGACCATATTGGCCTTGTAGCGGATCATATTGATCATCTGCTGGTGAGGCAAGCCAACAAAGTTCTGATTGTTTTTCTTGCCCATATTTACTGACCGTTTCCATGTATTGTTCTTGCCAATCACAATAGT	NA	NA	NA	NA
WP_141305868.1|1226879_1227281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760731.1|1228911_1229058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538214.1|1229081_1230272_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_143434649.1|1231879_1233284_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.7	2.4e-42
WP_003617847.1|1233495_1233741_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003612998.1|1233747_1233870_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013440320.1|1234070_1235249_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164407.1|1235372_1236716_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|1236672_1236906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|1236961_1237309_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035164409.1|1237301_1237484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003613006.1|1238812_1239934_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.4	5.8e-39
WP_003615317.1|1239975_1241094_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.8	1.2e-36
WP_035161268.1|1241065_1242904_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.4	2.3e-56
WP_035164978.1|1242935_1245002_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003615321.1|1244994_1245906_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_035164979.1|1246171_1246921_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003612996.1|1246920_1247826_-	GTPase Era	NA	NA	NA	NA	NA
WP_002880164.1|1247809_1248229_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_003615327.1|1248230_1248755_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_035161276.1|1248754_1249702_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	48.4	8.9e-49
WP_002880182.1|1249855_1250032_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_035164981.1|1250200_1251058_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_013439694.1|1251117_1251387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035161280.1|1251452_1252337_-	YitT family protein	NA	NA	NA	NA	NA
WP_003615339.1|1253755_1254940_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_072538211.1|1255120_1256431_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_035164983.1|1256520_1257570_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_078256830.1|1258066_1259290_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.0	5.1e-97
WP_035164985.1|1259699_1260407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164987.1|1260690_1260975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130137519.1|1260998_1261307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025895368.1|1261306_1261492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164992.1|1261871_1262768_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003615348.1|1262853_1264248_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IEP8	Erwinia_phage	27.8	4.0e-37
WP_003613136.1|1264250_1264784_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003613135.1|1264892_1265780_-	tyrosine recombinase XerC	NA	A0A1P8DJJ6	Virus_Rctr41k	31.5	2.5e-21
WP_035164994.1|1265779_1267099_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_003615350.1|1267230_1269405_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	34.9	1.0e-92
WP_003615351.1|1269531_1270371_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_035164995.1|1270461_1271232_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.0	2.0e-27
WP_003615353.1|1271221_1272079_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003613715.1|1272153_1272384_-	YozE family protein	NA	NA	NA	NA	NA
WP_002880203.1|1272387_1273233_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.0	1.0e-19
WP_072538208.1|1273368_1274049_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_072538207.1|1274162_1275212_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	4.0e-42
WP_072538195.1|1275800_1277024_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
WP_072538196.1|1277146_1278400_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035164999.1|1278572_1279763_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	33.6	5.2e-46
WP_072538167.1|1279922_1281290_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035165001.1|1281350_1282250_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.5	9.6e-53
WP_002880208.1|1282284_1282530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165502.1|1282603_1282900_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003615366.1|1282998_1283190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035161295.1|1283666_1285439_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	2.3e-50
WP_035165003.1|1285435_1287169_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	2.6e-38
WP_076612173.1|1287359_1288622_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_072538205.1|1288943_1289978_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.9	6.1e-43
>prophage 11
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	1301388	1366659	2237608	protease,tRNA,integrase,transposase	Bacillus_phage(16.67%)	53	1316061:1316078	1347915:1347932
WP_035164407.1|1301388_1302732_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_035165008.1|1304731_1305679_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016396499.1|1305787_1306921_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002876681.1|1307037_1308063_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003615397.1|1308264_1309152_-	cation transporter	NA	NA	NA	NA	NA
WP_003615398.1|1309263_1309566_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035161317.1|1309645_1310173_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.8	6.5e-25
WP_035165010.1|1310162_1312439_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.4	4.7e-72
WP_003615401.1|1312435_1313137_-	class A sortase	NA	NA	NA	NA	NA
WP_013439791.1|1313117_1314956_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.5	1.5e-20
WP_003615404.1|1315077_1316217_-	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	25.9	3.1e-16
1316061:1316078	attL	CTTCGTTGACTTCCTTGT	NA	NA	NA	NA
WP_035165012.1|1316299_1318144_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	1.0e-141
WP_035161323.1|1318205_1318805_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_035161325.1|1318816_1319860_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003615411.1|1319995_1320937_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	35.1	1.8e-09
WP_072538334.1|1321050_1321644_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	39.6	6.0e-35
WP_052109142.1|1323151_1323568_-	hypothetical protein	NA	A0A1B0T6A8	Bacillus_phage	29.7	3.1e-06
WP_072538204.1|1325220_1326444_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	3.0e-97
