The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014855	Escherichia albertii strain NIAH_Bird_3	4560575	839802	917943	4560575	portal,protease,capsid,plate,terminase,lysis,tail,integrase,head	Salmonella_phage(64.81%)	87	839704:839728	874900:874924
839704:839728	attL	AAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_095573775.1|839802_840855_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	3.0e-106
WP_000584504.1|840935_841457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000047742.1|841458_842661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095573776.1|842741_843623_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	44.8	6.4e-41
WP_000035244.1|843748_843970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095573777.1|844002_844512_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	6.4e-86
WP_001350183.1|844519_844753_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	86.1	5.2e-11
WP_000166365.1|844700_845159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095573778.1|845352_845619_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	85.7	4.7e-16
WP_000996717.1|845736_846078_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244227.1|846145_846379_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	3.2e-32
WP_095573779.1|846378_846606_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	1.3e-35
WP_095573780.1|846602_847460_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	1.6e-158
WP_095573781.1|847456_849871_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
WP_001154434.1|850024_850213_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001555842.1|850223_850457_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	4.0e-35
WP_000094764.1|850727_850943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000212611.1|850942_851785_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.1	8.4e-59
WP_024169233.1|852000_852192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095573783.1|852506_853547_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.3	2.4e-172
WP_001579969.1|853546_855313_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_095573784.1|855455_856289_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.2e-123
WP_095573785.1|856305_857364_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|857367_858018_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673526.1|858113_858578_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_095573786.1|858577_858781_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	7.5e-30
WP_000171568.1|858784_859000_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069904.1|858980_859496_+	lysozyme	NA	E5G6N1	Salmonella_phage	93.0	7.4e-90
WP_095573787.1|859492_859921_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	6.6e-60
WP_001039945.1|860016_860448_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_095573788.1|860440_860887_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_095573789.1|860925_861684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001513111.1|861798_862377_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	88.0	1.5e-94
WP_095573790.1|862373_862733_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.0	1.2e-49
WP_024247011.1|862719_863628_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.4	2.4e-144
WP_001086849.1|863620_864226_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.2e-109
WP_095573791.1|864222_865614_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	77.1	2.6e-161
WP_001440573.1|865600_865798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049143284.1|865766_866372_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.9	1.5e-94
WP_095573792.1|866371_866947_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.8	1.9e-54
WP_000905033.1|866977_867544_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_095573793.1|867686_868859_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.3e-203
WP_001207656.1|868868_869384_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001281016.1|869438_869741_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_000763312.1|869755_869875_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	1.1e-12
WP_095573794.1|869867_872945_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.6	0.0e+00
WP_000980384.1|872941_873427_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.8e-66
WP_095573795.1|873423_874524_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	86.9	1.2e-174
WP_000972391.1|874614_874833_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024864.1|875068_876754_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
874900:874924	attR	AAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000681105.1|877021_877399_+	membrane protein	NA	NA	NA	NA	NA
WP_001195235.1|877430_877688_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_044716548.1|877863_878151_+	YbjC family protein	NA	NA	NA	NA	NA
WP_000189180.1|878134_878857_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_059219873.1|878916_879819_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.6	1.1e-35
WP_002430164.1|879906_880383_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_059219872.1|880733_881846_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_044710221.1|881940_883074_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_025237300.1|883083_884037_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_059219870.1|884033_884879_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389264.1|884938_885427_+	YbjO family protein	NA	NA	NA	NA	NA
WP_095573796.1|885467_886619_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	9.5e-29
WP_095573797.1|886760_887492_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|887787_888456_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|888455_889172_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_059219866.1|889178_889910_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027193.1|889927_890656_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.6	2.1e-29
WP_059219865.1|890873_891389_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160731.1|891514_891838_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059219864.1|891834_892665_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	2.5e-07
