The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023052	Listeria monocytogenes strain FDA709873-31 chromosome, complete genome	3086245	125861	132388	3086245	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|125861_126314_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|126319_126655_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_009927883.1|126871_127300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731177.1|127311_127728_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
WP_003728212.1|128007_128397_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003721744.1|128409_128922_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|128969_129272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|129313_129718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928420.1|129704_131573_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	4.5e-20
WP_003734720.1|131569_132388_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NZ_CP023052	Listeria monocytogenes strain FDA709873-31 chromosome, complete genome	3086245	689722	745105	3086245	integrase,transposase,protease,terminase,tail,portal,capsid,head,holin	Listeria_phage(53.12%)	64	682428:682445	742853:742870
682428:682445	attL	AGCCTTCTAAATCATTTT	NA	NA	NA	NA
WP_031641925.1|689722_690874_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	46.3	3.4e-87
WP_031641924.1|690895_691609_-	lipoprotein	NA	NA	NA	NA	NA
WP_031641923.1|691663_692164_-	hypothetical protein	NA	A0A1S7FYX8	Listeria_phage	31.1	7.1e-13
WP_031641922.1|692164_692515_-	helix-turn-helix domain-containing protein	NA	A0A059T669	Listeria_phage	49.0	2.3e-18
WP_031641921.1|692668_692866_+	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	52.3	7.5e-11
WP_031641920.1|692888_693215_+	DUF771 domain-containing protein	NA	A0A2H4J474	uncultured_Caudovirales_phage	41.5	4.9e-15
WP_031641918.1|694427_694784_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012951305.1|695194_695371_+	hypothetical protein	NA	A8ATL8	Listeria_phage	69.0	1.7e-14
WP_031641917.1|695384_695909_+	hypothetical protein	NA	A0A059T5F9	Listeria_phage	98.3	2.8e-97
WP_003731842.1|695921_696089_+	hypothetical protein	NA	A8ASN5	Listeria_phage	80.0	9.2e-18
WP_003731843.1|696100_696316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031645809.1|696394_696988_+	pentapeptide repeat-containing protein	NA	A8ATE4	Listeria_phage	88.6	6.0e-43
WP_060595899.1|697030_697744_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	2.7e-130
WP_088518278.1|697754_698699_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	98.1	1.1e-176
WP_009928035.1|698711_699392_+	hypothetical protein	NA	A8ATD7	Listeria_phage	96.5	1.1e-120
WP_031641750.1|699388_699598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951315.1|699647_699839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951316.1|699898_700417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951317.1|700413_700956_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	53.3	4.3e-48
WP_012951318.1|701237_701465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102578311.1|701490_701766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049961585.1|701762_702125_+	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	44.1	3.5e-14
WP_012951321.1|702219_702747_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	46.7	6.1e-31
WP_012951322.1|702715_704467_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	50.7	4.1e-156
WP_023552290.1|704473_704674_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_012951323.1|704676_705912_+|portal	phage portal protein	portal	A0A2H4JAR2	uncultured_Caudovirales_phage	42.1	3.6e-82
WP_012951324.1|705908_706475_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1D6Z2A7	Staphylococcus_phage	52.2	1.0e-44
WP_012951325.1|706538_707708_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	38.1	2.1e-44
WP_012951326.1|707756_708095_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	37.8	8.1e-13
WP_012951327.1|708064_708385_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012951328.1|708378_708744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951329.1|708746_709145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031641752.1|709165_709741_+|tail	phage major tail protein	tail	M1PRQ7	Streptococcus_phage	42.9	9.2e-33
WP_012951331.1|709830_710178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951333.1|710374_714574_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	33.0	1.2e-12
WP_012951334.1|714566_716810_+	minor structural protein GP75	NA	A0A059T682	Listeria_phage	29.4	1.6e-56
WP_031641753.1|716815_719107_+	phage minor structural protein	NA	A0A059T7Y6	Listeria_phage	38.2	8.8e-135
