The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014856	Escherichia albertii strain CB9786	4598983	241780	319948	4598983	plate,head,capsid,terminase,tail,transposase,integrase,lysis,holin,portal,protease	Shigella_phage(44.26%)	98	267063:267084	320092:320113
WP_124866374.1|241780_242946_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.7	3.7e-73
WP_059275978.1|243798_244395_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_095575501.1|244975_245746_-	amidohydrolase	NA	NA	NA	NA	NA
WP_002430282.1|245924_246371_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_095575502.1|246412_248857_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|249096_249675_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_025237577.1|249879_250647_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225662.1|250617_251358_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_095575503.1|251670_252420_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_095573642.1|252596_253094_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_059222204.1|253209_254949_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_072243690.1|254893_255661_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_059217800.1|255790_256846_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|256897_257191_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|257193_257592_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_095575504.1|257601_258054_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072249376.1|258066_258666_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_059222190.1|258806_259049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001292996.1|259107_260565_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291989.1|260825_261284_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_059222189.1|261376_262621_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174680.1|262678_263080_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749853.1|263179_264235_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	4.2e-116
WP_025237534.1|264522_265626_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	1.1e-61
WP_059222188.1|265637_266891_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	1.2e-96
267063:267084	attL	ACTCCTATTATCGGCACCATTT	NA	NA	NA	NA
WP_000051887.1|267095_268259_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206811.1|268485_268791_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_095575505.1|268790_269153_-	hypothetical protein	NA	U5P092	Shigella_phage	96.7	4.4e-65
WP_042962713.1|269143_269680_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	2.4e-99
WP_000081287.1|269808_270633_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|270698_271061_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000016389.1|271529_271964_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549626.1|271935_272142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450735.1|272389_273016_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|273113_273314_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|273351_273903_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_001250269.1|274078_274258_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104953.1|274247_275189_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	5.6e-144
WP_094304485.1|275185_275680_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	3.6e-86
WP_095575506.1|275679_276333_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_000210154.1|276329_276656_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767113.1|276652_277042_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_023145982.1|277061_277871_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	5.3e-151
WP_024244661.1|277878_278868_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	4.4e-192
WP_001205457.1|278886_279231_+	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	7.2e-57
WP_000069423.1|279256_279871_-	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	36.4	9.9e-33
WP_143370799.1|279874_280219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001524096.1|280234_280984_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_001120496.1|281384_281711_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001197760.1|281714_282191_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	2.5e-84
WP_001228695.1|282407_282590_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|282680_282974_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_095575507.1|283499_283850_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	3.4e-62
WP_000929175.1|283975_284470_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_148723663.1|284703_286200_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	4.8e-299
WP_000605613.1|286211_286394_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	96.7	1.1e-24
WP_095575508.1|286393_287635_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.7e-241
WP_001193631.1|287612_288263_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_021575899.1|288277_289483_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.8	3.1e-224
WP_000601360.1|289532_289733_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_023568528.1|289735_290059_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	2.6e-56
WP_023147732.1|290055_290466_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	2.1e-71
WP_000213503.1|290440_290947_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_023568527.1|290943_291504_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	3.0e-105
WP_000497751.1|291512_291683_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_016244983.1|291666_293163_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.4	5.4e-274
WP_000090998.1|293162_293519_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661054.1|293518_293788_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_023568526.1|293929_295765_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.5	5.9e-307
WP_157730575.1|295825_297154_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	97.7	1.1e-243
WP_000999527.1|297150_298230_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	6.9e-207
WP_042106194.1|298229_298778_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	8.7e-97
