The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023142	Escherichia coli strain CFSAN061770 chromosome, complete genome	5292297	1600985	1647464	5292297	protease,portal,holin,lysis,integrase,coat,terminase,tail	Enterobacteria_phage(53.97%)	71	1605617:1605632	1646396:1646411
WP_000194531.1|1600985_1602419_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.2	9.1e-29
WP_001274886.1|1602634_1603558_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197026.1|1603619_1604867_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_012602833.1|1604946_1605099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001163428.1|1605396_1605597_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
1605617:1605632	attL	GGAATCGAACCTGCAA	NA	NA	NA	NA
WP_001281200.1|1605722_1606067_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_001277766.1|1606167_1606347_-	Eag protein	NA	K7PL40	Enterobacteria_phage	96.6	2.8e-28
WP_095454356.1|1606443_1607013_-	DUF551 domain-containing protein	NA	K7PK20	Enterobacteria_phage	95.5	3.1e-33
WP_095454355.1|1607009_1607513_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	51.4	8.9e-48
WP_095454354.1|1607509_1607791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095454353.1|1607787_1608219_-	hypothetical protein	NA	K7PMI0	Enterobacteria_phage	87.7	1.5e-64
WP_001214452.1|1608215_1608380_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_001515397.1|1608390_1608687_-	DUF2856 family protein	NA	G9L665	Escherichia_phage	93.9	1.7e-46
WP_095454352.1|1608700_1609216_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	94.2	2.2e-73
WP_095454351.1|1609216_1609924_-	recombinase	NA	Q716E7	Shigella_phage	98.7	7.2e-136
WP_001243355.1|1610178_1610331_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_016042219.1|1610315_1610441_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	G8C7L6	Escherichia_phage	100.0	2.0e-17
WP_000065374.1|1610513_1610882_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001735521.1|1611034_1611361_-	hypothetical protein	NA	A0A0M4R4L8	Citrobacter_phage	29.0	2.4e-06
WP_095454435.1|1611401_1611602_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	95.5	1.3e-31
WP_000219337.1|1611680_1611980_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	99.0	3.4e-31
WP_000856967.1|1612294_1612945_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000276886.1|1613025_1613211_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_095454434.1|1613319_1613598_+	hypothetical protein	NA	K7P8A8	Enterobacteria_phage	82.6	1.5e-33
WP_001119433.1|1613632_1614037_+	hypothetical protein	NA	G8C7U4	Escherichia_phage	91.0	2.4e-72
WP_000166207.1|1614036_1614183_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000067062.1|1614175_1615036_+	replication protein	NA	A0A088CPU2	Enterobacteria_phage	100.0	3.9e-160
WP_001307316.1|1615143_1617024_+	replication protein	NA	K7PK08	Enterobacteria_phage	99.8	0.0e+00
WP_095454433.1|1617100_1617307_+	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	92.6	3.4e-30
WP_058657038.1|1617324_1617639_+	hypothetical protein	NA	K7PKU8	Enterobacteria_phage	94.2	3.1e-51
WP_137579636.1|1617641_1617884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058657036.1|1618284_1618812_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_058657035.1|1618808_1619654_+	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	56.6	4.2e-90
WP_001254251.1|1619650_1619833_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_059254553.1|1619829_1620000_+	protein ninF	NA	M1FPE8	Enterobacteria_phage	100.0	1.2e-25
WP_001003984.1|1619992_1620715_+	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	99.6	7.1e-131
WP_041327960.1|1620714_1621005_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.2e-51
WP_001008200.1|1621001_1621364_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000994515.1|1621360_1621549_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_095454432.1|1621545_1622169_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.0	8.3e-112
WP_000783734.1|1622602_1622926_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|1622909_1623386_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_001701155.1|1623382_1623850_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.8	7.2e-76
WP_001139681.1|1623837_1623990_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_044066504.1|1624408_1624588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044066503.1|1624700_1625441_+	trypsin-like peptidase domain-containing protein	NA	A0A2H4J9L7	uncultured_Caudovirales_phage	77.5	4.4e-104
WP_000807789.1|1625604_1625847_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
WP_001700895.1|1625850_1626138_+	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.3e-06
WP_000205034.1|1626147_1626327_+	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	91.5	6.0e-23
WP_000729920.1|1626350_1626839_+	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_095454431.1|1626816_1628316_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.6	1.2e-305
WP_095454430.1|1628316_1630482_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.3	0.0e+00
WP_094318841.1|1630495_1631407_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.3	5.4e-160
WP_021568314.1|1631406_1632702_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	1.0e-241
WP_095454437.1|1632754_1633333_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	62.4	6.2e-61
WP_087549131.1|1633310_1633811_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.8	1.4e-90
WP_063119631.1|1633811_1635230_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	99.2	2.1e-275
WP_063119630.1|1635229_1636141_+	hypothetical protein	NA	Q716G6	Shigella_phage	89.8	4.2e-96
WP_000614031.1|1636140_1636596_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	1.5e-86
WP_000964888.1|1636598_1637294_+	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	98.3	8.1e-116
WP_095454429.1|1637304_1638720_+	acyltransferase	NA	I6RSG0	Salmonella_phage	80.7	4.8e-200
WP_095454428.1|1638719_1640555_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.2	2.2e-245
WP_032274929.1|1640582_1640972_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	87.6	8.7e-59
WP_032274930.1|1640987_1641323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090234.1|1641319_1641574_-	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	91.2	1.4e-33
WP_000677939.1|1641664_1641826_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_095454427.1|1641894_1642830_+	phage antirepressor Ant	NA	A0A2H4FRZ6	Salmonella_phage	98.1	1.2e-175
WP_095454426.1|1642930_1644367_+|tail	phage tail protein	tail	A5VW57	Enterobacteria_phage	75.5	6.5e-59
WP_016231946.1|1644379_1644565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085701386.1|1645062_1646220_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.7	2.8e-222
WP_000368131.1|1646531_1647464_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1646396:1646411	attR	GGAATCGAACCTGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP023142	Escherichia coli strain CFSAN061770 chromosome, complete genome	5292297	1893186	1902629	5292297		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569372.1|1893186_1894113_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	1.1e-22
WP_000783145.1|1894117_1894849_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1894829_1894937_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1894996_1895728_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001309587.1|1895949_1897635_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_000598641.1|1897631_1898351_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1898397_1898868_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1898909_1899371_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001309586.1|1899495_1901496_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001292789.1|1901492_1902629_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.3e-163
>prophage 3
NZ_CP023142	Escherichia coli strain CFSAN061770 chromosome, complete genome	5292297	2441091	2509137	5292297	protease,portal,lysis,integrase,terminase,tail	Enterobacteria_phage(43.14%)	79	2448667:2448682	2478658:2478673
WP_001260856.1|2441091_2441913_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233092.1|2442012_2442096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743947.1|2442188_2442524_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091836.1|2442920_2444174_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019558.1|2444280_2445174_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225257.1|2445308_2446529_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2446653_2447349_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000546460.1|2447301_2448594_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2448667:2448682	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148697.1|2448751_2449366_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	7.3e-28
WP_000526517.1|2449408_2450263_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2450264_2450882_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_012602795.1|2450892_2453316_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	1.4e-207
WP_000041650.1|2453376_2455803_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.3e-213