WP_031641433.1|719099_720161_+	hypothetical protein	NA	A8ATW1	Listeria_phage	68.6	1.6e-94
WP_003722523.1|720199_720565_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|720577_720859_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_012951337.1|720858_721704_+	peptidase M15	NA	A0A059T7Y8	Listeria_phage	93.3	4.8e-139
WP_003724378.1|722556_723228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724379.1|723257_723443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724380.1|723983_724517_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_014929420.1|724580_725498_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_021496183.1|725763_727644_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.1	8.3e-107
WP_003724383.1|727738_728467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724384.1|728606_729257_+	TalA family protein	NA	M4SLG0	Cyanophage	29.3	1.7e-14
WP_003740476.1|729299_731120_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.7	7.7e-49
WP_003727231.1|731354_732746_+	amino acid permease	NA	NA	NA	NA	NA
WP_088518281.1|732835_733675_+	VOC family protein	NA	NA	NA	NA	NA
WP_003721764.1|733757_734042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003724388.1|734139_735090_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003724389.1|735113_735755_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003731019.1|738532_739180_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003731020.1|739189_739726_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003740477.1|739712_740705_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_003721771.1|740895_741105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727224.1|741172_741880_+	serine/threonine protein phosphatase	NA	A0A249Y183	Enterococcus_phage	28.2	1.3e-20
WP_003724396.1|741925_742489_-	DUF420 domain-containing protein	NA	NA	NA	NA	NA
WP_003724397.1|742608_743025_+	hypothetical protein	NA	NA	NA	NA	NA
742853:742870	attR	AAAATGATTTAGAAGGCT	NA	NA	NA	NA
WP_009928463.1|743067_743697_+	endonuclease III domain-containing protein	NA	NA	NA	NA	NA
WP_023550362.1|743693_744590_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003724400.1|744823_745105_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP023052	Listeria monocytogenes strain FDA709873-31 chromosome, complete genome	3086245	1161007	1168430	3086245		Hokovirus(33.33%)	8	NA	NA
WP_003730941.1|1161007_1161391_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003727002.1|1161412_1162396_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_026747136.1|1162410_1163424_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003721509.1|1163632_1165123_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_088518287.1|1165134_1165959_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.2	9.7e-68
WP_009929872.1|1165971_1166280_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_009929871.1|1166340_1166745_+	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_023550418.1|1166873_1168430_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	6.0e-18
>prophage 4
NZ_CP023052	Listeria monocytogenes strain FDA709873-31 chromosome, complete genome	3086245	1315332	1372171	3086245	tRNA,protease	Bacillus_virus(16.67%)	56	NA	NA
WP_003734523.1|1315332_1316472_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1316551_1316947_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1317097_1317313_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|1317436_1317970_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|1317985_1318651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|1318912_1319851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095591254.1|1319965_1321249_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1321433_1322693_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003726393.1|1322811_1323378_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003726394.1|1323412_1323982_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003727520.1|1324083_1324626_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003726396.1|1324635_1325499_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003727519.1|1325495_1326281_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.6	6.7e-26
WP_003727518.1|1326414_1327275_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003727517.1|1327547_1329626_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	5.4e-107
WP_003726401.1|1329688_1330993_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_023550485.1|1331275_1332178_+	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	29.5	1.8e-14
