The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	2433	36485	4196031	transposase,coat	Bacillus_phage(55.56%)	38	NA	NA
WP_031600262.1|2433_3681_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_014479910.1|3810_4446_-	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.5	7.7e-73
WP_033881939.1|4858_6274_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_031600564.1|6375_7560_-	alanine racemase	NA	NA	NA	NA	NA
WP_014479913.1|7970_8396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479915.1|9314_9749_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
WP_033881937.1|10349_10613_-|coat	spore coat protein CotU	coat	NA	NA	NA	NA
WP_003231643.1|11019_11184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479918.1|11458_12298_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	5.6e-164
WP_121509411.1|12420_12708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479919.1|12750_13470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479920.1|13629_13986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479921.1|14231_14432_-|coat	spore coat protein CotC	coat	NA	NA	NA	NA
WP_003231634.1|14606_14795_-	twin-arginine translocase TatAC	NA	NA	NA	NA	NA
WP_009967329.1|15048_15447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231627.1|15512_15947_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_003231626.1|16253_16442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479929.1|19102_19909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479930.1|19913_20546_+	DUF4166 domain-containing protein	NA	NA	NA	NA	NA
WP_014479931.1|20527_22168_+	YndJ family transporter	NA	NA	NA	NA	NA
WP_069837523.1|22796_23555_+	gamma-polyglutamate hydrolase PghL	NA	O64134	Bacillus_phage	52.4	1.3e-53
WP_031600569.1|23581_24121_-	YndM family protein	NA	NA	NA	NA	NA
WP_014479937.1|24239_24659_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	66.1	2.0e-40
WP_003238209.1|25208_25826_-	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	2.5e-15
WP_003231598.1|25975_26293_+	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_014479938.1|26311_26965_+	recombinase family protein	NA	NA	NA	NA	NA
WP_003231595.1|27028_27262_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_069837524.1|27430_29434_+	transketolase	NA	NA	NA	NA	NA
WP_003231591.1|29586_30033_+	sporulation inhibitor of replication protein SirA	NA	NA	NA	NA	NA
WP_003221221.1|30118_30337_+	YneF family protein	NA	NA	NA	NA	NA
WP_010886518.1|30410_30584_-	aspartyl-phosphate phosphatase YnzD	NA	NA	NA	NA	NA
WP_003231585.1|30803_31511_+	cytochrome c-type biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_003245707.1|31599_31962_+	response regulator	NA	NA	NA	NA	NA
WP_014478984.1|32088_33441_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_010886519.1|33618_34110_+	CcdC family protein	NA	NA	NA	NA	NA
WP_087614160.1|34168_35319_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_003231580.1|35430_35859_-	DUF2621 domain-containing protein	NA	NA	NA	NA	NA
WP_072592538.1|36092_36485_-|coat	outer spore coat protein CotM	coat	NA	NA	NA	NA
>prophage 2
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	122209	180515	4196031	transposase,holin	Bacillus_phage(63.64%)	60	NA	NA
WP_080480857.1|122209_122542_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.7	2.6e-27
WP_017697296.1|122581_122884_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	43.4	2.2e-17
WP_069837540.1|122889_123099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043857633.1|123424_124876_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
WP_069837541.1|124912_125611_-	expansin ExlX	NA	NA	NA	NA	NA
WP_004399503.1|125873_126551_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_069837542.1|129542_130724_-	oxalate decarboxylase	NA	NA	NA	NA	NA
WP_121509413.1|131152_131308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697449.1|131838_132336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041335477.1|132436_133348_-	VanW family protein	NA	NA	NA	NA	NA
WP_015251949.1|133691_134174_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_021481417.1|134183_134420_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069837543.1|134542_135337_+	DUF817 domain-containing protein	NA	NA	NA	NA	NA
WP_046160469.1|135454_136327_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015714066.1|136427_137306_+	DMT family transporter	NA	NA	NA	NA	NA
WP_046160470.1|137479_137911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837544.1|138175_138808_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_080480858.1|139063_139984_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	43.2	1.0e-57
WP_069837546.1|140443_140806_-	YobA family protein	NA	NA	NA	NA	NA
WP_003231381.1|140866_141079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021481426.1|141182_141446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837547.1|141744_144345_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	34.8	3.3e-45
WP_069837548.1|145011_145653_-	endo-1,4-beta-xylanase XynA	NA	NA	NA	NA	NA
WP_014477028.1|146280_146520_-	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.1	1.4e-19
WP_029318062.1|146690_147029_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	31.7	3.5e-08
WP_069837549.1|147078_147822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837550.1|148025_148226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837551.1|148267_148726_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_033881696.1|148762_148996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043857647.1|149410_149542_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	93.0	2.7e-17