WP_042004576.1|298777_299203_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_016244979.1|299189_300248_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	99.1	2.1e-200
WP_073357865.1|300238_300823_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.4e-113
WP_095575510.1|300826_301567_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	92.2	1.2e-77
WP_072794540.1|301566_302169_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	1.1e-97
WP_089618265.1|302140_302584_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.6	7.3e-46
WP_089618264.1|302585_302981_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	37.5	1.2e-12
WP_095575511.1|303007_303562_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.0	5.7e-88
WP_000355479.1|303619_304393_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	3.2e-36
WP_001333214.1|304897_305317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095575512.1|305632_307099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788777.1|308144_308303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095575513.1|308731_309271_-	recombinase family protein	NA	Q2A092	Sodalis_phage	43.8	1.4e-27
WP_172843344.1|311405_311582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005469.1|311604_311775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095575515.1|311828_312557_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_075826105.1|312568_312847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016159682.1|312979_313390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088213470.1|313391_313730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021560779.1|314079_314292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001570993.1|314288_314651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095575516.1|314669_315698_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000452041.1|315784_315988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088213467.1|316002_317841_+	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.8	2.5e-31
WP_095575517.1|317875_318589_+	hypothetical protein	NA	I7I023	Enterobacteria_phage	49.3	2.5e-48
WP_172843345.1|318670_319948_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
320092:320113	attR	ACTCCTATTATCGGCACCATTT	NA	NA	NA	NA
>prophage 2
NZ_AP014856	Escherichia albertii strain CB9786	4598983	865973	899642	4598983	plate,head,capsid,terminase,tail,integrase,lysis,portal	Salmonella_phage(84.44%)	47	864567:864591	899709:899733
864567:864591	attL	AAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_095575598.1|865973_867023_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	7.7e-102
WP_000900884.1|867209_867401_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	70.5	2.4e-09
WP_033813112.1|867416_867986_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247707.1|868111_868333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460891.1|868365_868875_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001504054.1|868882_869083_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	95.5	4.6e-32
WP_095575599.1|869046_869388_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.0e-55
WP_001244209.1|869455_869689_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	2.4e-32
WP_095575600.1|869688_869916_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	1.0e-35
WP_095575601.1|869912_870770_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	3.9e-160
WP_001154431.1|873333_873522_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|873532_873766_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001059831.1|873958_874294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095575602.1|874803_875799_+	hypothetical protein	NA	A0A1S6KZY1	Salmonella_phage	91.2	7.1e-182
WP_095575603.1|875855_876410_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	87.0	2.2e-87
WP_149479001.1|876529_876826_-	hypothetical protein	NA	A0A1S6KZY3	Salmonella_phage	86.0	9.6e-34
WP_095575605.1|876883_877912_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	92.6	6.4e-178
WP_095575606.1|877911_879678_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_095575607.1|879820_880654_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	3.7e-123
WP_095575608.1|880670_881729_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_000059191.1|881732_882383_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673530.1|882478_882943_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000868169.1|882942_883146_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
WP_000171568.1|883149_883365_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_172843346.1|883345_883858_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	2.0e-87
WP_000730946.1|883859_884237_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.4e-16
WP_095575609.1|884233_884662_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	74.5	7.1e-46
WP_001039945.1|884757_885189_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_095575610.1|885181_885631_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	91.9	1.8e-68
WP_095575611.1|885645_886581_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	92.3	5.3e-171
WP_095575612.1|886666_887245_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	84.9	1.0e-92
WP_000177574.1|887241_887601_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	4.2e-52
WP_095575613.1|887587_888496_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	3.5e-143
WP_001086833.1|888488_889094_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_095575614.1|889090_890512_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	65.3	1.9e-167
WP_001682747.1|890532_890976_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	97.3	1.3e-79
WP_000639074.1|890947_891343_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_032144129.1|891351_891756_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	43.1	5.5e-16
WP_016237350.1|891786_892353_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	8.4e-87
WP_001682750.1|892495_893668_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.7	5.1e-203
WP_001207660.1|893677_894193_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001682751.1|894247_894550_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.2e-39