WP_024164829.1|892661_893675_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054411027.1|893773_895204_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566415.1|895214_896216_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_059219863.1|896253_897972_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.7	1.9e-33
WP_000178653.1|898104_899073_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_059219862.1|899084_900737_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002462423.1|900880_901780_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_059219861.1|902226_902922_-	aquaporin Z	NA	NA	NA	NA	NA
WP_095573798.1|903346_905005_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_143189694.1|905001_905958_-	DUF535 family protein	NA	NA	NA	NA	NA
WP_059219859.1|906108_907224_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_059267998.1|907220_909167_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.1	5.9e-39
WP_000410785.1|909238_909463_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520793.1|909785_910106_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.6	5.3e-14
WP_025237287.1|910136_912413_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	3.3e-166
WP_059223741.1|913729_914713_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	7.6e-43
WP_095573799.1|914709_917943_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	29.1	2.7e-65
>prophage 2
NZ_AP014855	Escherichia albertii strain NIAH_Bird_3	4560575	1364843	1373371	4560575	tRNA	Enterobacteria_phage(50.0%)	8	NA	NA
WP_059235732.1|1364843_1366217_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	1.4e-50
WP_095573884.1|1366319_1367255_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	1.2e-146
WP_072248922.1|1367751_1368387_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	47.4	5.2e-45
WP_172843671.1|1368855_1369491_+	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	53.0	4.1e-34
WP_059221914.1|1369949_1370390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574554.1|1371428_1371674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059268429.1|1371677_1372112_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	1.2e-29
WP_000836971.1|1372252_1373371_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.7	1.0e-112
>prophage 3
NZ_AP014855	Escherichia albertii strain NIAH_Bird_3	4560575	1881191	1936048	4560575	portal,capsid,integrase,terminase,lysis,tail,head,holin	Enterobacteria_phage(43.75%)	62	1924791:1924810	1944541:1944560
WP_001298831.1|1881191_1881782_-	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	58.9	2.3e-23
WP_122988840.1|1881803_1881881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054413144.1|1881991_1882261_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	7.1e-44
WP_095573988.1|1882262_1883513_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	90.8	1.4e-73
WP_095573989.1|1883572_1886986_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.5	0.0e+00
WP_025238684.1|1887119_1887641_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	66.7	2.0e-63
WP_172843678.1|1887683_1888277_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	81.9	3.1e-84
WP_095573991.1|1888222_1888966_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	9.5e-147
WP_095573992.1|1888971_1889670_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	3.8e-129
WP_000847354.1|1889669_1889999_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	8.1e-58
WP_095573993.1|1889995_1892569_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	76.8	0.0e+00
WP_071852674.1|1892549_1892963_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|1892989_1893421_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_054412995.1|1893434_1894187_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	2.2e-127
WP_000683071.1|1894194_1894590_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975035.1|1894586_1895162_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.7e-50
WP_095573994.1|1895176_1895530_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	68.4	1.9e-41
WP_000201530.1|1895522_1895897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054412999.1|1895948_1896977_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	7.8e-115
WP_000256840.1|1897034_1897382_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_054413001.1|1897418_1898924_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	2.1e-100
WP_054413003.1|1898913_1900506_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_000259002.1|1900502_1900709_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_059242538.1|1900692_1902621_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.2e-262
WP_000235446.1|1902592_1903102_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_059242540.1|1903416_1903821_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	41.9	7.2e-24
WP_000708309.1|1904064_1904376_-	DUF4406 domain-containing protein	NA	A0A2I6TCY5	Escherichia_phage	100.0	3.5e-55
WP_059242541.1|1904417_1904855_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.2	1.2e-69
WP_059242542.1|1904851_1905385_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	97.2	7.4e-101
WP_001315200.1|1905490_1905763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060877343.1|1905728_1906073_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	9.1e-36
WP_001382056.1|1906077_1906293_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.0e-32
WP_095573995.1|1906514_1908365_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	93.0	0.0e+00
WP_059275006.1|1909274_1909964_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.1e-60
WP_038347044.1|1909960_1910326_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	2.1e-38
WP_059275005.1|1910326_1911382_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_032278866.1|1911383_1911662_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_059236911.1|1911728_1911989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001585819.1|1912301_1912454_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_059274977.1|1912557_1912779_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	86.8	2.7e-25
WP_059227621.1|1912746_1913466_-	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	50.4	6.8e-49
WP_060877345.1|1913624_1914041_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	67.6	7.6e-45
WP_059274976.1|1914048_1914810_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	85.0	1.8e-113