WP_014480339.1|149811_151359_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014479891.1|151355_152114_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_033881213.1|152264_152516_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	96.4	1.0e-36
WP_033881218.1|152884_154312_-	serine hydrolase	NA	NA	NA	NA	NA
WP_033881214.1|154445_154676_+	membrane protein	NA	NA	NA	NA	NA
WP_014478926.1|154976_156101_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_095010827.1|156223_156493_-	hypothetical protein	NA	O64087	Bacillus_phage	81.5	1.5e-25
WP_087614174.1|156537_156762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837923.1|156796_157150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837552.1|158062_158311_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	86.4	2.3e-25
WP_046160477.1|158402_158840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160541.1|158930_159314_-	membrane protein	NA	O64087	Bacillus_phage	34.2	4.0e-08
WP_069837553.1|159906_160461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021481445.1|162020_162395_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.8	1.1e-26
WP_087614177.1|163504_164665_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.0	3.2e-32
WP_046160480.1|164945_165479_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046160481.1|165501_166353_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_052006225.1|166526_167672_-	ThiF family adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	21.1	4.3e-05
WP_033881552.1|167676_168507_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_080480860.1|168518_169751_-	MFS transporter	NA	NA	NA	NA	NA
WP_080480854.1|169834_171076_+|transposase	IS256-like element ISBsu2 family transposase	transposase	NA	NA	NA	NA
WP_033881859.1|173282_173642_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
WP_072592542.1|173901_173985_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_019712872.1|174273_174807_-	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	98.9	4.0e-99
WP_019712871.1|174842_175421_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	93.2	1.4e-100
WP_069837555.1|175476_175935_-	SMI1 / KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	84.9	1.1e-71
WP_041336410.1|176024_176483_-	type II toxin-antitoxin system antitoxin YobK	NA	NA	NA	NA	NA
WP_069837556.1|176492_178295_-	type II toxin-antitoxin system toxin ribonuclease YobL	NA	A0A1P8CWI7	Bacillus_phage	87.6	4.9e-221
WP_029318053.1|178393_178951_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.7	7.0e-102
WP_121509415.1|179078_180515_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.6	2.6e-07
>prophage 3
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	396041	402136	4196031		Staphylococcus_phage(66.67%)	8	NA	NA
WP_014480158.1|396041_396635_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
WP_014477220.1|396624_397380_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_014480159.1|397659_398184_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|398197_398572_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|398684_399149_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_038828558.1|399181_400378_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_014480161.1|400392_401040_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
WP_069837609.1|401050_402136_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
>prophage 4
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	653929	697406	4196031	transposase,coat,holin	Enterobacteria_phage(25.0%)	45	NA	NA
WP_014480339.1|653929_655477_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014479891.1|655473_656232_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_072592549.1|656824_656911_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_123772463.1|658323_658629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480344.1|659021_659501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881358.1|660117_660384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049832653.1|660522_660675_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	76.0	8.4e-18
WP_014480349.1|662162_662984_-	multidrug efflux transcriptional regulator BltR	NA	NA	NA	NA	NA
WP_029727180.1|663100_664303_+	multidrug efflux MFS transporter Blt	NA	NA	NA	NA	NA
WP_015714357.1|664471_664930_+	spermine/spermidine acetyltransferase	NA	NA	NA	NA	NA
WP_031600262.1|664962_666210_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_019712547.1|666455_667760_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_014477437.1|668049_668193_-	YrzO family protein	NA	NA	NA	NA	NA
WP_014480354.1|668210_669176_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014480355.1|669301_670168_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069837644.1|670287_671325_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	26.2	4.1e-15
WP_014480357.1|671412_672348_-	CDF family zinc transporter CzcD	NA	NA	NA	NA	NA
WP_014478926.1|672537_673662_-|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_046160626.1|674440_675763_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003245988.1|675927_676260_-	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
WP_069837645.1|676256_677021_-	azaleucine resistance protein AzlC	NA	NA	NA	NA	NA
WP_021480168.1|677033_677507_-	azlBCD operon transcriptional regulator AzlB	NA	NA	NA	NA	NA
WP_046381211.1|677840_678116_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_069837646.1|678787_679351_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_080480882.1|679578_679950_-	YrdB family protein	NA	NA	NA	NA	NA
WP_014480368.1|680761_681265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837647.1|681484_682336_-	aminoglycoside 6-adenylyltransferase AadK	NA	E4ZFP8	Streptococcus_phage	58.2	9.0e-93