WP_001295396.1|2456001_2456307_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001309527.1|2456414_2457125_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2457127_2457688_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2457722_2458064_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001306081.1|2458198_2458525_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001295394.1|2458730_2459945_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|2459956_2460976_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001513307.1|2461033_2461144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876984.1|2461163_2462444_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.9e-155
WP_001296941.1|2462478_2462715_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048333.1|2462802_2465274_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.6	2.1e-57
WP_001083276.1|2465367_2465559_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2465555_2465744_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344958.1|2466230_2466806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2466807_2466963_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001003381.1|2467155_2467563_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2467640_2467868_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2467851_2468373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|2468353_2469319_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001151189.1|2469359_2469761_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_000340970.1|2469979_2471767_-	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	23.1	9.3e-15
WP_000887485.1|2472384_2472597_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.7e-24
WP_000980991.1|2472813_2473065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309521.1|2473131_2473410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513304.1|2473411_2474461_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	56.7	6.9e-111
WP_001047132.1|2474474_2475227_+	antitermination protein	NA	Q8SBE4	Shigella_phage	95.2	2.5e-131
WP_120795389.1|2475504_2475594_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2475648_2475861_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2476161_2476377_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2477130_2477346_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_001309518.1|2477329_2477662_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.3	1.1e-25
WP_001092971.1|2477658_2478192_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2478188_2478686_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2478658:2478673	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2479049_2479262_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2479272_2479461_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|2479463_2479529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2479608_2479764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2479935_2480109_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035574.1|2480260_2480671_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.0	2.1e-63
WP_001031431.1|2480971_2481178_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000373425.1|2481740_2482235_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934101.1|2482234_2484337_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.9	0.0e+00
WP_001072975.1|2484333_2484546_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_011478361.1|2484473_2486054_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001136587.1|2485998_2488026_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|2488112_2488436_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|2488428_2488704_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677108.1|2488715_2489294_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|2489290_2489692_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|2489703_2490447_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001297778.1|2490507_2490894_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_001161009.1|2490902_2491232_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372011.1|2491203_2494269_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_000447253.1|2494268_2494598_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152385.1|2494607_2495306_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000140729.1|2495311_2496055_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	7.0e-150
WP_001309913.1|2495952_2496600_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000515574.1|2496660_2500059_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001230343.1|2500125_2500725_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.0	6.7e-111
WP_000279113.1|2500789_2503705_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	2.5e-57
WP_000885596.1|2503704_2504280_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	2.9e-103
WP_000086527.1|2504377_2504968_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2505284_2505518_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2505586_2505700_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347485.1|2506303_2507587_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527819.1|2507676_2509137_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.9	5.1e-43
>prophage 4
NZ_CP023142	Escherichia coli strain CFSAN061770 chromosome, complete genome	5292297	2897273	2941752	5292297	protease,head,portal,holin,lysis,tRNA,integrase,capsid,terminase,tail	Enterobacteria_phage(51.79%)	65	2891299:2891321	2938000:2938022
2891299:2891321	attL	AACGGGCGTGTTATACGCCCGTT	NA	NA	NA	NA
WP_000654172.1|2897273_2897552_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290537.1|2897548_2899570_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.5	3.8e-182
WP_000515553.1|2899628_2903111_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_071592626.1|2903171_2903804_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	6.5e-96
WP_001309445.1|2903740_2904484_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.6e-149
WP_001152512.1|2904489_2905188_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	6.8e-131
WP_000847364.1|2905187_2905517_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	1.2e-56
WP_095597208.1|2905513_2908093_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.1	0.0e+00
WP_000459451.1|2908085_2908520_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
WP_000479141.1|2908501_2908924_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.0e-69
WP_001309910.1|2908939_2909680_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.7	1.2e-128
WP_000683112.1|2909687_2910083_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_000985123.1|2910079_2910658_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
WP_000752986.1|2910669_2911023_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.6e-62
WP_000158868.1|2911034_2911430_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063217.1|2911471_2912497_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	5.2e-188
WP_001513196.1|2912552_2912885_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123267.1|2912894_2914214_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001309906.1|2914194_2915796_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000198149.1|2915792_2915999_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|2915995_2917921_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000453611.1|2917895_2918441_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001322384.1|2918829_2919024_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	4.8e-26
WP_000738423.1|2919383_2919677_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|2919767_2919950_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000075162.1|2920166_2920664_-	lysozyme	NA	A5LH83	Enterobacteria_phage	98.8	4.9e-91
WP_000839583.1|2920663_2920879_-|holin	holin	holin	M1FN85	Enterobacteria_phage	94.4	4.5e-33
WP_001112170.1|2921046_2921778_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592551.1|2922096_2923056_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780585.1|2923248_2923773_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	4.2e-48
WP_001204782.1|2923929_2924307_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	85.0	1.3e-54
WP_000971075.1|2924392_2924533_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099522.1|2924529_2924892_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
WP_000950953.1|2924911_2925106_-	protein ninF	NA	NA	NA	NA	NA
WP_000386642.1|2925098_2925440_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	95.6	4.7e-61
WP_001254223.1|2925442_2925619_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000153280.1|2925615_2926143_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|2926139_2926580_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145931.1|2926653_2926944_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788877.1|2926940_2927642_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000185503.1|2927638_2928538_-	replication protein	NA	M1FN81	Enterobacteria_phage	100.0	1.7e-174
WP_000438490.1|2928570_2928870_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
WP_001180318.1|2928976_2929204_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250470.1|2929282_2929990_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.7	2.2e-132
WP_000076840.1|2930119_2931019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000971595.1|2931247_2931463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157729183.1|2931461_2931770_+	regulator	NA	A0A075B8K6	Enterobacteria_phage	69.6	8.7e-30
WP_001066174.1|2931786_2932368_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	99.5	3.4e-99