WP_024194071.1|894564_894684_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	1.8e-12
WP_095575615.1|894676_897754_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.3	0.0e+00
WP_000980413.1|897750_898236_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_095575616.1|898232_899333_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	7.6e-177
WP_000972391.1|899423_899642_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
899709:899733	attR	AAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 3
NZ_AP014856	Escherichia albertii strain CB9786	4598983	934595	994005	4598983	plate,protease,head,capsid,terminase,tail,integrase,lysis,holin,portal,tRNA	Escherichia_phage(57.69%)	61	943415:943431	985599:985615
WP_000520793.1|934595_934916_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.6	5.3e-14
WP_025237287.1|934946_937223_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	3.3e-166
WP_001040187.1|938132_938351_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_059219856.1|938635_939340_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_095575619.1|939384_941106_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_059268048.1|941106_942873_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537396.1|942993_943959_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	7.2e-62
943415:943431	attL	CGGAAACCGTCGCGGCG	NA	NA	NA	NA
WP_000228473.1|944503_944998_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_095575620.1|945132_949011_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.4	1.5e-86
WP_002462419.1|949169_949781_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_059219851.1|949791_951135_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.3	1.1e-79
WP_000886690.1|951225_952518_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.5	3.9e-95
WP_059267994.1|952756_955201_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	3.5e-222
WP_000213098.1|955211_955829_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534713.1|955830_956694_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165868.1|956729_957356_-	hydrolase	NA	NA	NA	NA	NA
WP_025237281.1|957672_958821_+	MFS transporter	NA	NA	NA	NA	NA
WP_059219845.1|959030_960464_+	amino acid permease	NA	NA	NA	NA	NA
WP_095575621.1|960671_961469_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	2.3e-21
WP_000023390.1|961500_962496_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_001389238.1|962589_962889_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_001389237.1|962997_963354_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_000217682.1|963531_964032_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_000557703.1|964095_964320_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277949.1|964319_964622_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	95.0	4.2e-45
WP_001113270.1|964621_964846_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027662.1|964842_965118_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	100.0	3.8e-45
WP_095575622.1|965107_967384_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.3	0.0e+00
WP_095575623.1|967493_968825_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_086186067.1|968916_969336_+	hypothetical protein	NA	Q6K1E9	Salmonella_virus	71.2	5.0e-52
WP_000038194.1|969652_970687_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	1.2e-200
WP_000156847.1|970686_972459_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_001085948.1|972632_973487_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_095575624.1|973545_974619_+|capsid	phage major capsid protein, P2 family	capsid	U5N3E4	Enterobacteria_phage	99.7	1.9e-201
WP_001593490.1|974622_975366_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	99.2	3.5e-125
WP_000988633.1|975465_975975_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|975974_976178_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|976181_976463_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|976462_976960_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_039022207.1|976974_977400_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	95.0	9.5e-59
WP_001564788.1|977387_977813_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	4.7e-66
WP_000917188.1|977920_978388_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_001001786.1|978380_978833_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_064506788.1|978899_979535_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.2e-112
WP_001695636.1|979531_979879_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	2.9e-58
WP_021525816.1|979883_980792_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	5.7e-162
WP_001285341.1|980784_981396_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.9e-117
WP_095575625.1|981392_982712_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.2	2.7e-181
WP_095575626.1|982711_983314_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	7.3e-97
WP_074468294.1|983285_983729_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	71.4	3.2e-57
WP_062895573.1|983730_984117_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	70.0	2.1e-09
WP_000905093.1|984147_984741_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_063270303.1|984800_985991_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
985599:985615	attR	CGCCGCGACGGTTTCCG	NA	NA	NA	NA
WP_001251408.1|986003_986522_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_095575627.1|986578_986854_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	1.3e-40
WP_000785970.1|986886_987006_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_095575628.1|986998_989446_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_000978885.1|989460_989940_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_095575629.1|989939_991103_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	98.7	7.7e-204
WP_000468308.1|991184_991403_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292823.1|991722_994005_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 4
NZ_AP014856	Escherichia albertii strain CB9786	4598983	1026558	1106442	4598983	tRNA,head,capsid,terminase,tail,transposase,integrase,holin,portal,protease	Escherichia_phage(38.64%)	86	1059554:1059613	1101690:1101754
WP_000117893.1|1026558_1027959_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.3	3.1e-82