WP_014480370.1|682731_683775_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_014480371.1|684122_684920_+	glutamate racemase	NA	NA	NA	NA	NA
WP_032726255.1|685300_686008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480339.1|686260_687808_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014479891.1|687804_688563_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_072175780.1|689067_689145_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_033881351.1|689431_689593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160629.1|689656_690415_-	ZinT family metal-binding protein	NA	NA	NA	NA	NA
WP_046160630.1|690548_691079_-	RNA polymerase sigma factor SigZ	NA	A0A1V0DZZ1	Clostridioides_phage	24.8	2.1e-07
WP_029318151.1|691214_692195_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014480377.1|692353_693169_-	chitosanase	NA	A0A223LHY0	Streptomyces_phage	33.2	3.7e-19
WP_003229850.1|693605_693869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038829669.1|694005_694821_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004398671.1|695227_695584_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_004399021.1|695636_695996_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_119123071.1|696267_696369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398984.1|696511_696898_-	VOC family protein	NA	NA	NA	NA	NA
WP_003229845.1|697160_697406_+|coat	spore coat protein F-like protein YraG	coat	NA	NA	NA	NA
>prophage 5
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	778668	832140	4196031	coat,tRNA,protease	uncultured_Mediterranean_phage(12.5%)	56	NA	NA
WP_003229725.1|778668_779814_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|779840_780869_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003222669.1|780898_781099_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229718.1|781091_782096_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003229717.1|782106_782712_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003229715.1|782850_783363_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_003246197.1|783410_784718_-	MFS transporter	NA	NA	NA	NA	NA
WP_015251559.1|784788_785817_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_024572252.1|786054_786702_+	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	5.4e-05
WP_003229707.1|786747_786870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881610.1|786954_787401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398683.1|787407_787548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480443.1|787711_789166_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_033881612.1|789206_789929_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014480445.1|790031_790628_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_014480446.1|790775_791939_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_014480447.1|792055_793162_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_014480448.1|793148_794018_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_014480449.1|793971_795567_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_033881608.1|795669_796857_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
WP_004398582.1|796816_797359_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_004398512.1|797383_798241_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|798257_798701_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003246161.1|798761_800048_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_014480451.1|800081_800660_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|800737_800860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|800980_801265_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|801277_801616_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|801618_801927_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_014480452.1|802073_802940_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_014480453.1|802932_803727_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_014480454.1|803876_804683_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|804684_805365_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|805417_805936_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003222609.1|805932_806805_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|806835_807849_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_014480455.1|807940_808636_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_014480456.1|808672_809242_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_014480457.1|809394_810393_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_072592551.1|810526_811273_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_014480460.1|811412_812705_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014480461.1|812764_815407_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
WP_003222590.1|815854_816046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480462.1|816064_817090_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_014480463.1|817122_818844_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_014480464.1|818974_820267_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_014480465.1|820296_821271_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014480466.1|821267_822056_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014480467.1|822045_822990_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|823022_823853_-	protein HemX	NA	NA	NA	NA	NA