WP_031641425.1|1332198_1332738_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003727514.1|1332751_1334161_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	7.5e-44
WP_003726695.1|1334181_1334961_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_023550487.1|1335063_1335483_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003724130.1|1335505_1335817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726697.1|1335819_1336692_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003726698.1|1336733_1337330_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003727511.1|1337487_1337895_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_003727510.1|1338075_1340043_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	5.1e-123
WP_010958880.1|1340039_1342499_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.8	1.1e-101
WP_003726814.1|1342581_1343049_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_023550490.1|1343676_1345485_+	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_088518289.1|1345517_1347404_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	32.2	3.8e-43
WP_026747190.1|1347616_1348315_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	32.4	2.2e-12
WP_003723738.1|1348547_1350224_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_003726658.1|1350350_1351268_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003719566.1|1351389_1351623_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_012681271.1|1351733_1352957_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003727505.1|1352949_1354176_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003719570.1|1354377_1354746_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723435.1|1354816_1356151_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_023550496.1|1356294_1357590_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	62.1	2.2e-146
WP_003734519.1|1357623_1358148_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009928625.1|1358178_1358793_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_026747189.1|1358948_1359278_+	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003727501.1|1359371_1359599_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_009928628.1|1359745_1361740_+	transketolase	NA	NA	NA	NA	NA
WP_003726667.1|1361960_1362200_+	YneF family protein	NA	NA	NA	NA	NA
WP_003726668.1|1362248_1362980_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	58.0	2.3e-81
WP_003726669.1|1363001_1363508_-	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	1.4e-56
WP_003731336.1|1363517_1364822_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	1.2e-133
WP_012681273.1|1364811_1366017_-	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	46.6	7.0e-91
WP_003727498.1|1365994_1366369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723449.1|1366661_1367390_+	UMP kinase	NA	NA	NA	NA	NA
WP_003723450.1|1367389_1367947_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003727497.1|1368177_1368936_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
WP_003727496.1|1368949_1369738_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003726414.1|1369752_1370895_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_088518290.1|1370908_1372171_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 5
NZ_CP023052	Listeria monocytogenes strain FDA709873-31 chromosome, complete genome	3086245	1731917	1779179	3086245	integrase,terminase,head,plate,holin	Listeria_phage(100.0%)	74	1731364:1731383	1779213:1779232
1731364:1731383	attL	ATCCCACAAAAATCCCACAA	NA	NA	NA	NA
WP_069002483.1|1731917_1732283_+	hypothetical protein	NA	A8ATJ4	Listeria_phage	100.0	9.6e-60
WP_015987340.1|1732296_1732500_+	hypothetical protein	NA	A8ATJ3	Listeria_phage	100.0	2.1e-32
WP_015987339.1|1732527_1732749_+	helix-turn-helix transcriptional regulator	NA	A8ATJ2	Listeria_phage	100.0	1.4e-34
WP_015987338.1|1732811_1733777_-	PlyB054	NA	A8ATJ1	Listeria_phage	100.0	1.0e-185
WP_015987337.1|1733776_1734034_-|holin	phage holin	holin	A8ATJ0	Listeria_phage	100.0	2.0e-40
WP_015987336.1|1734044_1734260_-	LysM peptidoglycan-binding domain-containing protein	NA	A8ATI9	Listeria_phage	100.0	1.1e-28
WP_015987335.1|1734278_1734725_-	hypothetical protein	NA	A8ATI8	Listeria_phage	100.0	4.0e-68
WP_015987334.1|1734700_1735147_-	hypothetical protein	NA	A8ATI7	Listeria_phage	100.0	4.4e-75
WP_015987333.1|1735333_1735675_-	hypothetical protein	NA	A8ATI5	Listeria_phage	100.0	1.5e-46
WP_015987332.1|1735680_1736409_-	hypothetical protein	NA	A8ATI4	Listeria_phage	100.0	3.5e-138
WP_010991663.1|1736429_1737071_-	hypothetical protein	NA	A8ATI3	Listeria_phage	100.0	9.1e-114