WP_013440320.1|1326687_1327866_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_076612173.1|1328077_1329340_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_072538202.1|1330238_1331417_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_072538201.1|1331450_1331597_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035161940.1|1332400_1333312_+	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.8	2.8e-60
WP_003615419.1|1333333_1334518_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_035165013.1|1334483_1335041_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_049768352.1|1335287_1335701_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003615423.1|1336596_1337493_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002876717.1|1337543_1337906_-	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_013439807.1|1337918_1340396_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.9	2.3e-19
WP_002876720.1|1340400_1340685_-	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
WP_011678395.1|1340711_1340990_-	YlxR family protein	NA	NA	NA	NA	NA
WP_035165016.1|1341020_1342172_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002876725.1|1342191_1342668_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_072538200.1|1342776_1347114_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	31.6	9.8e-18
WP_035165020.1|1347126_1348824_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
1347915:1347932	attR	CTTCGTTGACTTCCTTGT	NA	NA	NA	NA
WP_013439810.1|1348863_1350111_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002876734.1|1350120_1350918_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_035165022.1|1350923_1351655_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	38.2	2.4e-17
WP_003615442.1|1351657_1352215_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002876740.1|1352214_1352940_-	UMP kinase	NA	NA	NA	NA	NA
WP_003615444.1|1353089_1354118_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003615446.1|1354180_1354942_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003615447.1|1355105_1356116_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003615448.1|1356186_1356801_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_035161952.1|1356882_1357869_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003615450.1|1357869_1359084_-	aspartate kinase	NA	NA	NA	NA	NA
WP_035161955.1|1359076_1360225_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003615452.1|1360364_1360799_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_035162034.1|1360847_1362638_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.4	1.6e-22
WP_003615455.1|1362630_1364391_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	4.8e-48
WP_002876770.1|1364501_1364726_-	YneF family protein	NA	NA	NA	NA	NA
WP_035165024.1|1364838_1365075_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_072538167.1|1365291_1366659_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
>prophage 12
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	1395118	1458351	2237608	protease,tRNA,transposase	uncultured_virus(25.0%)	52	NA	NA
WP_013440320.1|1395118_1396297_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_143434650.1|1398431_1400708_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_035164370.1|1401430_1402000_+	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	31.2	2.7e-16
WP_011674067.1|1402094_1402259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164366.1|1404905_1407569_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.8	5.0e-57
WP_035164365.1|1407579_1408401_+	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	28.9	3.3e-23
WP_013439915.1|1408409_1408994_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002879222.1|1409007_1409475_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_013439914.1|1409478_1410813_+	helicase DnaB	NA	NA	NA	NA	NA
WP_003615632.1|1410823_1411747_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	32.5	3.9e-25
WP_002879226.1|1412047_1413979_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	32.9	7.5e-95
WP_050899099.1|1414161_1414785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|1415144_1416323_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003615627.1|1416535_1417765_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002879234.1|1418307_1418829_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	39.4	1.0e-14
WP_002879235.1|1418849_1419050_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002879237.1|1419094_1419451_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_035165402.1|1419559_1420669_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_003615623.1|1420679_1421318_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_002879240.1|1421310_1421904_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002879243.1|1421945_1422293_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_003615619.1|1422296_1423451_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003614912.1|1423450_1424029_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_035164362.1|1424208_1424922_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.7	3.2e-27
WP_035164359.1|1424914_1426507_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	4.1e-22
WP_003615616.1|1426595_1427558_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003615614.1|1427591_1427864_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002879252.1|1427929_1428694_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003615612.1|1428775_1429126_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003615610.1|1429405_1430455_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	34.9	1.1e-31
WP_035164357.1|1430454_1432866_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003615606.1|1432936_1433425_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003615605.1|1435133_1437716_-	YfhO family protein	NA	NA	NA	NA	NA
WP_016396914.1|1437801_1439916_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_002879260.1|1440002_1440152_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003615603.1|1440205_1440778_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003614162.1|1440770_1441442_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003614169.1|1441441_1441669_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_003614167.1|1441731_1442133_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_035164353.1|1442213_1443131_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_016396910.1|1443136_1444393_+	aluminum resistance protein	NA	NA	NA	NA	NA
WP_016396909.1|1444530_1445868_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_035164351.1|1446118_1447339_+	MFS transporter	NA	NA	NA	NA	NA
WP_035164349.1|1447439_1447811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164347.1|1449893_1450193_+	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	A0A218MNE0	uncultured_virus	66.7	5.0e-06
WP_035162289.1|1450238_1451039_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	45.5	2.9e-61