WP_004399038.1|823860_825228_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014477563.1|825457_825955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|825976_826564_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014480468.1|826560_828885_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
WP_004398923.1|829065_830724_-|protease	Lon protease 2	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|830877_832140_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 6
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	1086224	1137216	4196031	coat,transposase,holin	Staphylococcus_phage(20.0%)	44	NA	NA
WP_014477741.1|1086224_1086629_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003229083.1|1086794_1087232_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	1.3e-47
WP_010886599.1|1087324_1087501_+	YtzI protein	NA	NA	NA	NA	NA
WP_014477743.1|1087494_1087932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003219361.1|1088051_1088525_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003229076.1|1088653_1088881_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	2.8e-25
WP_003229074.1|1088877_1089441_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003219346.1|1089534_1089783_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003229073.1|1089988_1091320_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_015384444.1|1091362_1092403_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003229069.1|1092456_1092615_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_069837708.1|1092633_1093521_-	manganese ABC transporter permease MntD	NA	NA	NA	NA	NA
WP_069837709.1|1093510_1094818_-	manganese ABC transporter permease MntC	NA	NA	NA	NA	NA
WP_017695441.1|1094823_1095576_-	manganese ABC transporter ATP-binding protein MntB	NA	G9BWD6	Planktothrix_phage	34.9	3.2e-17
WP_041337039.1|1095594_1096515_-	manganese ABC transporter substrate-binding protein/adhesin MntA	NA	NA	NA	NA	NA
WP_095010829.1|1096794_1097910_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_069837710.1|1097906_1099367_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.9	2.9e-75
WP_003229054.1|1099457_1100273_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_015714575.1|1100307_1101132_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_069837711.1|1101119_1102862_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_015251378.1|1102858_1104274_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_069837712.1|1104563_1105283_+	yteA family sporulation protein	NA	NA	NA	NA	NA
WP_069837713.1|1105291_1106110_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-51
WP_029946481.1|1106281_1107568_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.8	2.3e-71
WP_069837714.1|1107564_1108515_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.6	1.9e-30
WP_014480646.1|1108517_1109726_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014480647.1|1109813_1110242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480648.1|1110243_1111299_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_014480649.1|1111313_1112447_-|coat	spore coat protein CotSA	coat	NA	NA	NA	NA
WP_072592554.1|1112636_1113710_+|coat	spore coat kinase CotI	coat	NA	NA	NA	NA
WP_014480651.1|1113789_1114257_+	TspO/MBR family protein	NA	NA	NA	NA	NA
WP_014480652.1|1114287_1116684_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.2e-12
WP_014480653.1|1116670_1118125_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_004398841.1|1118121_1119153_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_003229018.1|1119176_1120319_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_069837715.1|1120315_1122199_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_003228966.1|1129866_1130445_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_014480655.1|1130486_1131008_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014480656.1|1131025_1132555_-	flotillin lipid rafts scaffold protein FloT	NA	A0A2I2L4B2	Orpheovirus	27.9	2.7e-07
WP_032727091.1|1132575_1133100_-	membrane protein	NA	NA	NA	NA	NA
WP_033881498.1|1133267_1133756_+	DinB family protein	NA	NA	NA	NA	NA
WP_014478984.1|1133874_1135227_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_069837716.1|1135341_1135920_-	molybdenum cofactor sulfurase	NA	NA	NA	NA	NA
WP_003243227.1|1136007_1137216_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
>prophage 7
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	1269465	1366175	4196031	coat,portal,protease,tail,holin,capsid,integrase,plate,terminase,transposase,head	Bacillus_phage(37.78%)	114	1310157:1310178	1347437:1347458
WP_069837738.1|1269465_1270485_-|coat	spore coat-associated protein CotNH	coat	NA	NA	NA	NA
WP_003243814.1|1270637_1271138_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.0	1.2e-41
WP_021480535.1|1271164_1271935_-	5' nucleotidase NucF	NA	NA	NA	NA	NA
WP_021480536.1|1271963_1272398_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003228682.1|1272421_1272697_-	YutD family protein	NA	NA	NA	NA	NA
WP_021480537.1|1272810_1273443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222888.1|1273458_1274355_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_014480753.1|1274589_1275570_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	37.3	3.0e-07
WP_015483652.1|1275597_1276365_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_014480755.1|1276437_1276743_-	YunC family protein	NA	NA	NA	NA	NA
WP_069837739.1|1276807_1278196_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_044052462.1|1278215_1279037_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003243895.1|1279054_1279903_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_015714653.1|1279940_1280288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837740.1|1280384_1281725_-	allantoinase	NA	NA	NA	NA	NA