WP_000065374.1|2932628_2932997_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|2933069_2933234_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2933202_2933346_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995439.1|2933420_2933717_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100848.1|2933722_2934508_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000186715.1|2934504_2935185_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	4.6e-132
WP_000149538.1|2935181_2935364_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	3.7e-28
WP_000548521.1|2935336_2935528_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	95.2	1.2e-24
WP_001309430.1|2935538_2935820_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	8.7e-45
WP_000763387.1|2935918_2936137_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	1.7e-35
WP_000944300.1|2936184_2936424_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	92.4	9.7e-37
WP_000088653.1|2936563_2936800_+	excisionase	NA	NA	NA	NA	NA
WP_000741344.1|2936789_2937932_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.4	3.1e-205
WP_000444487.1|2938045_2939296_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2938000:2938022	attR	AACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
WP_001248673.1|2939467_2940121_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476103.1|2940130_2940592_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|2940645_2941752_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP023142	Escherichia coli strain CFSAN061770 chromosome, complete genome	5292297	2948824	2995534	5292297	head,portal,holin,lysis,capsid,terminase,tail,transposase	Escherichia_phage(43.14%)	57	NA	NA
WP_000531594.1|2948824_2949961_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799406.1|2949944_2950808_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000937496.1|2951040_2951307_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_023148666.1|2951363_2952032_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_087762014.1|2952086_2952671_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	3.0e-103
WP_074403624.1|2952670_2955700_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	2.4e-55
WP_064580283.1|2955764_2956364_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	3.5e-107
WP_064580281.1|2956431_2960124_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_122632346.1|2960374_2961007_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.6	1.1e-100
WP_000194708.1|2960952_2961696_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.3	4.9e-143
WP_023148773.1|2961706_2962405_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	5.4e-128
WP_023148774.1|2962404_2962734_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.8e-58
WP_095454445.1|2962730_2965292_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.0	0.0e+00
WP_023148796.1|2965272_2965686_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.0e-41
WP_001299690.1|2965712_2966144_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_016234254.1|2966162_2966909_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	1.7e-124
WP_000683079.1|2966916_2967312_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975010.1|2967308_2967884_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
WP_001204571.1|2967899_2968253_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000201498.1|2968245_2968629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522592.1|2968680_2969709_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000256823.1|2969766_2970114_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_021548052.1|2970150_2971656_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.3	7.9e-100
WP_001545469.1|2971645_2973238_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	8.4e-185
WP_021548051.1|2973234_2973435_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	56.7	2.5e-09
WP_095454444.1|2973418_2975347_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	7.4e-260
WP_024176291.1|2975318_2975825_-	DNA-packaging protein	NA	O64316	Escherichia_phage	49.4	1.9e-34
WP_001322427.1|2976340_2976694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2976816_2977143_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_032142285.1|2977453_2977921_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_001280932.1|2977923_2978055_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001446668.1|2978069_2978252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092866.1|2978408_2978942_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001610647.1|2978978_2979869_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	1.6e-108
WP_000284506.1|2979873_2980089_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001538590.1|2980165_2980411_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_023143432.1|2980448_2980631_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
WP_021548048.1|2980767_2982729_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.2	4.3e-239
WP_001443236.1|2982989_2983325_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	73.8	1.2e-43
WP_095454443.1|2983680_2984954_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	1.1e-171
WP_000917765.1|2985045_2985243_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	2.3e-28
WP_023148803.1|2985467_2986022_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.9	1.0e-65
WP_021548047.1|2986030_2986390_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	9.5e-36
WP_024176294.1|2986402_2987452_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	8.5e-109
WP_023148805.1|2987453_2987726_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	7.2e-12
WP_000813254.1|2987893_2988049_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001224662.1|2989138_2989321_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2989414_2989771_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_023148807.1|2990166_2990385_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	1.0e-29
WP_064580229.1|2990734_2991157_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	5.7e-64
WP_000451003.1|2991172_2991943_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	2.7e-80
WP_000788950.1|2991964_2992711_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095671.1|2992717_2993680_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693943.1|2993702_2994128_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|2994124_2994340_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103685.1|2994389_2995106_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.0e-52
WP_000379589.1|2995378_2995534_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
>prophage 6
NZ_CP023142	Escherichia coli strain CFSAN061770 chromosome, complete genome	5292297	3152322	3274856	5292297	protease,head,portal,transposase,holin,lysis,tRNA,integrase,capsid,terminase,tail,plate	Escherichia_phage(38.33%)	109	3164261:3164281	3260993:3261013
WP_000156482.1|3152322_3154083_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|3154151_3154670_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|3154739_3154907_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759110.1|3155162_3155726_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445541.1|3155722_3157363_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333164.1|3157367_3158621_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053090.1|3158750_3160658_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
WP_001086515.1|3160669_3162778_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224276.1|3163021_3164131_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|3164127_3164670_-	cell division protein ZapC	NA	NA	NA	NA	NA
3164261:3164281	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_001305914.1|3164843_3165854_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001263931.1|3166090_3166666_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244355.1|3166658_3167618_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000055959.1|3167614_3168760_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235189.1|3168771_3169563_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090481.1|3169559_3170327_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	4.4e-30
WP_100222095.1|3170532_3171881_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000193813.1|3171968_3174581_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_001305916.1|3174846_3176049_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|3176216_3177617_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977917.1|3178219_3179308_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|3179492_3180683_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109449.1|3180733_3181381_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3181407_3181956_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925988.1|3182136_3183984_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572624.1|3184244_3188705_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295931.1|3188704_3189409_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|3189389_3190712_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|3190708_3191494_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3191629_3192409_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436907.1|3192385_3193279_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011612.1|3193432_3194179_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3194175_3194358_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056536.1|3194409_3195642_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570555.1|3195678_3196665_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551266.1|3196661_3198410_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705724.1|3198446_3200711_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3200917_3201202_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3201361_3203035_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3203145_3203829_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001305926.1|3204001_3204766_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000445212.1|3204935_3206219_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057148.1|3206289_3207378_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