WP_016396904.1|1451127_1452057_-	DegV family protein	NA	NA	NA	NA	NA
WP_035162291.1|1452249_1452591_+	HIRAN domain-containing protein	NA	NA	NA	NA	NA
WP_035162293.1|1452807_1453800_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_072538196.1|1453993_1455247_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_072538195.1|1455369_1456593_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
WP_013440320.1|1457172_1458351_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	1467410	1529448	2237608	tRNA,transposase	Prochlorococcus_phage(15.0%)	58	NA	NA
WP_072538193.1|1467410_1468445_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.9	3.6e-43
WP_072538192.1|1468604_1469315_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003618477.1|1469311_1469554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615506.1|1470118_1470802_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_035165043.1|1470831_1471725_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_078256835.1|1471725_1473750_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SD90	Indivirus	26.3	4.9e-20
WP_072538191.1|1473721_1474477_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_035165046.1|1474482_1475799_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003611980.1|1475788_1476736_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.1	4.8e-10
WP_035165047.1|1476748_1479130_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_002879690.1|1479192_1479414_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002879689.1|1479415_1480030_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	31.7	3.9e-13
WP_035165049.1|1480203_1480509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615514.1|1480625_1480958_-	peptide ABC transporter	NA	NA	NA	NA	NA
WP_050782116.1|1480997_1481354_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035165051.1|1481563_1483252_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003615519.1|1483273_1484089_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_072538190.1|1484088_1484952_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002879682.1|1484956_1485196_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_035165055.1|1485188_1486559_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.1	6.9e-34
WP_003615525.1|1486545_1487397_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	44.7	7.2e-42
WP_002879679.1|1487455_1487854_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_003618444.1|1487853_1488288_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_035165057.1|1488307_1488874_-	elongation factor P	NA	NA	NA	NA	NA
WP_016396438.1|1488943_1490050_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_035162038.1|1490194_1490488_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003615531.1|1490509_1490821_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003615533.1|1491061_1491418_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	41.8	6.3e-16
WP_072538331.1|1492289_1492655_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	4.0e-05
WP_003615539.1|1492715_1493981_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_035165058.1|1493996_1495538_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.1	8.2e-68
WP_003615541.1|1495538_1496120_-	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_035162042.1|1496119_1497163_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	8.3e-64
WP_003615543.1|1497165_1498644_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.4	1.8e-51
WP_003615544.1|1498619_1500842_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.2	6.5e-143
WP_035165059.1|1500841_1501516_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_035165060.1|1501515_1501764_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003615550.1|1501768_1502491_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	37.7	3.2e-38
WP_011544054.1|1502814_1504110_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	1.4e-20
WP_035162044.1|1504153_1505278_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_035162016.1|1505267_1505735_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.2	4.0e-18
WP_072538188.1|1506175_1506358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165062.1|1506865_1507261_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035165064.1|1508716_1508959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165066.1|1508989_1510813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|1511044_1512223_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035165068.1|1512371_1514510_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	45.6	1.6e-98
WP_003615571.1|1514997_1517376_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_035165069.1|1518966_1519749_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_072538176.1|1519903_1520953_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	8.1e-43
WP_035165071.1|1521043_1521967_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	64.7	1.8e-107
WP_095582932.1|1522155_1523358_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035165075.1|1523730_1524912_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	35.9	5.2e-46
WP_035164407.1|1525364_1526708_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|1526664_1526898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|1526953_1527301_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035160962.1|1527293_1527476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|1528269_1529448_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	1532691	1606616	2237608	tRNA,transposase	Staphylococcus_phage(20.0%)	58	NA	NA
WP_003611557.1|1532691_1533339_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_002879808.1|1533361_1533682_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002879806.1|1533760_1534417_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002879805.1|1534493_1535711_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035162252.1|1535703_1536444_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	3.0e-20
WP_025895565.1|1536547_1536985_+	HIT family protein	NA	Q19XP5	Mycobacterium_phage	32.6	3.9e-07
WP_003615649.1|1537001_1537352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035162250.1|1537431_1538361_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_013439932.1|1538624_1539347_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_035162245.1|1539336_1539960_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	26.0	8.5e-08
WP_035162242.1|1540086_1541010_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_095582949.1|1541091_1541748_-	chorismate synthase	NA	NA	NA	NA	NA
WP_035162238.1|1541720_1542047_-	shikimate kinase	NA	NA	NA	NA	NA