WP_069837741.1|1281899_1283495_+	purine catabolism transcriptional regulator PucR	NA	NA	NA	NA	NA
WP_069837742.1|1283639_1284989_+	uric acid permease PucJ	NA	Q9KX94	Enterobacteria_phage	28.1	1.2e-25
WP_121509431.1|1284994_1286275_+	uric acid permease PucK	NA	Q9KX94	Enterobacteria_phage	30.0	7.6e-27
WP_021480543.1|1286295_1287780_+	urate oxidase	NA	NA	NA	NA	NA
WP_031315332.1|1287779_1288124_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_009968115.1|1288545_1288677_+	YhzE/YjcZ family sporulation protein YuzJ	NA	NA	NA	NA	NA
WP_014480766.1|1288882_1289404_-	xanthine dehydrogenase subunit E	NA	NA	NA	NA	NA
WP_014480767.1|1289394_1291632_-	xanthine dehydrogenase subunit D	NA	NA	NA	NA	NA
WP_069837744.1|1291632_1292466_-	xanthine dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_049139629.1|1292462_1293080_-	xanthine dehydrogenase accessory protein PucB	NA	NA	NA	NA	NA
WP_049139630.1|1293076_1294069_-	XdhC family protein	NA	NA	NA	NA	NA
WP_014480772.1|1294295_1295546_-	(S)-ureidoglycine--glyoxylate transaminase	NA	NA	NA	NA	NA
WP_069837745.1|1295562_1296801_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_032726822.1|1297246_1298113_+	ribonuclease	NA	NA	NA	NA	NA
WP_014480776.1|1298291_1299395_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	29.7	5.0e-19
WP_014480777.1|1299576_1300305_+	transcriptional regulator FrlR	NA	NA	NA	NA	NA
WP_003228626.1|1300329_1301184_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_014480780.1|1302096_1302975_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003243455.1|1303032_1304301_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069837746.1|1304381_1305368_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	23.6	1.9e-09
WP_003228617.1|1305582_1305957_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_069837747.1|1306059_1307178_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003228613.1|1307336_1307483_+	acid-soluble spore protein SspG	NA	NA	NA	NA	NA
WP_003243521.1|1307482_1307758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087614170.1|1307815_1308966_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_014480784.1|1309111_1309495_-	methylglyoxalase	NA	NA	NA	NA	NA
WP_033882108.1|1309604_1309883_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
1310157:1310178	attL	CCTATAGAACCTTCCATTTCGA	NA	NA	NA	NA
WP_069837932.1|1310621_1310810_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	50.0	3.2e-11
WP_069837748.1|1310969_1312742_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	54.7	1.6e-120
WP_069837749.1|1312754_1313216_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_069837750.1|1313266_1314208_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
WP_014480878.1|1314249_1314672_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
WP_014480879.1|1314725_1314896_-	XkdX family protein	NA	NA	NA	NA	NA
WP_031600923.1|1314892_1315192_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
WP_069837751.1|1315207_1316431_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	80.3	9.1e-179
WP_033881098.1|1318055_1319930_-	autolysin	NA	D6R400	Bacillus_phage	27.8	5.5e-50
WP_014479880.1|1319943_1320777_-|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.1	3.5e-33
WP_069837752.1|1320789_1324530_-	transglycosylase SLT domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	60.4	9.1e-105
WP_014479878.1|1324592_1324775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479877.1|1324786_1325149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479876.1|1325208_1325793_-	hypothetical protein	NA	U5U3Z7	Lactobacillus_phage	36.5	9.1e-28
WP_014479875.1|1325798_1326206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600548.1|1326202_1326595_-	hypothetical protein	NA	A0A0M5M1E5	Enterococcus_phage	37.9	3.0e-11
WP_014479873.1|1326594_1326921_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_014479872.1|1326910_1327204_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	33.0	2.6e-07
WP_014479871.1|1327258_1327642_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.8	1.4e-05
WP_043856934.1|1327669_1328872_-|capsid	phage major capsid protein	capsid	A0A2H4J824	uncultured_Caudovirales_phage	49.8	8.3e-76
WP_043856935.1|1328920_1329517_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.3	3.6e-48
WP_043856936.1|1329509_1330736_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.8	5.3e-70
WP_043856937.1|1330740_1330947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043857127.1|1330963_1332670_-|terminase	terminase large subunit	terminase	A0A2H4JC16	uncultured_Caudovirales_phage	42.8	1.9e-121
WP_043856938.1|1332662_1333157_-|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	36.1	9.1e-21
WP_043856939.1|1333390_1333603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837754.1|1334091_1334706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837755.1|1334842_1335403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220264.1|1335660_1336203_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	63.9	5.8e-61
WP_069837933.1|1336199_1336652_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	1.7e-37
WP_155118967.1|1337091_1337265_-	hypothetical protein	NA	Q38078	Bacillus_phage	91.2	3.7e-22
WP_069837757.1|1337261_1337648_-	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	36.2	3.8e-14
WP_080480871.1|1337644_1338124_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.8	1.0e-21
WP_069837758.1|1338123_1338816_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.7	6.7e-38
WP_048217676.1|1338978_1339227_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	44.9	6.0e-05