WP_088518295.1|1737060_1738212_-|plate	baseplate J/gp47 family protein	plate	A8ATI2	Listeria_phage	99.7	7.2e-210
WP_010991665.1|1738204_1738567_-	DUF2634 domain-containing protein	NA	A8ATI1	Listeria_phage	100.0	1.4e-58
WP_010991666.1|1738563_1738902_-	hypothetical protein	NA	A8ATI0	Listeria_phage	100.0	5.4e-57
WP_010991667.1|1738902_1739709_-	hypothetical protein	NA	A8ATH9	Listeria_phage	100.0	5.4e-148
WP_010991668.1|1739708_1740074_-	hypothetical protein	NA	A8ATH8	Listeria_phage	100.0	3.2e-63
WP_010991669.1|1740073_1740637_-	LysM peptidoglycan-binding domain-containing protein	NA	A8ATH7	Listeria_phage	100.0	9.2e-94
WP_015987331.1|1740642_1745358_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	100.0	0.0e+00
WP_003731526.1|1745359_1745572_-	hypothetical protein	NA	A8ATH5	Listeria_phage	100.0	3.7e-32
WP_003731525.1|1745534_1745891_-	hypothetical protein	NA	A8ATH4	Listeria_phage	100.0	1.4e-60
WP_003731524.1|1745943_1746342_-	hypothetical protein	NA	A8ATH3	Listeria_phage	100.0	4.7e-68
WP_003731523.1|1746358_1747354_-	DUF3383 family protein	NA	A8ATH2	Listeria_phage	100.0	1.9e-182
WP_003731522.1|1747358_1747847_-	hypothetical protein	NA	A8ATH1	Listeria_phage	100.0	3.2e-87
WP_003731521.1|1747836_1748211_-	hypothetical protein	NA	A8ATH0	Listeria_phage	100.0	4.6e-65
WP_003731520.1|1748210_1748810_-	hypothetical protein	NA	A8ATG9	Listeria_phage	100.0	2.6e-110
WP_003731519.1|1748809_1749145_-	DUF4054 domain-containing protein	NA	A8ATG8	Listeria_phage	100.0	2.1e-53
WP_003731518.1|1749156_1749543_-	hypothetical protein	NA	A8ATG7	Listeria_phage	97.7	1.0e-64
WP_003731517.1|1749565_1750471_-	DUF2184 domain-containing protein	NA	A8ATG6	Listeria_phage	99.0	2.1e-164
WP_003731516.1|1750491_1750941_-	hypothetical protein	NA	A8ATG5	Listeria_phage	100.0	9.0e-76
WP_003731515.1|1750940_1752050_-	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	100.0	6.5e-176
WP_003731514.1|1752098_1752269_-	hypothetical protein	NA	A8ATG3	Listeria_phage	100.0	1.1e-26
WP_003731513.1|1752265_1753675_-|head	phage head morphogenesis protein	head	A8ATG2	Listeria_phage	100.0	7.8e-267
WP_003731512.1|1753667_1755053_-	DUF1073 domain-containing protein	NA	A8ATG1	Listeria_phage	100.0	1.1e-265
WP_003731511.1|1755066_1756527_-|terminase	phage terminase large subunit	terminase	A8ATG0	Listeria_phage	100.0	4.4e-289
WP_003731510.1|1756504_1757389_-	hypothetical protein	NA	A8ATF9	Listeria_phage	99.3	6.6e-139
WP_010990878.1|1757434_1757659_-	hypothetical protein	NA	A8ATN8	Listeria_phage	100.0	2.7e-36
WP_010991671.1|1757686_1757917_-	hypothetical protein	NA	A8ATN7	Listeria_phage	100.0	9.7e-34
WP_003731507.1|1758047_1758245_-	hypothetical protein	NA	A8ATN6	Listeria_phage	100.0	5.2e-28
WP_015987349.1|1758292_1759630_-	ParB N-terminal domain-containing protein	NA	A8ATN5	Listeria_phage	100.0	9.7e-259
WP_003731505.1|1759626_1759920_-	hypothetical protein	NA	A8ATN4	Listeria_phage	100.0	2.3e-48
WP_003731503.1|1760447_1761215_-	hypothetical protein	NA	A8ATN0	Listeria_phage	100.0	1.6e-141
WP_003731502.1|1761227_1761650_-	hypothetical protein	NA	A8ATM9	Listeria_phage	100.0	6.3e-71
WP_088518296.1|1761730_1762291_-	hypothetical protein	NA	A8ATM8	Listeria_phage	96.2	5.4e-102
WP_003731500.1|1762302_1762554_-	DUF3850 domain-containing protein	NA	A8ATM7	Listeria_phage	95.2	9.9e-40
WP_003731499.1|1762550_1762703_-	hypothetical protein	NA	A8ATM6	Listeria_phage	100.0	8.1e-21
WP_003731498.1|1762903_1763239_-	hypothetical protein	NA	A8ATZ5	Listeria_phage	93.1	4.6e-08
WP_003731497.1|1763238_1763427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731496.1|1763445_1763829_-	preprotein translocase subunit YajC	NA	A8ATZ3	Listeria_phage	88.2	2.4e-53
WP_003731495.1|1763932_1764148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731493.1|1764350_1764875_-	hypothetical protein	NA	A8ASP1	Listeria_phage	47.8	1.1e-32
WP_003731492.1|1764891_1766253_-	hypothetical protein	NA	A8ATM0	Listeria_phage	96.5	2.5e-254
WP_003731491.1|1766249_1766672_-	hypothetical protein	NA	A8ATL9	Listeria_phage	100.0	1.2e-53
WP_003731490.1|1766683_1766860_-	hypothetical protein	NA	A8ATL8	Listeria_phage	100.0	2.0e-23
WP_003731489.1|1766819_1767200_-	hypothetical protein	NA	A8ATL7	Listeria_phage	100.0	3.1e-69
WP_003731488.1|1767240_1767861_-	hypothetical protein	NA	A8ATL6	Listeria_phage	100.0	1.1e-108
WP_003731487.1|1767881_1768319_-	RusA family crossover junction endodeoxyribonuclease	NA	A8ATL5	Listeria_phage	100.0	1.6e-77
WP_003731486.1|1768299_1768509_-	hypothetical protein	NA	A8ATL4	Listeria_phage	100.0	8.2e-32
WP_003731485.1|1768509_1768716_-	hypothetical protein	NA	A8ATL3	Listeria_phage	100.0	5.6e-33