WP_003613948.1|1542427_1543378_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_072538186.1|1543370_1545797_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013439938.1|1545793_1546999_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_016396947.1|1547001_1547355_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_035162231.1|1547396_1549484_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002879784.1|1549624_1550473_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003615669.1|1550567_1551479_-	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_035165082.1|1551604_1552309_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_072538185.1|1552483_1552867_-	sortase	NA	NA	NA	NA	NA
WP_013440320.1|1553811_1554990_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035165090.1|1557849_1558074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165091.1|1558174_1559728_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_013439946.1|1559743_1560595_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_035165093.1|1562268_1564119_-	pyruvate oxidase	NA	NA	NA	NA	NA
WP_035165094.1|1564340_1565459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|1565644_1566823_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035162216.1|1566994_1569409_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	31.8	3.0e-125
WP_013438997.1|1569743_1571027_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.9e-58
WP_035165096.1|1571224_1572844_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003615690.1|1572938_1575353_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	66.7	0.0e+00
WP_035164983.1|1575701_1576751_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_035162207.1|1576957_1578406_-	MFS transporter	NA	NA	NA	NA	NA
WP_035165099.1|1578468_1579665_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.6	1.1e-141
WP_078256836.1|1586042_1586969_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	21.9	2.0e-08
WP_016396720.1|1587003_1587663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876598.1|1587734_1588340_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_035165105.1|1588336_1589107_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_035162510.1|1589103_1589649_-	YutD family protein	NA	NA	NA	NA	NA
WP_035162512.1|1589596_1591027_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_002876592.1|1591037_1591370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615703.1|1591476_1592478_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_035165107.1|1592630_1593737_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_035162517.1|1594137_1594515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016396726.1|1594537_1594957_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_016396727.1|1595088_1595940_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003615712.1|1595981_1596602_-	XTP/dITP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	28.5	1.8e-10
WP_016396728.1|1596840_1597236_+	YslB family protein	NA	NA	NA	NA	NA
WP_013438997.1|1597469_1598753_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.9e-58
WP_016396729.1|1598821_1599133_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.9	1.1e-19
WP_035164396.1|1599304_1600354_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_078256837.1|1600478_1602842_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.4e-21
WP_016396732.1|1602905_1603229_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_002876575.1|1603231_1603660_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003615719.1|1603659_1603917_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_003615721.1|1603982_1606616_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.2	7.9e-63
>prophage 15
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	1626767	1687496	2237608	tRNA,transposase	Streptococcus_phage(30.77%)	59	NA	NA
WP_035164983.1|1626767_1627817_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_072538182.1|1627852_1628608_-	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_035162528.1|1628604_1629468_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.6	3.3e-66
WP_016396749.1|1629467_1629800_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_003615752.1|1629814_1630687_-	DNA polymerase III subunit delta	NA	M1NSC1	Streptococcus_phage	26.8	1.6e-15
WP_002876541.1|1630686_1631013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615753.1|1631024_1631663_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.4	5.2e-53
WP_002876539.1|1631792_1632029_-	YaaL family protein	NA	NA	NA	NA	NA
WP_002876538.1|1632030_1632630_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002876537.1|1632631_1632961_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016396751.1|1633032_1634856_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.6	7.7e-49
WP_003615755.1|1635015_1635525_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_035162535.1|1635524_1636127_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_035165114.1|1636128_1636659_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_035165116.1|1638234_1641102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003611058.1|1641158_1641437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615763.1|1641708_1641951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615765.1|1641917_1642253_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_035165118.1|1642569_1642761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165120.1|1642759_1643707_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_035162550.1|1643838_1644957_-	serine hydrolase	NA	NA	NA	NA	NA
WP_041812036.1|1646859_1648083_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	1.7e-97
WP_003615771.1|1648333_1648996_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016396754.1|1648995_1649925_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003615773.1|1649936_1650566_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013440320.1|1651457_1652636_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_095582936.1|1653305_1654508_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013439993.1|1655072_1655345_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	70.0	1.1e-25
WP_002876509.1|1657373_1657739_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002876508.1|1657791_1658301_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_035165129.1|1658561_1658963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101868787.1|1658982_1659201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035162599.1|1660540_1661545_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003615785.1|1661707_1662403_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002876501.1|1662486_1662912_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002876498.1|1663037_1663592_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_003615789.1|1663683_1663854_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002876495.1|1663860_1664010_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003615790.1|1664185_1665937_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_002876482.1|1666959_1667175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016396767.1|1667242_1667812_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_035165133.1|1667923_1668673_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_002876476.1|1668659_1669103_-	ribonuclease iii family protein	NA	NA	NA	NA	NA