WP_069837759.1|1339223_1339631_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.0	2.9e-25
WP_048217677.1|1339627_1339912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048217678.1|1339955_1340153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003237439.1|1340400_1340541_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_048217679.1|1340648_1341197_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	39.3	4.6e-05
WP_153952969.1|1341348_1341510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048217680.1|1341496_1342351_-	ATP-binding protein	NA	Q4ZAS1	Staphylococcus_virus	29.4	2.2e-22
WP_069837760.1|1342301_1343141_-	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	51.4	1.4e-66
WP_069837761.1|1343133_1343364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157698117.1|1343657_1343909_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069837763.1|1344045_1344441_+	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	39.1	6.6e-06
WP_069837764.1|1344672_1344867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837765.1|1344863_1345988_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P786	Bacillus_phage	24.0	2.8e-09
WP_069837766.1|1346320_1347358_+|integrase	site-specific integrase	integrase	A0A223LI82	Staphylococcus_phage	47.1	1.8e-87
WP_003228608.1|1347432_1348830_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
1347437:1347458	attR	CCTATAGAACCTTCCATTTCGA	NA	NA	NA	NA
WP_003222809.1|1348850_1349294_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	38.7	1.9e-14
WP_003228604.1|1349283_1350504_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.8	3.4e-117
WP_014480787.1|1350503_1351817_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_014477918.1|1351834_1352620_-	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	23.6	6.5e-05
WP_003228600.1|1352813_1352951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014477920.1|1353144_1353522_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_069837767.1|1353606_1354431_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_003228593.1|1354444_1355113_-	methionine ABC transporter permease MetP	NA	NA	NA	NA	NA
WP_003242531.1|1355105_1356131_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	1.4e-31
WP_014480791.1|1356457_1356802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480792.1|1356908_1357229_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014480793.1|1357230_1357671_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_014480794.1|1357670_1357907_-	YusG family protein	NA	NA	NA	NA	NA
WP_003222781.1|1357962_1358346_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003222779.1|1358412_1358769_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	54.6	1.8e-23
WP_069837768.1|1358879_1360664_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_014480796.1|1360681_1361857_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_041337967.1|1361867_1364237_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003240817.1|1364411_1364558_+	YuzL family protein	NA	NA	NA	NA	NA
WP_041333072.1|1364582_1365491_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	42.2	3.9e-62
WP_003228567.1|1365584_1365830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222766.1|1365842_1366175_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 8
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	1447942	1515508	4196031	portal,protease,tail,holin,capsid,integrase,plate,terminase,transposase,head	Bacillus_phage(65.22%)	80	1459010:1459032	1498673:1498695
WP_014478984.1|1447942_1449295_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_033882081.1|1449419_1451831_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.8	1.3e-120
WP_003228406.1|1451914_1452124_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_003228404.1|1452199_1452505_-	copper-sensing transcriptional repressor CsoR	NA	NA	NA	NA	NA
WP_014480865.1|1452632_1453709_+	scyllo-inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_069837778.1|1454540_1456436_-	FUSC family protein	NA	NA	NA	NA	NA
WP_069837779.1|1456598_1457000_-	YvaD family protein	NA	NA	NA	NA	NA
WP_069837780.1|1456996_1457356_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_003243160.1|1457352_1457925_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003228388.1|1458035_1458830_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
1459010:1459032	attL	TATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_033882082.1|1459339_1459528_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	53.3	1.4e-11
WP_014480874.1|1459689_1461273_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.2e-75
WP_014480875.1|1461287_1461677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105778748.1|1462019_1462622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480877.1|1462661_1463603_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
WP_014480878.1|1463644_1464067_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
WP_014480879.1|1464120_1464291_-	XkdX family protein	NA	NA	NA	NA	NA
WP_031600923.1|1464287_1464587_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
WP_069837751.1|1464602_1465826_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	80.3	9.1e-179
WP_080480874.1|1465862_1467437_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	88.5	5.3e-264
WP_031600926.1|1467473_1469180_-	hypothetical protein	NA	D6R400	Bacillus_phage	81.8	9.4e-267
WP_031600927.1|1469191_1470031_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	83.2	8.5e-136
WP_033882059.1|1470030_1473909_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	81.0	0.0e+00
WP_017696308.1|1473921_1474101_-	hypothetical protein	NA	D6R3Z7	Bacillus_phage	68.5	1.6e-12