WP_003731483.1|1768893_1769709_-	ATP-binding protein	NA	A8ATL1	Listeria_phage	100.0	4.8e-144
WP_003731482.1|1769632_1770550_-	DUF4373 domain-containing protein	NA	A8ATL0	Listeria_phage	100.0	2.2e-169
WP_003731481.1|1770561_1771299_-	MBL fold metallo-hydrolase	NA	A8ATK9	Listeria_phage	100.0	1.7e-135
WP_003731480.1|1771258_1772044_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	100.0	7.9e-144
WP_015987342.1|1772044_1773988_-	AAA family ATPase	NA	A8ATK7	Listeria_phage	100.0	0.0e+00
WP_095591257.1|1773974_1774316_-	hypothetical protein	NA	A8ATK6	Listeria_phage	99.1	1.0e-55
WP_003731477.1|1774333_1774561_-	hypothetical protein	NA	A8ATK5	Listeria_phage	100.0	1.8e-32
WP_003731476.1|1774738_1775029_-	hypothetical protein	NA	A8ATK4	Listeria_phage	100.0	4.6e-49
WP_049872582.1|1775178_1775373_-	hypothetical protein	NA	A8ATK3	Listeria_phage	100.0	9.4e-22
WP_003731474.1|1775347_1775641_-	helix-turn-helix domain-containing protein	NA	A8ATK2	Listeria_phage	100.0	2.3e-48
WP_003731473.1|1775655_1776180_-	hypothetical protein	NA	A8ATK1	Listeria_phage	100.0	5.5e-93
WP_003731472.1|1776256_1776442_-	helix-turn-helix transcriptional regulator	NA	A8ATK0	Listeria_phage	100.0	1.2e-29
WP_003731471.1|1776602_1777031_+	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	100.0	4.0e-73
WP_003731470.1|1777047_1777467_+	ImmA/IrrE family metallo-endopeptidase	NA	A8ATJ8	Listeria_phage	100.0	4.0e-78
WP_003731469.1|1777514_1777907_+	hypothetical protein	NA	A8ATJ7	Listeria_phage	100.0	2.3e-59
WP_003731468.1|1778003_1779179_+|integrase	site-specific integrase	integrase	A8ATJ6	Listeria_phage	100.0	6.2e-225
1779213:1779232	attR	ATCCCACAAAAATCCCACAA	NA	NA	NA	NA
>prophage 6
NZ_CP023052	Listeria monocytogenes strain FDA709873-31 chromosome, complete genome	3086245	1852265	1885131	3086245	tail,protease,terminase,portal,capsid,head,holin	Erysipelothrix_phage(67.74%)	39	NA	NA
WP_014929970.1|1852265_1853180_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D8ETE4	Propionibacterium_phage	44.0	3.9e-33
WP_025186379.1|1853169_1853583_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	57.0	1.5e-37
WP_003731143.1|1853631_1854051_-	DUF1617 family protein	NA	A0A1S5RCP5	Lactobacillus_phage	26.5	2.4e-06
WP_003731142.1|1854037_1854199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731141.1|1854211_1858276_-	hypothetical protein	NA	A0A1B1P770	Bacillus_phage	41.8	8.7e-85
WP_003731140.1|1858260_1858953_-	hypothetical protein	NA	A0A1L2BYA2	Clostridium_phage	29.0	1.7e-20
WP_003731139.1|1858968_1861530_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	74.1	3.9e-83
WP_003731138.1|1861597_1862242_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_003731137.1|1862493_1862877_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	64.2	5.4e-37
WP_003731136.1|1862886_1863477_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	72.2	4.1e-76
WP_029645088.1|1863478_1863787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731135.1|1863813_1864245_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	59.4	7.6e-40
WP_003731134.1|1864237_1864576_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	54.7	1.7e-23
WP_003731133.1|1864572_1864884_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	74.0	2.2e-36
WP_003731132.1|1864894_1866112_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	48.0	1.1e-102
WP_095591263.1|1866115_1866868_-|protease	Clp protease ClpP	protease	M1PLE5	Streptococcus_phage	55.7	1.9e-62
WP_014929974.1|1866764_1868126_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	74.0	2.7e-179
WP_100066221.1|1868193_1868454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088518322.1|1868585_1870178_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	84.8	7.2e-269
WP_003731127.1|1870238_1870463_-	hypothetical protein	NA	A0A2K5B284	Erysipelothrix_phage	48.6	2.0e-15
WP_023559365.1|1870452_1870641_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_003731125.1|1870624_1870819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731124.1|1870821_1871211_-	DUF4314 domain-containing protein	NA	E4ZFL7	Streptococcus_phage	71.0	3.1e-16
WP_003731123.1|1871299_1872550_-	site-specific DNA-methyltransferase	NA	A0A2I4R670	Erysipelothrix_phage	62.0	7.4e-144
WP_100066220.1|1872539_1872917_-	hypothetical protein	NA	A0A0B5HE03	Vibrio_phage	38.8	4.5e-12
WP_014929977.1|1873141_1873924_-	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_031641527.1|1873928_1874507_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	52.8	1.2e-53
WP_031641526.1|1874639_1875005_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	56.9	1.4e-31
WP_003731117.1|1875172_1875601_-	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	45.8	1.5e-27