WP_095573812.1|1028127_1029330_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_059227727.1|1029595_1032208_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.7	3.5e-18
WP_002462366.1|1032620_1033631_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220656.1|1033804_1034347_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_095575634.1|1034343_1035453_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_059219822.1|1035696_1037805_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_059239030.1|1037816_1039724_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.4	9.2e-53
WP_000333197.1|1039924_1041178_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_025237261.1|1041182_1042823_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759093.1|1042819_1043383_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000828648.1|1043639_1043807_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002462364.1|1043875_1044394_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_095575635.1|1044462_1046223_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_059219816.1|1046408_1046861_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_024164823.1|1046935_1047988_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288703.1|1048343_1048853_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_059219814.1|1049070_1049700_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_072248637.1|1049659_1051825_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261228.1|1051834_1052281_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_095575636.1|1052403_1054458_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.3e-20
WP_000424182.1|1054489_1054948_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847777.1|1055043_1055706_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002462360.1|1055878_1056292_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1056336_1056654_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116313.1|1056711_1057902_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048219.1|1057995_1058274_+	acylphosphatase	NA	NA	NA	NA	NA
WP_024164819.1|1058270_1058600_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1058691_1059351_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1059554:1059613	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_001372523.1|1059759_1060779_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	9.8e-86
WP_059278349.1|1060747_1060999_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_095575637.1|1061065_1063546_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	64.1	2.2e-62
WP_001090221.1|1063638_1063830_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449200.1|1063826_1064015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123057874.1|1064412_1064559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024227554.1|1064544_1064919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059278976.1|1064930_1065083_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000381213.1|1065251_1065659_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	1.2e-31
WP_000921592.1|1065739_1065967_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_095575638.1|1065950_1066472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123057873.1|1066452_1067418_+	hypothetical protein	NA	U5P0A0	Shigella_phage	64.8	1.5e-59
WP_059278970.1|1067458_1067881_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	5.0e-60
WP_059268374.1|1068018_1068291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095575640.1|1069339_1070413_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
WP_000813259.1|1070484_1070640_+	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	96.1	5.5e-17
WP_059259921.1|1070915_1071176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095575641.1|1071242_1071521_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_095575642.1|1071522_1072578_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.7	2.6e-89
WP_095575643.1|1072578_1072944_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	9.3e-39
WP_095575644.1|1072940_1073630_+	antiterminator	NA	I6PDF8	Cronobacter_phage	47.6	2.5e-56
WP_095576268.1|1073762_1074623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095575645.1|1074789_1075176_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	91.4	1.2e-55
WP_073978423.1|1075162_1075444_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	47.8	4.1e-18
WP_095575646.1|1075443_1076058_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	8.0e-91
WP_023155120.1|1076065_1076335_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.5	1.6e-19
WP_023155123.1|1076745_1077285_-	YfbU family protein	NA	NA	NA	NA	NA
WP_095575647.1|1077423_1077774_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	3.6e-64
WP_095575648.1|1077922_1078405_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	2.5e-84
WP_095575649.1|1078404_1080162_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.1	0.0e+00
WP_000478567.1|1080173_1080356_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_000466255.1|1080355_1081597_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193631.1|1081574_1082225_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_095575650.1|1082239_1083445_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.0	1.7e-222
WP_000601355.1|1083494_1083683_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_095575651.1|1083694_1084000_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	80.2	7.8e-39
WP_095575652.1|1084008_1084347_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	96.4	2.5e-54
WP_095575653.1|1084343_1084793_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	79.9	4.3e-62
WP_047627858.1|1084789_1085134_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	99.1	1.6e-56
WP_095575654.1|1085194_1085899_+	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	96.2	3.0e-118
WP_095575655.1|1085913_1086285_+|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	96.7	1.0e-61
WP_171002985.1|1086308_1086587_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.9	2.8e-43
WP_095575656.1|1086633_1089861_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	94.3	0.0e+00
WP_001114907.1|1089853_1090195_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	1.2e-40