WP_035165136.1|1669095_1670520_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.4	1.4e-53
WP_035162591.1|1670662_1671229_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003615804.1|1672182_1672443_+	peptidase M20	NA	NA	NA	NA	NA
WP_035165137.1|1672544_1673420_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	35.7	6.4e-09
WP_072538176.1|1673626_1674676_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	8.1e-43
WP_035162587.1|1674790_1675816_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_002876356.1|1675897_1677400_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016396774.1|1677544_1678381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440010.1|1678380_1679079_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.8e-14
WP_002876367.1|1679080_1679449_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016396775.1|1679822_1681442_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003615813.1|1681573_1682098_+	NUDIX hydrolase	NA	A0A1S6L1P8	Vibrio_phage	28.6	3.9e-06
WP_035165164.1|1682138_1683359_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_035165162.1|1683355_1684537_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_035165160.1|1684551_1685619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164983.1|1686446_1687496_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
>prophage 16
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	1746021	1801931	2237608	transposase	unidentified_phage(25.0%)	33	NA	NA
WP_035164396.1|1746021_1747071_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_072538172.1|1747090_1748272_+	galactokinase	NA	NA	NA	NA	NA
WP_035165180.1|1748296_1749763_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_035165182.1|1749835_1751203_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_035165183.1|1751500_1752394_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_035165185.1|1752528_1753380_-	hypothetical protein	NA	A0A249XZV3	Enterococcus_phage	71.0	2.4e-21
WP_035165187.1|1754068_1754932_-	homoserine kinase	NA	NA	NA	NA	NA
WP_016396828.1|1755099_1756578_+	threonine synthase	NA	NA	NA	NA	NA
WP_003615907.1|1757206_1757737_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003611373.1|1757937_1758123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016396829.1|1758243_1759230_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.4	1.5e-22
WP_013440066.1|1759252_1760710_-	sucrose-6-phosphate hydrolase	NA	NA	NA	NA	NA
WP_003615910.1|1760994_1762941_+	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_016396832.1|1763126_1764206_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_013440320.1|1766010_1767189_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035165190.1|1767323_1769045_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	45.2	1.6e-141
WP_035165194.1|1770989_1771517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164396.1|1772646_1773696_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_035165196.1|1775388_1776624_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_078256804.1|1777337_1778600_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_016396848.1|1778655_1778964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165197.1|1779102_1782243_+	DUF3427 domain-containing protein	NA	A0A0A1ENT0	Lactobacillus_phage	29.4	3.0e-32
WP_016396850.1|1782322_1783312_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	39.0	3.3e-54
WP_035165198.1|1783504_1784347_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_035165200.1|1784539_1785910_+	amino acid permease	NA	NA	NA	NA	NA
WP_003615959.1|1786533_1786902_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_035165202.1|1786911_1787826_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_035165203.1|1787854_1788667_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_035165205.1|1788685_1789687_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_035165207.1|1790577_1791957_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_072538328.1|1792441_1793992_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078256838.1|1800510_1800690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|1800752_1801931_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	1815640	1876864	2237608	tRNA,transposase	Streptococcus_phage(33.33%)	45	NA	NA
WP_072538168.1|1815640_1817392_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002880222.1|1817357_1817588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|1817789_1819133_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|1819089_1819323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|1819378_1819726_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035160962.1|1819718_1819901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615989.1|1820268_1820949_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.3	1.2e-15
WP_035165225.1|1820948_1822184_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003615992.1|1822195_1822672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011544204.1|1822671_1823040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003611142.1|1823205_1823667_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	58.6	7.9e-43
WP_035165228.1|1823689_1826059_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.2	3.9e-77
WP_002876914.1|1826125_1826359_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_035165229.1|1826413_1828486_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.2	1.8e-139
WP_003615999.1|1828504_1829518_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003611152.1|1829510_1830560_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003616000.1|1830552_1831722_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041812036.1|1833427_1834651_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	1.7e-97
WP_013438997.1|1834908_1836192_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.9e-58
WP_072538167.1|1836347_1837715_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035164983.1|1839263_1840313_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_035165231.1|1842055_1843279_-	arginine deiminase	NA	NA	NA	NA	NA
WP_003616007.1|1843442_1844372_-	carbamate kinase	NA	NA	NA	NA	NA
WP_078256799.1|1844390_1845395_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_013440320.1|1845417_1846596_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_016396985.1|1847072_1847942_+	response regulator	NA	NA	NA	NA	NA
WP_035165232.1|1848018_1848738_+|tRNA	tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
WP_035165234.1|1848816_1849419_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_072538166.1|1849848_1851072_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	1.3e-97