WP_014929979.1|1875597_1876950_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	69.0	6.8e-159
WP_003731115.1|1876949_1877234_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	60.2	3.5e-25
WP_003731114.1|1877230_1877440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731113.1|1877577_1879821_-	hypothetical protein	NA	A0A1B0RXC5	Streptococcus_phage	49.7	4.8e-210
WP_014929980.1|1879813_1880158_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	51.4	4.1e-28
WP_014929981.1|1880150_1880921_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	50.8	2.7e-64
WP_003731110.1|1881131_1883069_-	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	68.6	7.7e-265
WP_003731109.1|1883129_1883672_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	77.2	8.9e-78
WP_003731108.1|1883673_1884816_-	DUF2800 domain-containing protein	NA	M1Q218	Streptococcus_phage	57.8	1.5e-122
WP_010821424.1|1884816_1885131_-	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	41.5	6.6e-09
>prophage 7
NZ_CP023052	Listeria monocytogenes strain FDA709873-31 chromosome, complete genome	3086245	1966208	1974494	3086245		Synechococcus_phage(33.33%)	8	NA	NA
WP_003726209.1|1966208_1966775_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
WP_003726210.1|1966771_1967821_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|1967839_1969267_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_009918191.1|1969251_1971471_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_003726212.1|1971463_1972147_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1972150_1972396_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003726214.1|1972407_1973121_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.0e-40
WP_003729814.1|1973201_1974494_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 8
NZ_CP023052	Listeria monocytogenes strain FDA709873-31 chromosome, complete genome	3086245	2501655	2543213	3086245	integrase,tail,terminase,portal,capsid,plate,holin	Listeria_phage(93.75%)	67	2498752:2498767	2535812:2535827
2498752:2498767	attL	TGCAAAAATCACTTTC	NA	NA	NA	NA
WP_012951563.1|2501655_2501889_-	hypothetical protein	NA	A8ATC5	Listeria_phage	98.7	1.6e-36
WP_023548524.1|2502286_2502454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031641270.1|2502718_2503564_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	94.7	1.6e-137
WP_003722522.1|2503563_2503845_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003727799.1|2503857_2504223_-	hypothetical protein	NA	A8ASL3	Listeria_phage	97.9	1.7e-11
WP_003722524.1|2504250_2504409_-	hypothetical protein	NA	Q9T1A1	Listeria_phage	100.0	6.0e-19
WP_003731746.1|2504413_2504731_-	hypothetical protein	NA	Q9T1A2	Listeria_phage	92.4	1.7e-49
WP_088518304.1|2504742_2505816_-|plate	phage baseplate upper protein	plate	Q9T1A3	Listeria_phage	90.5	1.1e-180
WP_014931687.1|2505815_2506844_-	hypothetical protein	NA	Q9T1A4	Listeria_phage	98.8	2.1e-189
WP_031645706.1|2506844_2507870_-	phage minor structural protein	NA	Q9T1A5	Listeria_phage	93.3	3.9e-191
WP_031645707.1|2507878_2508697_-|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	93.4	3.8e-149
WP_088518305.1|2508698_2514083_-	tape measure protein	NA	Q9T1A7	Listeria_phage	97.8	0.0e+00
WP_003722531.1|2514093_2514699_-	hypothetical protein	NA	Q9T1A8	Listeria_phage	100.0	1.3e-109
WP_003727791.1|2514704_2515127_-|tail	phage tail assembly chaperone	tail	Q9T1A9	Listeria_phage	100.0	4.1e-70
WP_003727790.1|2515181_2515514_-	hypothetical protein	NA	Q9T1B0	Listeria_phage	99.1	1.8e-49
WP_009925981.1|2515443_2515878_-|tail	tail protein	tail	Q9T1B1	Listeria_phage	97.9	3.0e-76
WP_003737937.1|2515880_2516288_-	hypothetical protein	NA	A8ASK1	Listeria_phage	99.3	2.0e-66
WP_029508830.1|2516287_2516626_-	hypothetical protein	NA	A0A0B5CTV8	Listeria_phage	95.5	5.4e-57
WP_055310957.1|2516625_2516988_-	hypothetical protein	NA	A0A059T658	Listeria_phage	95.0	1.5e-60
WP_009925044.1|2516987_2517383_-	hypothetical protein	NA	A0A059T5E3	Listeria_phage	82.4	2.2e-54
WP_009925045.1|2517384_2517543_-	hypothetical protein	NA	A8ASJ7	Listeria_phage	92.3	9.6e-17
WP_088518306.1|2517542_2518442_-|capsid	phage major capsid protein	capsid	Q9T1B7	Listeria_phage	99.3	5.0e-166
WP_009925047.1|2518465_2519035_-	scaffold protein	NA	A0A0B5CTV7	Listeria_phage	97.9	1.2e-80
WP_039381673.1|2519113_2520253_-	hypothetical protein	NA	A8ASJ4	Listeria_phage	96.0	1.3e-200
WP_060577779.1|2520253_2522023_-|portal	phage portal protein	portal	A8ASJ3	Listeria_phage	91.2	7.8e-264
WP_031645718.1|2522035_2523367_-|terminase	PBSX family phage terminase large subunit	terminase	A8ASJ2	Listeria_phage	98.9	3.5e-261