WP_000642852.1|3207576_3208269_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001305927.1|3208398_3210159_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3210564_3211422_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292809.1|3211476_3213759_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000468308.1|3214078_3214297_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_047627481.1|3214378_3215542_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	5.4e-205
WP_025693440.1|3215541_3216021_-|tail	phage tail protein	tail	M1TAU1	Escherichia_phage	98.7	3.3e-84
WP_095454396.1|3216035_3218483_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.8	0.0e+00
WP_000785970.1|3218475_3218595_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|3218627_3218903_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|3218959_3219478_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286727.1|3219490_3220681_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_000569052.1|3220941_3221634_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	98.3	8.0e-124
WP_001406733.1|3222125_3222305_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_000002748.1|3222357_3222636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032139879.1|3222856_3223384_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	90.3	1.6e-87
WP_032139880.1|3223385_3225560_-	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	79.9	0.0e+00
WP_001285325.1|3225570_3226101_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121497.1|3226093_3227002_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_000127163.1|3227006_3227354_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_047627492.1|3227350_3227986_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	96.7	5.5e-111
WP_095454397.1|3228092_3229337_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_032151671.1|3229437_3229887_-	phage virion morphogenesis protein	NA	A0A218M4K4	Erwinia_phage	63.3	5.3e-44
WP_000917186.1|3229879_3230347_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_072276370.1|3230309_3230483_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_061091349.1|3230454_3230880_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	6.8e-65
WP_095454398.1|3230867_3231293_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	6.1e-58
WP_001144101.1|3231307_3231805_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|3231804_3232086_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|3232089_3232293_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_089624459.1|3232292_3232802_-|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	99.4	7.3e-90
WP_000203450.1|3232901_3233645_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.0	5.6e-123
WP_001248590.1|3233648_3234722_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	98.9	3.7e-200
WP_001085952.1|3234780_3235635_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156847.1|3235808_3237581_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_000038161.1|3237580_3238615_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_095454399.1|3239133_3241353_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_095454400.1|3241600_3243868_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_033553688.1|3243857_3244133_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	8.6e-45
WP_001113269.1|3244129_3244354_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	5.0e-35
WP_001277904.1|3244353_3244656_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	99.0	5.9e-47
WP_000557701.1|3244655_3244880_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217670.1|3244943_3245444_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001389237.1|3245621_3245978_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001389238.1|3246086_3246386_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_000023390.1|3246479_3247475_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000067979.1|3247506_3248304_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000918504.1|3248513_3249944_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109299.1|3250153_3251302_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3251616_3252243_+	hydrolase	NA	NA	NA	NA	NA
WP_000534641.1|3252278_3253142_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|3253143_3253761_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850300.1|3253771_3256216_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|3256454_3257747_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_095454401.1|3257837_3259181_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	3.6e-80
WP_001295343.1|3259191_3259803_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077077.1|3259961_3264068_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
3260993:3261013	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_000228473.1|3264202_3264697_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3265242_3266208_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_095454402.1|3266330_3268097_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202195.1|3268097_3269819_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	3.8e-21
WP_001241678.1|3269860_3270565_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3270849_3271068_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012602745.1|3271712_3272111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934041.1|3272228_3274505_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3274535_3274856_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 7
NZ_CP023142	Escherichia coli strain CFSAN061770 chromosome, complete genome	5292297	3402085	3440511	5292297	protease,head,portal,holin,integrase,capsid,terminase,tail,plate	Shigella_phage(62.0%)	55	3401728:3401742	3440585:3440599
3401728:3401742	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_000931964.1|3402085_3402448_+	GtrA family protein	NA	U5P0S6	Shigella_phage	86.7	3.9e-53
WP_000703625.1|3402444_3403374_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	89.4	6.3e-156
WP_000561375.1|3403360_3404848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071781723.1|3405061_3405178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593801.1|3405149_3405434_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	62.5	3.5e-17
WP_000554711.1|3405554_3406487_-	carbohydrate kinase	NA	U5P0I1	Shigella_phage	95.2	2.1e-50
WP_000383564.1|3406490_3407075_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	3.5e-112
WP_000785292.1|3407065_3408124_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	3.6e-200
WP_000424738.1|3408110_3408536_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	8.8e-81
WP_001259080.1|3408535_3409084_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	99.5	6.6e-97
WP_000999486.1|3409083_3410163_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	5.3e-207
WP_001309364.1|3410159_3411536_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	98.5	1.4e-252
WP_000774666.1|3411560_3413468_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	95.0	0.0e+00
WP_000571713.1|3413552_3413876_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_000090992.1|3413872_3414229_-	hypothetical protein	NA	U5P076	Shigella_phage	98.3	2.0e-62
WP_000155695.1|3414228_3415725_-|tail	tail sheath protein	tail	S5FKL0	Shigella_phage	98.2	7.0e-274
WP_000497751.1|3415708_3415879_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779294.1|3415887_3416448_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000224835.1|3416444_3416951_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000702391.1|3416925_3417336_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	9.7e-69
WP_000927711.1|3417332_3417656_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601362.1|3417658_3417859_-	hypothetical protein	NA	S5FNU1	Shigella_phage	95.5	8.4e-26
WP_000257523.1|3417907_3419113_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	2.7e-223
WP_001193628.1|3419127_3419778_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.1	3.1e-117
WP_000466243.1|3419755_3420997_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	1.4e-240
WP_000605604.1|3420996_3421179_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_122989542.1|3421190_3422687_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	6.3e-299
WP_000929176.1|3422920_3423415_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.1e-87
WP_001135200.1|3423540_3423891_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	2.8e-64
WP_001309363.1|3424309_3424567_-	hypothetical protein	NA	Q8SBD8	Shigella_phage	89.3	3.2e-33
WP_001309362.1|3424451_3424844_-	DUF2570 family protein	NA	Q8SBD9	Shigella_phage	94.6	2.3e-59
WP_001148534.1|3424827_3425304_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	100.0	7.5e-89
WP_001120497.1|3425307_3425634_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	1.5e-56