WP_157737585.1|1852177_1853326_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_072538165.1|1854116_1855166_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
WP_003616015.1|1861015_1861882_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_035165238.1|1861895_1862459_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003612150.1|1862616_1863924_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.0	2.0e-91
WP_078256798.1|1864167_1864662_-	GNAT family N-acetyltransferase	NA	A0A2K9L4B7	Tupanvirus	34.1	8.8e-08
WP_003616018.1|1864661_1865255_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	39.3	5.6e-33
WP_016396856.1|1865461_1866265_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035165241.1|1866267_1867152_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002879329.1|1867680_1868352_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_035164983.1|1868531_1869581_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_035165242.1|1869862_1871248_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_072538166.1|1871635_1872859_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	1.3e-97
WP_072538303.1|1873097_1874465_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	28.8	6.0e-30
WP_035165243.1|1874633_1875716_-	membrane protein	NA	NA	NA	NA	NA
WP_072538165.1|1875814_1876864_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
>prophage 18
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	1905541	1948077	2237608	transposase,protease	unidentified_phage(28.57%)	34	NA	NA
WP_003612123.1|1905541_1906204_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_035165262.1|1906218_1906872_+	phosphoglycerate mutase family protein	NA	NA	NA	NA	NA
WP_003616066.1|1906977_1907670_+	glycerophosphoryl diester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	23.6	2.6e-13
WP_035165265.1|1907976_1908480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060611715.1|1908499_1908787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760733.1|1908720_1908873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165270.1|1911013_1912537_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_035165271.1|1912547_1913255_-	VanZ family protein	NA	NA	NA	NA	NA
WP_035165272.1|1913514_1913937_+	GtrA family protein	NA	NA	NA	NA	NA
WP_120490618.1|1913943_1914117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008460463.1|1914183_1914633_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.6	2.0e-19
WP_072538326.1|1915637_1916627_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.9	4.3e-38
WP_035165275.1|1916808_1917798_-	capsule biosynthesis protein CapC	NA	NA	NA	NA	NA
WP_035165276.1|1917828_1918818_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013440320.1|1919635_1920814_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035165277.1|1921550_1922558_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	24.6	4.9e-05
WP_035165279.1|1922583_1923570_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_035165281.1|1923572_1924412_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_013440320.1|1924736_1925915_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035165282.1|1926019_1926733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165284.1|1926787_1927909_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_078256804.1|1927916_1929179_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_013440320.1|1930403_1931582_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035165287.1|1932239_1933355_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	71.2	2.0e-156
WP_072538323.1|1933497_1934532_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.9	4.0e-42
WP_035165289.1|1934861_1935842_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035165290.1|1936081_1937311_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035165292.1|1941072_1941960_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_035165536.1|1942275_1942572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165293.1|1942823_1943192_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003616107.1|1943326_1944340_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_035165295.1|1945190_1945502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165297.1|1945778_1946693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|1946898_1948077_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	1954587	2002684	2237608	transposase	uncultured_virus(12.5%)	45	NA	NA
WP_035164407.1|1954587_1955931_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_078256804.1|1956078_1957341_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_072538319.1|1958278_1958713_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_003612761.1|1958765_1959191_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002880229.1|1960042_1961017_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.2	6.2e-29
WP_095582951.1|1961030_1961639_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	7.2e-44
WP_070487999.1|1962561_1963560_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	1.0e-87
WP_072538317.1|1963647_1964172_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072538316.1|1964183_1964888_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_013440194.1|1964889_1965267_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_072538315.1|1965268_1965850_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_072538314.1|1965863_1966859_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_072538347.1|1966968_1967631_-	beta-carotene 15,15'-monooxygenase	NA	NA	NA	NA	NA
WP_072538313.1|1967675_1967990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041812036.1|1968360_1969584_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	1.7e-97
WP_016395838.1|1969822_1971190_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_011544347.1|1971871_1972096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538312.1|1972067_1973819_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035160962.1|1975614_1975797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|1975789_1976137_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|1976192_1976426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|1976382_1977726_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_072538310.1|1977983_1979432_-	flippase	NA	NA	NA	NA	NA
WP_013440320.1|1979585_1980764_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035165306.1|1981200_1982481_+	GTPase HflX	NA	NA	NA	NA	NA
WP_035165307.1|1982529_1983309_-	hydrolase	NA	NA	NA	NA	NA
WP_035165308.1|1983354_1984113_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	40.2	2.3e-15
WP_072538309.1|1985333_1987040_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003614608.1|1987008_1987677_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	5.7e-50
WP_035165310.1|1988084_1988867_-	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	42.7	3.4e-14
WP_003616168.1|1989054_1989528_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	38.5	5.5e-15
