The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023147	Mycobacterium marseillense strain FLAC0026 chromosome, complete genome	5266037	623240	680502	5266037	protease,integrase,bacteriocin,tRNA	Streptococcus_phage(18.18%)	58	664798:664843	682819:682864
WP_067174695.1|623240_624038_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_095576506.1|624034_625045_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_082991545.1|625268_626579_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_067174688.1|626567_627191_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095576507.1|627341_628415_+	phosphotransferase	NA	NA	NA	NA	NA
WP_067174682.1|628472_630770_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	63.1	4.2e-270
WP_095576508.1|630828_631467_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_095576509.1|631404_632619_-	MCE family protein	NA	NA	NA	NA	NA
WP_083014762.1|632638_633028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067174674.1|633165_634692_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	29.9	2.3e-46
WP_008263904.1|634758_635853_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.9	7.9e-57
WP_067174670.1|635920_636106_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_095576510.1|636252_637347_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_095576511.1|637469_638357_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_095578090.1|638617_639256_-	FABP family protein	NA	NA	NA	NA	NA
WP_067174630.1|639451_639754_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_095576512.1|639755_640589_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_067174625.1|640616_641096_-	DUF4395 domain-containing protein	NA	NA	NA	NA	NA
WP_167386441.1|641320_641740_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_095576513.1|641807_642620_-	mannan chain length control protein LmeA	NA	NA	NA	NA	NA
WP_083014778.1|642789_643578_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.5	7.0e-15
WP_095576514.1|643574_644504_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_095578092.1|644668_645793_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	32.4	1.2e-23
WP_067174609.1|645844_646879_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_067174606.1|646875_647790_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_067174602.1|647802_648579_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	1.3e-16
WP_067174598.1|648605_649274_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_095576515.1|649332_651447_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_083014791.1|651657_652791_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_067174588.1|652798_653821_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_095576516.1|653974_654589_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_067174581.1|654656_655718_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_082991537.1|655739_655943_-	zinc transporter Slc39a7	NA	NA	NA	NA	NA
WP_095576517.1|655987_656395_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	32.6	1.6e-07
WP_067174574.1|656435_656936_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	33.3	8.6e-11
WP_067174571.1|657054_657954_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_157746172.1|658198_659278_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	25.1	7.4e-07
WP_157746173.1|659286_661251_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	36.5	5.1e-06
WP_139803738.1|661237_661639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095576520.1|661669_662584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095576521.1|662580_663138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095576522.1|663147_663876_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
664798:664843	attL	CCTGAAAAGCGGAAGGTCGGCGGTTCGATCCCGCCCCTGGCCACCA	NA	NA	NA	NA
WP_012396382.1|664875_666033_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	30.1	7.1e-32
WP_012396381.1|666033_666264_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009954443.1|666274_667621_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_012396380.1|667617_668040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012396379.1|668139_668934_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012396378.1|669011_669440_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_031349047.1|669510_670110_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080677207.1|670515_671127_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012396375.1|671172_671595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014941273.1|671710_672604_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033724522.1|672618_675546_-	RND family transporter	NA	NA	NA	NA	NA
WP_012396371.1|676487_677174_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031349045.1|677186_678380_-	cytochrome P450	NA	NA	NA	NA	NA
WP_012396369.1|678446_679028_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012396368.1|679453_679795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012396367.1|679848_680502_-|protease	CAAX amino protease	protease	NA	NA	NA	NA
682819:682864	attR	CCTGAAAAGCGGAAGGTCGGCGGTTCGATCCCGCCCCTGGCCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP023147	Mycobacterium marseillense strain FLAC0026 chromosome, complete genome	5266037	3836700	3843780	5266037		Bacillus_phage(28.57%)	8	NA	NA
WP_067175193.1|3836700_3837168_+	VOC family protein	NA	A0A2K9L121	Tupanvirus	33.8	8.6e-13
WP_095577583.1|3837195_3839361_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.5	2.5e-208
WP_067175094.1|3839330_3839783_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	39.3	7.6e-14
WP_064936759.1|3839815_3840055_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	64.5	2.6e-21
WP_067175091.1|3840582_3841137_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.4	1.6e-05
WP_067175088.1|3841228_3841843_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_067175190.1|3841851_3842904_+	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	29.6	7.1e-23
WP_095577584.1|3842838_3843780_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	29.5	9.3e-06