WP_031645719.1|2523335_2523878_-|terminase	terminase small subunit	terminase	A8ASJ1	Listeria_phage	98.3	1.2e-90
WP_010990212.1|2523935_2524199_-	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	78.2	1.7e-34
WP_009911405.1|2524225_2524525_-	phage protein	NA	A0A2H4JBC0	uncultured_Caudovirales_phage	40.7	3.8e-14
WP_003735131.1|2524919_2525354_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	99.3	4.3e-75
WP_046377523.1|2525498_2525903_-	endodeoxyribonuclease	NA	A8AU00	Listeria_phage	99.3	2.1e-71
WP_014601286.1|2525868_2526009_-	BH0509 family protein	NA	A8ATZ9	Listeria_phage	100.0	2.6e-18
WP_088518307.1|2526005_2526311_-	response regulator	NA	A8ATZ8	Listeria_phage	92.1	3.4e-42
WP_088518308.1|2526342_2526825_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	92.5	1.0e-77
WP_088518309.1|2526821_2527067_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	90.7	1.5e-32
WP_088518310.1|2527059_2527395_-	hypothetical protein	NA	A8ATZ5	Listeria_phage	89.7	2.1e-08
WP_085400849.1|2527394_2527583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003727764.1|2527579_2527765_-	hypothetical protein	NA	A0A059T5G1	Listeria_phage	100.0	4.1e-27
WP_003725081.1|2527761_2527950_-	SAM--benzoic acid carboxyl methyltransferase	NA	D7RWG4	Brochothrix_phage	49.1	4.4e-08
WP_088518311.1|2527953_2528472_-	hypothetical protein	NA	A8ASP1	Listeria_phage	52.6	9.8e-34
WP_023548475.1|2528468_2528837_-	hypothetical protein	NA	Q8W5X1	Listeria_phage	87.7	1.1e-55
WP_023548473.1|2528833_2529013_-	hypothetical protein	NA	A0A059T5G0	Listeria_phage	93.2	6.0e-23
WP_023548471.1|2529009_2529690_-	hypothetical protein	NA	A8ATD7	Listeria_phage	97.8	3.3e-122
WP_023548469.1|2529702_2530647_-|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	98.4	1.7e-177
WP_023548467.1|2530657_2531371_-	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	96.6	7.2e-128
WP_088518312.1|2531367_2532300_-	DnaD domain-containing protein	NA	A8ATY7	Listeria_phage	98.1	9.7e-165
WP_079441179.1|2532319_2533135_-	recombinase RecT	NA	A8ATY6	Listeria_phage	98.5	1.0e-149
WP_077915324.1|2533137_2534097_-	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	99.4	2.7e-178
WP_003733629.1|2534332_2534521_-	hypothetical protein	NA	Q9T175	Listeria_phage	80.6	1.2e-21
WP_003733630.1|2534628_2534844_-	hypothetical protein	NA	Q9T176	Listeria_phage	67.6	9.7e-20
WP_003733631.1|2534840_2535374_-	hypothetical protein	NA	Q9T177	Listeria_phage	87.6	5.5e-80
WP_088518313.1|2535496_2536276_-	phage antirepressor Ant	NA	A0A059T6E7	Listeria_phage	96.5	3.4e-139
2535812:2535827	attR	TGCAAAAATCACTTTC	NA	NA	NA	NA
WP_088518314.1|2536339_2536570_+	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	97.4	2.0e-34
WP_003727748.1|2536574_2536736_-	hypothetical protein	NA	A0A059T7X7	Listeria_phage	98.1	1.2e-19
WP_003769995.1|2536767_2537049_-	hypothetical protein	NA	Q9T180	Listeria_phage	96.8	1.4e-39
WP_003733634.1|2537045_2537282_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	100.0	3.3e-37
WP_003769996.1|2537321_2537606_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	98.9	1.6e-46
WP_003735007.1|2537617_2537812_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	100.0	1.3e-26
WP_003731220.1|2537815_2538067_-	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	100.0	7.6e-40
WP_009911345.1|2538215_2538524_+	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	98.0	7.8e-47
WP_009911346.1|2538554_2539046_+	bacteriophage gp35-type protein	NA	A8ATX4	Listeria_phage	98.8	1.1e-90
WP_025370648.1|2539068_2539287_+	zinc-ribbon domain-containing protein	NA	A0A059T6E3	Listeria_phage	97.2	1.3e-32
WP_003770013.1|2539302_2540025_+	hypothetical protein	NA	A0A059T7P9	Listeria_phage	84.6	7.4e-88
WP_003770015.1|2540046_2540922_+	hypothetical protein	NA	A0A0B5D0D1	Listeria_phage	94.5	2.2e-150
WP_009911646.1|2540985_2542344_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	97.1	2.0e-251
WP_031641942.1|2542334_2542811_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|2542865_2543213_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 9
NZ_CP023052	Listeria monocytogenes strain FDA709873-31 chromosome, complete genome	3086245	2687535	2695377	3086245		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|2687535_2688507_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003731212.1|2688514_2689483_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|2689484_2690360_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003725409.1|2690467_2692198_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	9.5e-174
WP_077915067.1|2692239_2693301_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009918601.1|2693317_2694301_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	3.1e-52