WP_000355468.1|3425925_3427101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150292.1|3427103_3428318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205470.1|3428297_3428654_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_001309360.1|3428671_3429661_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
WP_157729184.1|3429668_3430478_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	98.5	3.8e-149
WP_000767129.1|3430497_3430887_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	1.6e-68
WP_000210149.1|3430883_3431210_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	5.0e-52
WP_001309358.1|3431209_3431698_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	93.2	4.2e-79
WP_000104945.1|3431694_3432636_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
WP_001250269.1|3432625_3432805_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515848.1|3432980_3433532_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	96.7	4.6e-98
WP_001191675.1|3433524_3433785_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	2.1e-40
WP_001353346.1|3433882_3434575_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	1.9e-125
WP_000549623.1|3434922_3435129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016392.1|3435100_3435535_-	hypothetical protein	NA	U5P096	Shigella_phage	99.3	7.1e-78
WP_000135680.1|3436003_3436366_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081252.1|3436431_3437256_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	1.3e-149
WP_000008192.1|3437383_3437920_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.9	6.3e-100
WP_000335008.1|3437910_3438789_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.8	2.4e-165
WP_000206057.1|3438785_3439130_+	hypothetical protein	NA	U5P0J0	Shigella_phage	79.5	2.0e-30
WP_001303849.1|3439244_3439463_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533656.1|3439440_3440511_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.5e-201
3440585:3440599	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 8
NZ_CP023142	Escherichia coli strain CFSAN061770 chromosome, complete genome	5292297	3631142	3711349	5292297	protease,head,portal,lysis,integrase,capsid,terminase,tail,transposase	Enterobacteria_phage(49.15%)	91	3664823:3664869	3711363:3711409
WP_001300563.1|3631142_3632255_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956465.1|3632331_3632484_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001130641.1|3632937_3634056_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682524.1|3634121_3634370_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360972.1|3634434_3634818_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351480.1|3634896_3635550_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3635657_3636905_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000786320.1|3636972_3638349_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573896.1|3638450_3641594_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.3	2.2e-59
WP_000717115.1|3641605_3642829_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709877.1|3642844_3643177_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074191.1|3643200_3644583_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3644739_3645423_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253810.1|3645412_3646861_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_032194044.1|3647216_3647528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000582607.1|3647553_3648594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587252.1|3648705_3649746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001305541.1|3649799_3650114_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_001309965.1|3650361_3651156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001243225.1|3651248_3651560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001015686.1|3653123_3653585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309331.1|3653602_3653872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420757.1|3653950_3655087_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001057457.1|3655907_3656354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169380.1|3656381_3656810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829608.1|3657029_3657200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322695.1|3659971_3662944_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_095454441.1|3662944_3663835_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177464.1|3664017_3664779_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3664823:3664869	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201810.1|3665292_3666246_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3666495_3667245_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355607.1|3667920_3668214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235985.1|3668224_3668929_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.1	6.6e-57
WP_000654147.1|3668938_3669220_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	1.2e-17
WP_000290535.1|3669216_3671586_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	43.7	9.3e-87
WP_000515681.1|3671646_3675144_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.5	0.0e+00
WP_000090891.1|3675203_3675836_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194783.1|3675772_3676516_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152511.1|3676521_3677220_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	1.2e-130
WP_000847366.1|3677219_3677549_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.6e-56
WP_000840287.1|3677545_3680101_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.0	0.0e+00
WP_000459479.1|3680093_3680528_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	2.2e-63
WP_000479145.1|3680509_3680932_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	9.1e-70
WP_001309909.1|3680947_3681688_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	2.5e-131
WP_000683122.1|3681695_3682091_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	3.2e-69
WP_000975078.1|3682087_3682666_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000752994.1|3682677_3683031_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000160184.1|3683042_3683438_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	1.8e-56
WP_000118196.1|3683479_3684505_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.3	1.2e-184
WP_000201478.1|3684560_3684893_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_001542142.1|3684902_3686234_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	96.8	6.7e-228
WP_016238988.1|3686214_3687816_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
WP_000198149.1|3687812_3688019_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027256.1|3688015_3689941_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453611.1|3689915_3690461_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001309326.1|3690849_3691083_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079510.1|3691140_3691551_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	9.8e-53
WP_001139678.1|3691902_3692055_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3692083_3692290_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001135256.1|3692506_3693004_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
WP_000839596.1|3693003_3693219_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|3693792_3694875_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204780.1|3695064_3695448_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971055.1|3695533_3695674_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099522.1|3695670_3696033_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
WP_000774491.1|3696029_3696320_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.7e-46
WP_000224914.1|3696312_3696483_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053016.1|3696482_3696938_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.2	2.2e-61
WP_001309322.1|3696934_3697036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990010.1|3697132_3697642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211451.1|3697877_3698486_-	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	42.1	6.3e-32
WP_000195116.1|3699298_3700801_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	53.7	3.8e-62
WP_000145913.1|3701049_3701352_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	96.8	2.7e-44
WP_000788915.1|3701348_3702050_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	97.9	9.3e-128
WP_024185956.1|3702046_3702976_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.0e-111
WP_001182772.1|3703062_3703602_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_001067458.1|3703671_3703902_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3704006_3704696_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000414677.1|3704777_3705251_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	61.6	1.3e-53
WP_001288169.1|3705247_3706180_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	54.4	2.8e-87
WP_001309317.1|3706578_3706869_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.0e-27
WP_000995439.1|3706944_3707241_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3707246_3708032_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186792.1|3708028_3708709_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
WP_000149534.1|3708705_3708888_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	9.1e-27
WP_000548530.1|3708860_3709052_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_077252933.1|3709062_3709350_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.6e-47