WP_095575657.1|1090194_1090893_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	7.6e-130
WP_095575658.1|1090897_1091641_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	8.6e-148
WP_095575659.1|1091538_1092186_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	92.6	1.4e-106
WP_095575660.1|1092246_1095660_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.7	0.0e+00
WP_095575661.1|1095721_1097035_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	95.7	3.4e-75
WP_095575662.1|1097036_1097306_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	1.6e-43
WP_095576270.1|1097417_1098044_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.7	1.7e-40
WP_095575663.1|1098270_1099755_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_095575664.1|1099941_1100892_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_059219811.1|1102223_1103342_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1101690:1101754	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_059219810.1|1103338_1105132_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_095573817.1|1105150_1105858_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_095575665.1|1105854_1106442_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_AP014856	Escherichia albertii strain CB9786	4598983	1442820	1451351	4598983	tRNA	Enterobacteria_phage(50.0%)	8	NA	NA
WP_059268187.1|1442820_1444194_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	1.1e-50
WP_059228647.1|1444296_1445232_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.2	2.4e-147
WP_072248922.1|1445728_1446364_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	47.4	5.2e-45
WP_072243648.1|1446833_1447469_+	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	53.0	9.2e-34
WP_059221914.1|1447927_1448368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010340761.1|1449408_1449654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059268429.1|1449657_1450092_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	1.2e-29
WP_095575712.1|1450232_1451351_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.4	2.3e-112
>prophage 6
NZ_AP014856	Escherichia albertii strain CB9786	4598983	2039824	2081106	4598983	head,capsid,terminase,tail,integrase,lysis,holin,portal	Enterobacteria_phage(45.9%)	62	2070029:2070043	2085595:2085609
WP_172843351.1|2039824_2040337_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	58.5	6.9e-48
WP_095575816.1|2043257_2043857_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.5	1.9e-105
WP_095575817.1|2043927_2047341_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.5	0.0e+00
WP_071791559.1|2047401_2048034_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	3.2e-95
WP_095575818.1|2047970_2048714_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.3e-148
WP_095575819.1|2048719_2049418_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	95.7	5.4e-128
WP_095575820.1|2049417_2049747_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	3.1e-57
WP_095575821.1|2049743_2052305_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.8	0.0e+00
WP_059222279.1|2052297_2052723_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	4.8e-63
WP_032329098.1|2052704_2053127_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_059236901.1|2053142_2053883_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	97.6	6.1e-130
WP_059217891.1|2053890_2054286_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.9	2.5e-69
WP_095575822.1|2054282_2054861_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	5.2e-76
WP_085456367.1|2054872_2055226_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	95.7	1.1e-60
WP_085456368.1|2055237_2055633_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	1.8e-56
WP_059219384.1|2055674_2056700_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	9.9e-187
WP_032285278.1|2056755_2057088_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	2.9e-55
WP_059217886.1|2057097_2058417_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	95.0	1.5e-224
WP_085456369.1|2058397_2059999_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	2.5e-309
WP_095575823.1|2059995_2060202_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	95.6	1.4e-28
WP_095575824.1|2060198_2062124_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453611.1|2062098_2062644_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_095575825.1|2063137_2063755_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	92.4	3.5e-102
WP_095575826.1|2063888_2064326_-|lysis	lysis protein	lysis	K7PJY1	Enterobacterial_phage	93.8	3.6e-69
WP_001135262.1|2064322_2064820_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.1e-90
WP_000839574.1|2064819_2065035_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_000027554.1|2065372_2065891_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	5.9e-95
WP_000994514.1|2065887_2066076_-	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	7.2e-27
WP_001008200.1|2066072_2066435_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000002229.1|2066431_2066722_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	99.0	1.0e-51
WP_001283996.1|2066722_2066941_-	hypothetical protein	NA	S4TUE0	Salmonella_phage	68.1	4.3e-23
WP_021520333.1|2066933_2067104_-	protein ninF	NA	A0A2I6PIG4	Escherichia_phage	98.2	2.7e-25
WP_059222272.1|2067100_2067283_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	1.8e-27
WP_000153270.1|2067279_2067807_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_024182569.1|2067803_2068250_-	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	92.6	4.4e-75
WP_000344556.1|2068206_2068584_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	66.4	9.0e-37
WP_000818848.1|2068601_2068808_-	hypothetical protein	NA	A0A2I6PIF1	Escherichia_phage	94.1	2.3e-26
WP_095575827.1|2068880_2070257_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.3	6.9e-252
2070029:2070043	attL	TGGTCATCAGGATTG	NA	NA	NA	NA
WP_095575828.1|2070253_2071075_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	98.9	1.3e-152
WP_000166961.1|2071061_2071223_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000251073.1|2071255_2071549_-	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_001194218.1|2071668_2071884_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|2071992_2072625_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_044809909.1|2072621_2073026_+	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	3.3e-69