WP_003722610.1|2694417_2695377_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 1
NZ_CP023053	Listeria monocytogenes strain FDA709873-31 plasmid pCFSAN021143, complete sequence	61919	2165	54987	61919	transposase,protease	Streptococcus_phage(22.73%)	51	NA	NA
WP_002389568.1|2165_2846_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	90.7	2.6e-119
WP_003728481.1|3469_4834_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.5	1.9e-07
WP_003728480.1|5079_5949_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003750113.1|6308_6629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728477.1|6819_7584_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003728476.1|8046_9930_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	5.6e-87
WP_043993356.1|10049_10691_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.0e-101
WP_003728474.1|11175_13029_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003728473.1|13021_14233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728472.1|14483_15047_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	2.0e-40
WP_031644250.1|15620_15986_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_031641532.1|16006_17305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003725288.1|17704_18061_-	glyoxalase	NA	NA	NA	NA	NA
WP_009917198.1|18986_19331_-	quaternary ammonium compound efflux SMR transporter BcrC	NA	NA	NA	NA	NA
WP_003725293.1|19348_19666_-	quaternary ammonium compound efflux SMR transporter BcrB	NA	NA	NA	NA	NA
WP_003725294.1|19677_20217_-	efflux transporter transcriptional regulator BcrA	NA	NA	NA	NA	NA
WP_031644247.1|20657_20897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728469.1|22970_25886_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.7	1.9e-174
WP_003728468.1|25889_26444_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	53.4	7.0e-38
WP_003728467.1|26723_27083_+	Cd(II)-sensing metalloregulatory transcriptional repressor CadC	NA	E4ZFI8	Streptococcus_phage	50.0	3.1e-26
WP_003728466.1|27082_29218_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	64.5	1.6e-247
WP_003728465.1|29410_29752_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003728464.1|29745_29988_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003728463.1|30048_30300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728462.1|30430_30757_+	hypothetical protein	NA	A0A2K9V3N4	Faecalibacterium_phage	40.8	3.2e-06
WP_003731676.1|30756_31419_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_003769263.1|31437_31815_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	55.1	2.2e-14
WP_023553717.1|32213_32462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728519.1|32583_32832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728518.1|32832_33258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728517.1|33261_33984_+	CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_003731678.1|33999_34716_+	AP2 domain-containing protein	NA	O03945	Lactobacillus_phage	31.0	3.8e-20
WP_003728514.1|35688_35943_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	46.4	1.6e-13
WP_003728513.1|36466_38233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728512.1|38244_38985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728511.1|39272_39881_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.9	1.0e-21
WP_003728510.1|39870_40098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731679.1|40217_40496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728509.1|40458_40695_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	53.4	6.7e-14
WP_003728507.1|41122_43237_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.1	3.4e-117
WP_013315188.1|43512_44853_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	38.6	1.1e-31
WP_003728505.1|45027_45762_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003728504.1|45966_46311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728503.1|46298_47579_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.9	5.2e-92
WP_003728502.1|47629_47926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003728501.1|47903_48878_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.0	2.4e-33
WP_003728500.1|49617_51252_+	plasmid replication protein	NA	NA	NA	NA	NA
WP_003728499.1|51526_52282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023553716.1|52315_52903_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.7	2.5e-33
WP_003755398.1|52994_53792_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	63.2	3.3e-81
WP_003728496.1|53760_54987_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	60.6	4.7e-135