WP_035165311.1|1989697_1990744_-	lactate dehydrogenase	NA	NA	NA	NA	NA
WP_035165313.1|1991028_1991514_-	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	39.7	1.6e-14
WP_002879481.1|1991638_1992181_-	AAA family ATPase	NA	A0A2R2ZH49	Clostridioides_phage	28.0	3.0e-09
WP_002879482.1|1992270_1992600_+	DUF2187 family protein	NA	NA	NA	NA	NA
WP_035165314.1|1992663_1994202_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_035161515.1|1994252_1994879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002879488.1|1994881_1995397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165316.1|1995853_1996321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016396190.1|1996546_1997038_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_035165317.1|1997040_1997796_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_035165318.1|1997849_1999394_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.2	2.0e-45
WP_002879494.1|1999408_1999786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035161504.1|1999904_2001044_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035165320.1|2001385_2002684_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	C1KFS0	Lactobacillus_virus	39.0	2.5e-70
>prophage 20
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	2021011	2080193	2237608	transposase	Streptococcus_phage(14.29%)	55	NA	NA
WP_013440320.1|2021011_2022190_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_016396175.1|2022724_2024452_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.2e-44
WP_002879518.1|2024590_2025361_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_002879521.1|2025375_2026476_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002879522.1|2026552_2026816_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003613278.1|2026808_2027699_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	34.4	9.0e-19
WP_003616606.1|2027676_2028456_-	ParA family protein	NA	Q8JL10	Natrialba_phage	30.4	5.1e-26
WP_072538307.1|2028457_2029282_-	nucleoid occlusion protein	NA	S5WII0	Leptospira_phage	41.8	6.6e-16
WP_016396172.1|2029300_2030020_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_035165333.1|2030191_2030716_+	CvpA family protein	NA	NA	NA	NA	NA
WP_035165335.1|2030939_2031899_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002879529.1|2031910_2032693_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_095582939.1|2032859_2034062_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002879530.1|2034393_2034942_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	44.6	3.3e-32
WP_003616594.1|2034957_2035497_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	46.2	9.3e-35
WP_052109149.1|2035624_2036173_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035165337.1|2036448_2037849_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_016396167.1|2037926_2038349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165338.1|2038371_2039034_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	2.4e-24
WP_035164983.1|2039117_2040167_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_072538305.1|2040280_2040934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165341.1|2040926_2041625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165342.1|2041611_2042406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440268.1|2042580_2043078_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_035165343.1|2043184_2043991_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	24.0	1.4e-07
WP_035165345.1|2043999_2045289_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_011678650.1|2045288_2045492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165346.1|2045554_2046586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052109150.1|2046588_2047200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002879538.1|2047352_2048027_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	1.0e-35
WP_003616571.1|2048028_2049087_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035165347.1|2049129_2049636_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035165348.1|2049956_2051360_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_035165349.1|2051541_2052279_-	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	32.5	1.9e-22
WP_035165351.1|2052343_2052979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165352.1|2053072_2054284_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_078256840.1|2054360_2055623_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.3	6.1e-29
WP_072538304.1|2055875_2056910_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.0	7.5e-41
WP_013440320.1|2057075_2058254_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_078256803.1|2058668_2060036_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	28.5	1.3e-29
WP_072538302.1|2061070_2063317_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.3	5.4e-60
WP_035164407.1|2065714_2067058_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|2067014_2067248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|2067303_2067651_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035160962.1|2067643_2067826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538300.1|2068032_2070564_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.9e-72
WP_016396148.1|2071026_2071815_+	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	2.1e-19
WP_078256804.1|2071928_2073191_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_013440320.1|2073377_2074556_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035160962.1|2074875_2075058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|2075050_2075398_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|2075453_2075687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|2075643_2076987_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_072538195.1|2077593_2078817_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
WP_072538196.1|2078939_2080193_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	2093905	2152259	2237608	transposase,protease	Staphylococcus_phage(23.08%)	41	NA	NA
WP_035165359.1|2093905_2095996_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.2	8.4e-124
WP_035160962.1|2096175_2096358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|2096350_2096698_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|2096753_2096987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|2096943_2098287_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_072538298.1|2098809_2100516_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_072538287.1|2100484_2101153_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	5.7e-50
WP_078256805.1|2101327_2102041_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_078256806.1|2102592_2102994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538195.1|2103739_2104963_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