WP_000763385.1|3709442_3709661_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3709708_3709987_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|3709958_3710330_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_001299447.1|3710185_3711349_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
3711363:3711409	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 9
NZ_CP023142	Escherichia coli strain CFSAN061770 chromosome, complete genome	5292297	4072675	4099462	5292297	plate,transposase	Shigella_phage(20.0%)	23	NA	NA
WP_085949589.1|4072675_4073888_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_000006263.1|4074047_4074545_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000093873.1|4074721_4075471_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001225679.1|4075771_4076512_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4076482_4077250_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4077455_4078034_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|4078273_4080718_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|4080760_4081234_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118007.1|4081387_4082158_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001306803.1|4082429_4082918_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000227713.1|4083008_4083512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000420763.1|4083631_4084768_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001306804.1|4085214_4086465_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	3.6e-29
WP_000400155.1|4086996_4087953_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_157729185.1|4088265_4089228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001306805.1|4089342_4090914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000446997.1|4090935_4091775_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_001306807.1|4091774_4093733_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	1.9e-24
WP_001142963.1|4093953_4094472_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000041478.1|4095174_4095678_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000111580.1|4095700_4097185_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001189669.1|4097189_4097615_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000863395.1|4097620_4099462_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
NZ_CP023142	Escherichia coli strain CFSAN061770 chromosome, complete genome	5292297	4356272	4434518	5292297	protease,portal,lysis,tRNA,integrase,terminase,tail	Enterobacteria_phage(43.64%)	83	4386443:4386458	4437734:4437749
WP_001223149.1|4356272_4356959_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4357358_4357499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4357594_4358311_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920350.1|4358370_4359723_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219570.1|4359780_4361205_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	4.2e-10
WP_001188679.1|4361204_4361894_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4361906_4362380_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4362590_4363460_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4363456_4364104_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001309202.1|4364155_4364671_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068678.1|4364664_4364991_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409419.1|4365080_4367018_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_024176316.1|4367228_4368896_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	4.9e-42
WP_000566334.1|4369051_4369939_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000023619.1|4370072_4371083_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000762718.1|4371102_4371900_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001140838.1|4371925_4372342_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_000848790.1|4372499_4372712_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001322566.1|4372760_4372946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000093813.1|4373172_4374405_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029698.1|4374425_4375808_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132956.1|4375856_4376825_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_095454393.1|4376930_4377575_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105844.1|4377602_4378619_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224877.1|4379061_4379781_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4379837_4381061_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|4381112_4382435_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001298497.1|4382660_4383440_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143200.1|4383697_4385248_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088427.1|4385219_4386083_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
4386443:4386458	attL	GCGTCGCATCTGGCAT	NA	NA	NA	NA
WP_000563029.1|4386601_4387381_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000531527.1|4387377_4388451_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4388572_4388734_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4388860_4389466_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|4389858_4391445_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217546.1|4391664_4391913_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
WP_024176333.1|4392258_4393491_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	99.5	1.1e-237
WP_064580195.1|4393619_4394204_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_095454392.1|4394203_4397227_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_001230352.1|4397291_4397891_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
WP_095597209.1|4397957_4401356_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.7	0.0e+00
WP_023277304.1|4401416_4402064_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_047606715.1|4401961_4402705_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	3.1e-150
WP_001152385.1|4402710_4403409_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447253.1|4403418_4403748_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_072748579.1|4403747_4406813_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.5	0.0e+00
WP_001161009.1|4406784_4407114_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001372042.1|4407122_4407509_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	100.0	4.3e-66
WP_053290591.1|4407569_4408313_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	1.7e-132
WP_023148639.1|4408323_4408725_-|tail	phage tail protein	tail	K7PJP5	Enterobacteria_phage	100.0	1.1e-72
WP_064580273.1|4408721_4409300_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.0	1.0e-100
WP_001283152.1|4409311_4409587_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_001097039.1|4409579_4409903_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_095454450.1|4409989_4412017_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.8	0.0e+00
WP_072748693.1|4411994_4413470_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.0	3.4e-281
WP_001072975.1|4413469_4413682_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001401096.1|4413678_4415781_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.4	0.0e+00
WP_023363274.1|4415780_4416275_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	4.9e-83
WP_001139675.1|4416950_4417103_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001341210.1|4417090_4417558_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|4417554_4418052_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|4418051_4418267_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4418334_4419387_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|4419537_4419741_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001047110.1|4419994_4420747_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001404200.1|4420760_4421750_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.5e-195
WP_001061444.1|4421757_4422567_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001398927.1|4422586_4422976_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_000210170.1|4422972_4423299_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001373594.1|4423298_4423793_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	100.0	3.9e-88
WP_023148686.1|4423789_4424620_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	94.9	6.3e-115
WP_001446924.1|4424616_4424841_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.6	7.0e-37
WP_001555700.1|4424845_4425682_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	98.2	3.9e-149
WP_000515860.1|4425678_4426230_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_000649477.1|4426273_4426474_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859460.1|4426564_4427239_+	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
WP_001398518.1|4427907_4428270_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	3.3e-60
WP_001404195.1|4428335_4429160_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.3	1.0e-149
WP_001398520.1|4429287_4429824_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	5.3e-99
WP_001404194.1|4429814_4430177_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
WP_001399670.1|4430176_4430797_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	90.8	6.3e-112
WP_001399668.1|4431531_4433127_+	deoxycytidylate deaminase	NA	NA	NA	NA	NA