WP_095575829.1|2073252_2073579_+	antitermination protein	NA	K7PHQ7	Enterobacteria_phage	99.1	1.0e-52
WP_095575830.1|2073587_2073776_+	hypothetical protein	NA	K7PMF8	Enterobacteria_phage	97.7	7.2e-19
WP_095575831.1|2073971_2074340_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	97.5	1.3e-64
WP_000972063.1|2074415_2074550_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|2074534_2074687_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_095575832.1|2074941_2075649_+	recombinase	NA	Q716E7	Shigella_phage	99.6	1.7e-137
WP_095575833.1|2075649_2076111_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.0	1.3e-69
WP_136669547.1|2076126_2076594_+	hypothetical protein	NA	Q716E9	Shigella_phage	47.9	7.7e-38
WP_001111278.1|2076607_2076901_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_032279487.1|2076911_2077076_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.2e-23
WP_095575834.1|2077072_2077483_+	hypothetical protein	NA	G8C7K9	Escherichia_phage	61.2	9.2e-43
WP_095575835.1|2077479_2077779_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.4e-56
WP_172843349.1|2077780_2078524_+	ead/Ea22-like family protein	NA	K7PK20	Enterobacteria_phage	79.4	6.0e-85
WP_157730585.1|2078516_2078798_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	94.6	1.1e-47
WP_095575837.1|2078864_2079155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095575838.1|2079385_2079730_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_059225545.1|2079836_2080055_+	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
WP_059258406.1|2080032_2081106_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	95.5	5.7e-193
2085595:2085609	attR	CAATCCTGATGACCA	NA	NA	NA	NA
>prophage 7
NZ_AP014856	Escherichia albertii strain CB9786	4598983	2090299	2098486	4598983	tRNA	Escherichia_phage(42.86%)	8	NA	NA
WP_059275232.1|2090299_2091703_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	4.1e-34
WP_000137865.1|2091699_2092422_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	8.3e-31
WP_025238759.1|2092609_2092942_+	YegP family protein	NA	NA	NA	NA	NA
WP_095575841.1|2093089_2094451_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	98.4	2.3e-215
WP_072179090.1|2095110_2095887_+	cytolethal distending toxin type II subunit CdtA	NA	G1BEM3	Escherichia_phage	93.8	1.1e-126
WP_095575842.1|2095883_2096693_+	cytolethal distending toxin type II nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	94.8	4.5e-142
WP_059219458.1|2096707_2097253_+	cytolethal distending toxin type II subunit CdtC	NA	M1SNM4	Escherichia_phage	90.1	8.3e-92
WP_095575843.1|2097586_2098486_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.2	1.3e-12
>prophage 8
NZ_AP014856	Escherichia albertii strain CB9786	4598983	2138694	2148141	4598983		Enterobacteria_phage(85.71%)	10	NA	NA
WP_059219476.1|2138694_2139831_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	93.8	1.3e-158
WP_095575853.1|2139827_2141825_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	85.3	0.0e+00
WP_000643193.1|2141955_2142417_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	89.5	8.4e-69
WP_000950403.1|2142459_2142930_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	96.8	2.2e-80
WP_002461811.1|2142976_2143696_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002461809.1|2143692_2145378_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	97.7	2.7e-298
WP_095575854.1|2145599_2146331_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	97.0	1.7e-108
WP_001216963.1|2146390_2146498_+	protein YohO	NA	NA	NA	NA	NA
WP_095575855.1|2146478_2147210_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569309.1|2147214_2148141_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 9
NZ_AP014856	Escherichia albertii strain CB9786	4598983	2545571	2620058	4598983	plate,head,terminase,tail,integrase,holin,tRNA	Salmonella_phage(42.86%)	80	NA	NA
WP_059219642.1|2545571_2546312_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_059219643.1|2546430_2547234_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_025238575.1|2547379_2548234_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_059219644.1|2548424_2549705_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244166.1|2549696_2550836_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_059219645.1|2551250_2551673_+	DoxX family protein	NA	NA	NA	NA	NA
WP_059267490.1|2551832_2552705_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_000700787.1|2552715_2553810_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_001276664.1|2553842_2554841_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_059278260.1|2554865_2556377_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	1.5e-13
WP_095575928.1|2556399_2557383_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095575929.1|2557479_2560761_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_059219648.1|2560878_2562072_+	ROK family protein	NA	NA	NA	NA	NA
WP_059219649.1|2562273_2563527_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	2.0e-101
WP_059219101.1|2563856_2565047_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717692.1|2565094_2565433_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_002461544.1|2565493_2566828_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	6.7e-10
WP_059219676.1|2566817_2567531_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_059219650.1|2567548_2568979_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	4.4e-15
WP_025238561.1|2569601_2570183_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_059275363.1|2570251_2574139_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	3.8e-130
WP_054411135.1|2574396_2575953_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001250374.1|2576096_2576633_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190659.1|2576657_2577293_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_002461536.1|2577501_2578350_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095575930.1|2579240_2580086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095575931.1|2580090_2580405_-	recombinase family protein	NA	M1T2R9	Escherichia_phage	92.1	4.3e-40