WP_035172677.1|2106558_2106756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165360.1|2106828_2107494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616492.1|2107695_2107893_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	9.8e-19
WP_035165361.1|2108427_2108670_+	recombinase family protein	NA	M4QQC6	Vibrio_phage	55.8	1.4e-06
WP_003613384.1|2111034_2111844_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_016396128.1|2111908_2112784_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013440303.1|2112776_2114087_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_013440320.1|2114150_2115329_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003616476.1|2121282_2121552_-	anion transporter	NA	NA	NA	NA	NA
WP_003616470.1|2122341_2122806_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.0	1.5e-25
WP_035165365.1|2122820_2123999_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.9	1.3e-97
WP_003616467.1|2124018_2124633_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.9	4.6e-30
WP_035160962.1|2126047_2126230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|2126222_2126570_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|2126625_2126859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|2126815_2128159_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_035165367.1|2134456_2135083_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035165368.1|2135086_2137087_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	33.9	4.4e-29
WP_016396121.1|2137223_2137613_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003613653.1|2137772_2137997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003613649.1|2138171_2139458_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_002879627.1|2139447_2139690_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_035165369.1|2139767_2141000_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.3	2.4e-22
WP_035165370.1|2140996_2142499_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.3	2.2e-41
WP_003613642.1|2142514_2142664_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_013440320.1|2142984_2144163_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003613636.1|2144230_2144533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|2145419_2146598_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035162141.1|2147749_2148220_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_035165557.1|2150356_2151517_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003616451.1|2151602_2152259_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 22
NZ_CP023139	Lactobacillus delbrueckii subsp. lactis strain KCTC 3034 chromosome, complete genome	2237608	2170572	2227530	2237608	transposase	Bacillus_phage(20.0%)	51	NA	NA
WP_072538295.1|2170572_2171796_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.5	7.4e-96
WP_013440320.1|2172019_2173198_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003624103.1|2173719_2174568_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035165377.1|2174621_2176106_-	MFS transporter	NA	NA	NA	NA	NA
WP_035165378.1|2176408_2177764_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.7	5.2e-10
WP_003611643.1|2177773_2178442_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_002877735.1|2178576_2178942_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_035165379.1|2179006_2179348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438946.1|2179518_2179899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035161041.1|2179916_2180417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165380.1|2181354_2182170_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003616256.1|2182283_2182763_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_035165381.1|2183254_2184538_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.5	2.0e-19
WP_002877724.1|2184632_2185430_-	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	32.0	2.5e-28
WP_003616258.1|2185448_2186249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051112105.1|2186249_2187839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165382.1|2187819_2189715_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.3	4.6e-36
WP_003616262.1|2189761_2190490_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.5	3.4e-40
WP_016395958.1|2190750_2191527_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016395957.1|2191554_2192379_+	glycosyl transferase 8 family protein	NA	NA	NA	NA	NA
WP_035165384.1|2192442_2193312_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_035165385.1|2193445_2194774_-	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	37.7	2.1e-56
WP_035160877.1|2195116_2195368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160876.1|2195493_2196072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160873.1|2196094_2198224_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_035160872.1|2198384_2198579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003611906.1|2198745_2199366_+	helix-turn-helix domain-containing protein	NA	Q9G0C2	Lactococcus_phage	38.6	1.1e-31
WP_035160868.1|2199472_2200042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|2200375_2201554_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035162107.1|2202765_2204304_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_035165386.1|2204381_2205176_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003616411.1|2205172_2206528_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_035165387.1|2206980_2209458_-	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_003616407.1|2211446_2212130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616406.1|2212329_2212647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|2213810_2214989_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164396.1|2215153_2216203_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_035165388.1|2216440_2217109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616402.1|2217110_2217821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003613078.1|2217831_2218461_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.8	3.5e-25
WP_072538293.1|2218450_2218960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165391.1|2218983_2219397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616399.1|2219409_2220192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165392.1|2220221_2220890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011544373.1|2220947_2221361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002880222.1|2222153_2222384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538230.1|2222349_2224101_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013439920.1|2224940_2225174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|2225229_2225577_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035160962.1|2225569_2225752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|2226351_2227530_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