WP_023148581.1|4433279_4434518_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	97.8	8.5e-233
4437734:4437749	attR	GCGTCGCATCTGGCAT	NA	NA	NA	NA
>prophage 11
NZ_CP023142	Escherichia coli strain CFSAN061770 chromosome, complete genome	5292297	4526064	4593246	5292297	transposase	Stx2-converting_phage(21.43%)	59	NA	NA
WP_001322394.1|4526064_4527081_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_157729188.1|4527231_4527420_-	phospholipase	NA	NA	NA	NA	NA
WP_001054376.1|4529986_4530244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309181.1|4530255_4530801_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000354251.1|4530856_4531603_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000010829.1|4532388_4533510_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_024165496.1|4533503_4533785_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000460843.1|4533796_4535110_+	PTS system EIIC permease component	NA	NA	NA	NA	NA
WP_000118626.1|4535122_4535929_+	BtpA family protein SgcQ	NA	NA	NA	NA	NA
WP_000606406.1|4536059_4536491_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000600622.1|4536502_4537135_+	ribulose-phosphate 3 epimerase family protein	NA	NA	NA	NA	NA
WP_000082780.1|4537151_4537934_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000251798.1|4538236_4539025_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000714563.1|4539029_4539935_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000116326.1|4539945_4541913_+	YjhG/YagF family D-xylonate dehydratase	NA	NA	NA	NA	NA
WP_001128363.1|4542019_4543369_+	GntP family permease	NA	NA	NA	NA	NA
WP_000373366.1|4543715_4544702_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000471147.1|4544742_4545747_-	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_000439687.1|4545850_4546492_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001022014.1|4546522_4547638_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000132327.1|4547647_4548907_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_001295723.1|4549834_4550203_-	antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|4550365_4550587_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|4550649_4551126_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855064.1|4551141_4551615_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
WP_001234653.1|4551956_4552775_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	6.1e-46
WP_001323397.1|4552929_4553088_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000820498.1|4553158_4556278_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|4556649_4557522_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001297234.1|4558752_4560237_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000813451.1|4560558_4561161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949589.1|4561327_4562540_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_123055412.1|4562510_4562795_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000221515.1|4564246_4564816_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|4565075_4565477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|4565464_4565899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|4566253_4566634_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|4566630_4566978_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998017.1|4567027_4568413_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.5	6.9e-260
WP_000823243.1|4568651_4570010_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937736.1|4570388_4570580_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_000555337.1|4570742_4571000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4572750_4573272_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4573268_4574222_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188283.1|4574308_4576633_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879155.1|4576677_4577580_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|4577576_4578575_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684852.1|4578571_4579528_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
WP_000175457.1|4579528_4580296_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4580852_4581110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|4582368_4583520_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001293436.1|4584576_4586574_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625671.1|4586636_4587050_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085948656.1|4586984_4588152_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000254999.1|4588465_4588723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594405.1|4588775_4588901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611568.1|4588943_4590062_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000179691.1|4590073_4591291_-	MFS transporter	NA	NA	NA	NA	NA
WP_000547191.1|4591917_4593246_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP023142	Escherichia coli strain CFSAN061770 chromosome, complete genome	5292297	4634513	4696239	5292297	protease,integrase,transposase	Acidithiobacillus_phage(20.0%)	55	4631388:4631404	4695980:4695996
4631388:4631404	attL	GTACCGTCACGATCGCG	NA	NA	NA	NA
WP_001162171.1|4634513_4635866_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4635959_4636511_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_024176287.1|4636661_4638035_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|4638210_4639209_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|4639241_4640237_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|4640223_4641246_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205796.1|4641259_4642762_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	2.4e-11
WP_000265933.1|4643071_4644028_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|4644337_4644868_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_001219160.1|4645247_4645589_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060914.1|4645591_4649371_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269337.1|4649367_4651101_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001305659.1|4651306_4651945_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4652267_4653611_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4653671_4653878_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|4654202_4654760_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|4654749_4655490_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589436.1|4655679_4657623_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084623.1|4657751_4658132_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560581.1|4658219_4659080_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001305661.1|4659188_4660154_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331457.1|4660261_4660924_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000936773.1|4660968_4662453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000240846.1|4662486_4663650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000228342.1|4663783_4665187_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4665495_4666116_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|4666333_4666972_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_001309930.1|4667118_4668315_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.7	1.3e-206
WP_001526538.1|4668322_4668937_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	8.9e-42
WP_001305664.1|4669379_4670174_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4670244_4670694_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4670735_4670963_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4670967_4671282_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216677.1|4671288_4671684_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492918.1|4672010_4672286_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170835.1|4672415_4673102_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_086669528.1|4673101_4673917_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_053287687.1|4674080_4675274_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	46.9	5.5e-96
WP_053287686.1|4675682_4676339_-	EcsC family protein	NA	NA	NA	NA	NA
WP_053287685.1|4676709_4677063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282653.1|4678001_4678757_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_023181050.1|4678773_4680309_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_053287683.1|4680975_4681329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053287682.1|4681375_4681948_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_053287681.1|4682271_4682523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000555617.1|4684100_4685015_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_095597212.1|4685014_4685842_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.9	1.9e-10
WP_001101719.1|4685838_4686696_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_053287820.1|4689199_4689634_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053287821.1|4690127_4690877_-	epimerase	NA	NA	NA	NA	NA
WP_053287822.1|4690888_4691179_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_053287823.1|4691226_4692102_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_053287824.1|4692130_4693153_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_053287825.1|4693164_4694178_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000343728.1|4695030_4696239_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	7.4e-48