WP_000789001.1|1914832_1915579_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	3.4e-112
WP_060877346.1|1915585_1916539_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.8e-58
WP_052931681.1|1916519_1917041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025237252.1|1917024_1917255_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379971.1|1917338_1917746_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	2.6e-13
WP_000379568.1|1917912_1918065_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394553.1|1918076_1918715_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	43.0	2.5e-07
WP_001133037.1|1918715_1918925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560212.1|1919493_1919715_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
WP_060877348.1|1919838_1922310_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	5.0e-59
WP_000096344.1|1922368_1922572_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533623.1|1922571_1923597_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	6.8e-103
WP_024164886.1|1923832_1924630_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1924791:1924810	attL	CCAGTCAGAGGAGCCAAATT	NA	NA	NA	NA
WP_095574559.1|1924971_1925190_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_172843672.1|1925458_1929586_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	5.3e-21
WP_095573996.1|1929589_1929892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095573998.1|1930451_1931402_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_095573999.1|1932515_1933778_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	9.0e-73
WP_095574002.1|1935163_1936048_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
1944541:1944560	attR	CCAGTCAGAGGAGCCAAATT	NA	NA	NA	NA
>prophage 4
NZ_AP014855	Escherichia albertii strain NIAH_Bird_3	4560575	2000606	2008262	4560575		Enterobacteria_phage(33.33%)	7	NA	NA
WP_095574027.1|2000606_2001155_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.2	1.0e-52
WP_095574028.1|2001159_2002038_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	6.6e-107
WP_095574029.1|2002095_2002995_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	4.4e-29
WP_095574030.1|2002994_2004080_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	7.4e-100
WP_000183060.1|2004450_2005344_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_157730401.1|2005848_2006001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574031.1|2006678_2008262_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	1.6e-34
>prophage 5
NZ_AP014855	Escherichia albertii strain NIAH_Bird_3	4560575	2078041	2087488	4560575		Enterobacteria_phage(85.71%)	10	NA	NA
WP_095574051.1|2078041_2079178_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	93.8	3.3e-159
WP_059219477.1|2079174_2081172_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	85.4	0.0e+00
WP_059219478.1|2081302_2081764_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	88.9	1.1e-68
WP_000950403.1|2081806_2082277_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	96.8	2.2e-80
WP_002461811.1|2082323_2083043_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_059268535.1|2083039_2084725_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	97.5	7.8e-298
WP_095574052.1|2084946_2085678_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	96.5	5.0e-108
WP_001216963.1|2085737_2085845_+	protein YohO	NA	NA	NA	NA	NA
WP_095574053.1|2085825_2086557_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569309.1|2086561_2087488_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	8.8e-09
>prophage 6
NZ_AP014855	Escherichia albertii strain NIAH_Bird_3	4560575	2671881	2679022	4560575		Escherichia_phage(66.67%)	6	NA	NA
WP_000110915.1|2671881_2674443_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	3.5e-31
WP_044708390.1|2674549_2675206_+	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	44.9	3.6e-49
WP_002461462.1|2675256_2676024_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	1.1e-68
WP_059221372.1|2676219_2677128_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	6.6e-118
WP_095574172.1|2677124_2678387_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.8	2.8e-135
WP_000997546.1|2678383_2679022_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.5	7.5e-84
>prophage 7
NZ_AP014855	Escherichia albertii strain NIAH_Bird_3	4560575	3701610	3714817	4560575	integrase	Enterobacteria_phage(88.89%)	13	3701428:3701450	3712144:3712166
3701428:3701450	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218981.1|3701610_3702783_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.9	2.3e-203
WP_000360276.1|3702813_3704574_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000446147.1|3704844_3705417_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_033548335.1|3705490_3705991_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283019.1|3705987_3706722_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.6	7.2e-131
WP_001149160.1|3707273_3707540_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001360858.1|3707536_3708136_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	3.0e-50
WP_001244665.1|3708128_3708416_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_095574361.1|3708408_3708864_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	8.0e-64
WP_000856729.1|3708999_3709320_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_095574362.1|3709334_3711668_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
WP_095574363.1|3713085_3713706_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
3712144:3712166	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_095574364.1|3713779_3714817_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.0	5.5e-68
>prophage 8
NZ_AP014855	Escherichia albertii strain NIAH_Bird_3	4560575	3985579	4054328	4560575	portal,protease,capsid,plate,terminase,lysis,tRNA,tail,integrase,head,holin	Escherichia_phage(38.3%)	77	4004209:4004255	4036902:4036948
WP_000560983.1|3985579_3986017_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_157730433.1|3986061_3987003_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_095574427.1|3987462_3989277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027704.1|3991640_3992570_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829019.1|3992566_3993202_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331386.1|3993198_3994101_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077871465.1|3994113_3997164_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.5	1.1e-07