WP_019842908.1|2580434_2580821_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	70.0	2.1e-09
WP_095575932.1|2580822_2581266_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	74.1	2.0e-59
WP_095575933.1|2581237_2581840_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.0	3.3e-97
WP_095575934.1|2581839_2582628_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	63.0	6.2e-80
WP_000049950.1|2582627_2583308_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_095575935.1|2583304_2584504_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.6	1.4e-184
WP_001270634.1|2584503_2584857_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_001007932.1|2584856_2585609_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.3	2.0e-88
WP_000213604.1|2585671_2585842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044735.1|2585845_2586400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000832850.1|2586407_2586755_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.1	6.0e-27
WP_021517994.1|2586757_2587822_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.7	6.5e-157
WP_000155119.1|2587824_2588127_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_001420197.1|2588126_2588714_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_095575936.1|2588713_2590699_-	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	53.5	3.4e-175
WP_032314228.1|2590876_2591329_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	73.3	2.7e-56
WP_000109249.1|2591332_2591773_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_021572531.1|2591783_2592929_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	1.8e-160
WP_001349562.1|2592932_2593496_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_001519792.1|2593470_2593860_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	3.3e-66
WP_021517253.1|2593846_2594401_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.7	2.6e-80
WP_001125665.1|2594397_2594805_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	8.7e-70
WP_160393966.1|2594803_2595037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095575938.1|2595033_2595975_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	1.1e-155
WP_001066733.1|2595986_2596493_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	9.8e-71
WP_095575939.1|2596496_2597717_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	3.2e-200
WP_157730589.1|2597731_2598466_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	85.0	2.2e-95
WP_000113490.1|2598356_2599823_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
WP_095575940.1|2599822_2601445_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.2	0.0e+00
WP_000162796.1|2601447_2602020_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_095575941.1|2602081_2602606_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.1	1.3e-41
WP_001194119.1|2602589_2603066_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000781776.1|2603069_2603411_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_095575942.1|2603855_2604197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089647689.1|2604228_2604651_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	5.2e-41
WP_095575943.1|2604939_2607126_-	replication protein	NA	B6SCY1	Bacteriophage	72.7	1.1e-174
WP_044782164.1|2607115_2607301_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000606440.1|2607414_2608107_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	48.5	3.8e-57
WP_000801672.1|2608728_2608878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051353.1|2608874_2609777_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_095575944.1|2609779_2611081_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	6.8e-132
WP_000769011.1|2611096_2611645_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_042106501.1|2611696_2612335_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	69.3	1.7e-72
WP_000490741.1|2612402_2612672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095575945.1|2612728_2614792_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	1.0e-275
WP_000008820.1|2614797_2615013_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000637724.1|2615009_2615309_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	63.2	2.7e-28
WP_095575946.1|2615298_2615580_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	65.9	1.1e-26
WP_063112595.1|2615568_2616495_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	38.5	5.5e-51
WP_095575947.1|2616597_2617992_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.4	1.5e-214
WP_001291431.1|2617988_2618189_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001138329.1|2618185_2619583_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_095575948.1|2619797_2620058_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 10
NZ_AP014856	Escherichia albertii strain CB9786	4598983	2763226	2770367	4598983		Escherichia_phage(66.67%)	6	NA	NA
WP_000110915.1|2763226_2765788_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	3.5e-31
WP_044708390.1|2765894_2766551_+	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	44.9	3.6e-49
WP_002461462.1|2766601_2767369_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	1.1e-68
WP_059221372.1|2767564_2768473_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	6.6e-118
WP_095575967.1|2768469_2769732_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	6.3e-135
WP_000997546.1|2769728_2770367_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.5	7.5e-84
>prophage 11
NZ_AP014856	Escherichia albertii strain CB9786	4598983	4501370	4571164	4598983	terminase,tail,transposase,integrase,lysis,portal,protease	Enterobacteria_phage(43.64%)	78	4510644:4510674	4573457:4573487
WP_095576245.1|4501370_4502303_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	1.7e-60
WP_054409938.1|4502494_4503451_-	GTPase	NA	NA	NA	NA	NA
WP_000467859.1|4503461_4503665_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_095576246.1|4503714_4505865_-	pyruvate/proton symporter BtsT	NA	NA	NA	NA	NA
WP_095574528.1|4506902_4508264_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091581.1|4508481_4509396_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095576247.1|4509534_4510557_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	24.9	6.1e-11
4510644:4510674	attL	CCGGATAAGGCGTTTACGCCGCATCCGGCAT	NA	NA	NA	NA