4695980:4695996	attR	GTACCGTCACGATCGCG	NA	NA	NA	NA
>prophage 1
NZ_CP023143	Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence	228947	207002	227904	228947	transposase,integrase	Salmonella_phage(40.0%)	21	209174:209187	225347:225360
WP_000844627.1|207002_207245_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138014.1|207302_210269_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
209174:209187	attL	CGCTGACGCTCTCG	NA	NA	NA	NA
WP_001161490.1|210272_210833_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000454193.1|211008_211359_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|211561_212575_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|212741_213584_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000050382.1|213679_214288_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|214345_215137_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_095454464.1|215398_216658_+	CmlA family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|216750_217542_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|217711_218044_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000034420.1|219223_220015_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|220483_220729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|220766_221630_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_011264039.1|221775_222015_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_001067855.1|222087_222792_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_095597217.1|222782_223025_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|223136_224630_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|224660_225545_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
225347:225360	attR	CGAGAGCGTCAGCG	NA	NA	NA	NA
WP_023300759.1|225761_226976_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001067856.1|227199_227904_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
>prophage 1
NZ_CP023144	Escherichia coli strain CFSAN061770 plasmid pEGY2, complete sequence	103234	34740	96413	103234	integrase,transposase	Escherichia_phage(21.43%)	56	93963:93977	96692:96706
WP_023181050.1|34740_36276_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	6.6e-102
WP_095454459.1|36541_36859_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	50.9	3.1e-06
WP_000117633.1|37323_37824_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.6	1.9e-05
WP_000218850.1|38553_38988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001578094.1|39080_39347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032211189.1|39411_40290_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	1.1e-66
WP_029400586.1|40351_40582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148285.1|40612_40864_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024187407.1|40897_41095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021532736.1|41443_42292_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000157103.1|42377_42713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291058.1|42945_43278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095454458.1|43289_45992_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_033810804.1|46060_46309_+	cell growth regulatory protein MazE	NA	NA	NA	NA	NA
WP_032354044.1|46308_46653_+	MazF family transcriptional regulator	NA	NA	NA	NA	NA
WP_085949154.1|47123_48271_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_045148228.1|50008_50254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157729189.1|50450_51678_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.0e-170
WP_157729190.1|53210_53381_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.2e-06
WP_095597222.1|53346_54509_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	95.6	4.3e-162
WP_021532733.1|57102_58227_-	DsbC family protein	NA	NA	NA	NA	NA
WP_065898610.1|58223_59486_-	IncI1-type conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_065898726.1|60150_60618_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.7	8.9e-18
WP_039079279.1|62037_62802_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_065898756.1|63828_64599_-	ribonuclease Z	NA	A0A0A0RUN7	Bacillus_phage	38.5	1.8e-07
WP_065898755.1|64816_65866_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	2.1e-27
WP_095454416.1|65895_67035_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_039079274.1|67226_68057_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_095454417.1|68071_68917_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_095454415.1|69015_69438_+	LysR family transcriptional regulator	NA	A0A2L1IV26	Escherichia_phage	100.0	1.1e-06
WP_095454470.1|70250_72416_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_000650755.1|72488_73058_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_053287749.1|73054_74260_-	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_095454469.1|74217_74838_-	conjugal transfer protein TraV	NA	NA	NA	NA	NA
WP_095454468.1|74837_77882_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_095454467.1|78057_78438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380400.1|78437_78797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072668202.1|78851_79670_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001277575.1|79584_79836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021532718.1|79892_80291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001379391.1|80337_80865_-	conjugal transfer protein TraQ	NA	NA	NA	NA	NA
WP_065203151.1|80864_81578_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_021532716.1|81574_82906_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_021532715.1|82909_83884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021532714.1|83894_84590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086795407.1|84601_84952_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_086795406.1|84968_89000_-	DNA primase	NA	A0A1B0VML8	Pseudomonas_phage	29.8	3.5e-17
WP_000817799.1|89063_89354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021532711.1|89350_90499_-	plasmid transfer ATPase TraJ	NA	NA	NA	NA	NA
WP_000848138.1|90482_91319_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_001081199.1|91315_91768_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_077896580.1|92126_93329_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000804089.1|93418_94240_-	hypothetical protein	NA	NA	NA	NA	NA
93963:93977	attL	ATGATGTGTTCTGTC	NA	NA	NA	NA
WP_000695052.1|94499_94820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065898789.1|94911_95202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065203201.1|95243_96413_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	43.7	1.9e-48
96692:96706	attR	GACAGAACACATCAT	NA	NA	NA	NA
>prophage 1
NZ_CP023145	Escherichia coli strain CFSAN061770 plasmid pEGY3, complete sequence	87173	3254	41189	87173	protease,integrase,transposase	Escherichia_phage(41.67%)	36	24237:24251	45113:45127
WP_000616807.1|3254_3908_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|4000_4258_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|4190_4592_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_023141679.1|4876_6202_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|6238_6943_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|8039_8900_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|8912_9455_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|9936_10128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|10133_10379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|10429_11566_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|14074_15379_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|15425_16130_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|16319_17135_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|17285_17990_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|18050_18887_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|18886_19690_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|19750_20566_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000240536.1|20873_21725_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|22480_23185_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|23231_23633_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|23782_24643_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
24237:24251	attL	AGTAAGTTGGCAGCA	NA	NA	NA	NA
WP_001067855.1|25227_25932_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_080282620.1|25822_26260_-	recombinase family protein	NA	M4QQC6	Vibrio_phage	51.1	1.3e-15
WP_000454193.1|26385_26736_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|26938_27952_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|28109_28583_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000428546.1|30863_31457_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_032338434.1|33895_34279_+	endoribonuclease	NA	NA	NA	NA	NA
WP_001022265.1|34311_35277_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000562172.1|35322_36075_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387467.1|36679_36964_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421272.1|36963_37239_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105060.1|37344_37638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|37833_39003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023141670.1|40202_40328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066953.1|40448_41189_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
45113:45127	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