WP_000753602.1|3997357_3998191_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_059228882.1|3998344_3999400_+	YiiG family protein	NA	NA	NA	NA	NA
WP_002460606.1|3999663_4000284_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.4	1.0e-61
WP_095574428.1|4000353_4001052_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_095574429.1|4001071_4001278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580409.1|4001463_4002837_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.2	3.2e-15
WP_001033724.1|4002833_4003535_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_024164685.1|4003684_4004185_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4004209:4004255	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|4004371_4005352_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_095574430.1|4005421_4005715_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	99.0	2.3e-48
WP_095574431.1|4005851_4006124_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	98.9	2.4e-47
WP_000217670.1|4006293_4006794_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|4006857_4007082_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_095574432.1|4007081_4007381_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	98.0	6.0e-44
WP_001113264.1|4007383_4007608_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|4007604_4007880_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_095574433.1|4007869_4010155_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
WP_023156287.1|4010154_4010607_+	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	96.6	2.0e-78
WP_001540306.1|4011091_4012030_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	97.8	7.2e-184
WP_089569874.1|4012030_4013023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140373.1|4013009_4014128_-	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	99.7	5.8e-172
WP_029401225.1|4014503_4015538_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_001744545.1|4015537_4017310_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085971.1|4017483_4018338_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_059327993.1|4018396_4019470_+|capsid	phage major capsid protein, P2 family	capsid	A0A0F7LBR8	Escherichia_phage	99.4	4.3e-201
WP_095574434.1|4019473_4020217_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.8	7.8e-125
WP_000988633.1|4020316_4020826_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_021560117.1|4020825_4021029_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	6.8e-31
WP_000123123.1|4021032_4021314_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|4021313_4021811_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_001576658.1|4021825_4022251_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.5	1.0e-57
WP_095574435.1|4022238_4022664_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	96.5	1.4e-65
WP_072174950.1|4022635_4022809_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_000917151.1|4022771_4023239_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001001791.1|4023231_4023684_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	4.1e-76
WP_053266706.1|4023750_4024386_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	7.6e-113
WP_000127163.1|4024382_4024730_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121474.1|4024734_4025643_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001285325.1|4025635_4026166_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_095574436.1|4026176_4028222_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	99.3	0.0e+00
WP_040083689.1|4028225_4028753_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	96.6	1.8e-91
WP_000014362.1|4028968_4029868_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	100.0	6.2e-169
WP_001286683.1|4030187_4031378_+|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	99.7	8.1e-225
WP_001251408.1|4031390_4031909_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4031965_4032241_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4032273_4032393_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_095574437.1|4032385_4034833_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	98.2	0.0e+00
WP_000978900.1|4034847_4035327_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	100.0	5.1e-85
WP_095574438.1|4035326_4036490_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	98.2	2.4e-205
WP_000468308.1|4036571_4036790_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_059221848.1|4037026_4037929_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4036902:4036948	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_001355350.1|4038110_4039073_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_095574439.1|4039392_4040382_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_059221849.1|4040486_4041242_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216333.1|4041296_4042064_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_059271402.1|4042171_4042771_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155267.1|4042871_4043312_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655995.1|4043521_4043821_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323550.1|4043832_4044261_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796308.1|4044265_4045012_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_095574440.1|4045108_4046119_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_059221853.1|4046316_4047825_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084280.1|4047847_4048693_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.4	5.7e-15
WP_001296623.1|4049117_4049363_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_124782764.1|4049401_4050028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059275733.1|4050150_4050825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000872905.1|4050885_4051371_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_010342312.1|4051463_4052390_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293346.1|4052456_4053788_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	2.2e-45
WP_000208242.1|4053797_4054328_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