WP_024165299.1|4510736_4513028_-	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_095576248.1|4513281_4513776_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_059221687.1|4513832_4514570_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.4	2.9e-63
WP_059267525.1|4514572_4515112_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	1.7e-28
WP_000538185.1|4515217_4515691_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_095576249.1|4515681_4516452_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_095574531.1|4517077_4517803_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000400850.1|4517760_4518438_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_059278757.1|4518477_4519266_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_072243629.1|4519406_4519643_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_095576250.1|4520301_4521333_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_044714832.1|4521435_4521849_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092450.1|4521817_4522264_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870691.1|4522278_4522956_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_021537116.1|4523341_4524565_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	2.8e-236
WP_021537117.1|4524836_4525856_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_071791560.1|4526587_4526782_-	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	90.6	9.3e-30
WP_000073886.1|4526781_4527093_-	hypothetical protein	NA	A0A2H4N7F8	Pectobacterium_phage	42.6	1.1e-11
WP_024241867.1|4527089_4527476_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	71.7	1.1e-40
WP_024241866.1|4527475_4527838_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.4	1.3e-64
WP_000008174.1|4527828_4528365_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000081287.1|4528492_4529317_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|4529382_4529745_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_059251277.1|4530216_4530732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|4530932_4531607_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4531697_4531898_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_024241865.1|4531941_4532493_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	7.6e-101
WP_024241864.1|4532489_4533326_+	ash family protein	NA	Q8SBF3	Shigella_phage	99.3	1.6e-150
WP_029792846.1|4533318_4533555_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	96.2	5.1e-38
WP_024241862.1|4533551_4534370_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.5	1.8e-122
WP_016236627.1|4534366_4534861_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	4.3e-87
WP_001522094.1|4534860_4535514_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_024241861.1|4535510_4535837_+	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	99.1	4.5e-53
WP_000767110.1|4535833_4536229_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|4536391_4537207_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001360050.1|4537214_4538204_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_024241860.1|4538217_4538970_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	96.0	1.3e-138
WP_122985741.1|4539248_4539338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001589622.1|4539392_4539605_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_024241859.1|4539905_4540121_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	75.0	1.7e-24
WP_024241858.1|4540865_4541081_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.0e-32
WP_024044720.1|4541080_4541578_+	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	99.4	8.4e-91
WP_024241857.1|4541574_4542012_+|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	96.6	4.2e-70
WP_024241856.1|4542215_4542770_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	94.4	7.7e-93
WP_000421825.1|4543274_4543814_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_024241854.1|4543822_4545922_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.9	0.0e+00
WP_001072975.1|4545918_4546131_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_077827187.1|4546058_4547639_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.0	1.5e-287
WP_095576251.1|4547583_4549611_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_001097046.1|4549697_4550021_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|4550013_4550289_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_095576252.1|4550300_4550879_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	2.7e-101
WP_023148639.1|4550875_4551277_+|tail	phage tail protein	tail	K7PJP5	Enterobacteria_phage	100.0	1.1e-72
WP_024241850.1|4551287_4552031_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001300035.1|4552091_4552478_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|4552486_4552816_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_024241849.1|4552787_4555862_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	92.5	0.0e+00
WP_000847354.1|4555858_4556188_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	8.1e-58
WP_024241847.1|4556187_4556886_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_029792841.1|4556890_4557628_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.1	2.7e-146
WP_095576253.1|4558258_4561672_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.0	0.0e+00
WP_024241843.1|4561742_4562342_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	95.0	2.9e-106
WP_172843354.1|4564683_4565190_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	54.9	1.6e-44
WP_059222141.1|4565327_4565657_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_024241840.1|4566013_4566604_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	36.2	6.2e-24
WP_000836769.1|4566982_4567216_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|4567284_4567398_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|4567824_4568073_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_095576255.1|4568292_4569879_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	4.1e-30
WP_095576256.1|4570270_4570876_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|4571002_4571164_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
4573457:4573487	attR	CCGGATAAGGCGTTTACGCCGCATCCGGCAT	NA	NA	NA	NA