WP_003220222.1|1474103_1474442_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	70.5	3.0e-39
WP_017696306.1|1474496_1475108_-|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	89.7	7.9e-99
WP_031600930.1|1475108_1475489_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	66.1	2.6e-39
WP_033882058.1|1475485_1475869_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	86.6	2.9e-59
WP_033882056.1|1475861_1476233_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	68.3	3.5e-41
WP_031600933.1|1476165_1476513_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	87.0	2.0e-51
WP_031600934.1|1476528_1477020_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	69.1	1.3e-27
WP_031600935.1|1477048_1477363_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	68.8	6.8e-30
WP_033882054.1|1477378_1478581_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	71.5	3.3e-157
WP_003220242.1|1478617_1479244_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	92.8	1.8e-106
WP_033882052.1|1479233_1480481_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	86.5	1.3e-217
WP_033882051.1|1480486_1480702_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.6	1.3e-24
WP_069837781.1|1480714_1482424_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	92.1	0.0e+00
WP_017697674.1|1482423_1482957_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
WP_046160532.1|1483336_1483711_-	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	7.5e-60
WP_033881251.1|1483760_1484507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837782.1|1485037_1485667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123772464.1|1485817_1486183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220264.1|1486853_1487396_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	63.9	5.8e-61
WP_069837933.1|1487392_1487845_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	1.7e-37
WP_014480881.1|1488127_1488328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480882.1|1488324_1488744_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	61.2	1.6e-42
WP_014480883.1|1488740_1489073_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.3	8.3e-18
WP_069837783.1|1489072_1489729_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	46.0	5.8e-39
WP_014480885.1|1489846_1490104_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	41.7	6.6e-07
WP_014480886.1|1490100_1490508_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.8	1.3e-25
WP_014480887.1|1490504_1490822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480888.1|1490818_1491181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220282.1|1491223_1491421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003237439.1|1491667_1491808_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_014480892.1|1491915_1492464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480894.1|1492778_1493606_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.9	3.7e-35
WP_014480895.1|1493589_1494471_-	phage replisome organiser	NA	V9QKF6	Oenococcus_phage	33.1	6.8e-27
WP_033881245.1|1494463_1494682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881244.1|1494706_1494898_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.0	1.0e-12
WP_014480896.1|1494949_1495153_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014480897.1|1495387_1495786_+	helix-turn-helix transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	33.7	4.3e-05
WP_003220025.1|1499214_1499685_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
1498673:1498695	attR	TATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_069837784.1|1499829_1502169_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	43.4	1.3e-88
WP_003242610.1|1502187_1502928_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003220028.1|1503059_1503290_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014480904.1|1503438_1504212_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003220031.1|1504245_1504479_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003220034.1|1504630_1505038_+	transcriptional repressor RghR	NA	S6C481	Thermus_phage	64.8	1.9e-16
WP_014480905.1|1505067_1505487_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
WP_003242888.1|1505578_1505905_+	catDE operon transcriptional regulator CatR	NA	NA	NA	NA	NA
WP_014480906.1|1506032_1507733_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	8.0e-24
WP_069837785.1|1507773_1508454_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_041338970.1|1508470_1509391_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069837786.1|1509402_1510056_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_069837787.1|1510072_1511218_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	4.6e-15
WP_024571735.1|1511501_1512035_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046160851.1|1512066_1512741_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_080480888.1|1512758_1513670_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046160853.1|1513689_1514343_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_069837788.1|1514365_1515508_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	29.6	2.8e-12
>prophage 9
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	1836344	1929809	4196031	coat,protease,transposase,tRNA,bacteriocin	Bacillus_phage(20.0%)	93	NA	NA
WP_014478926.1|1836344_1837469_-|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_003227667.1|1837720_1838263_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_014481188.1|1838275_1838725_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_014481190.1|1838881_1839334_-	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_014481191.1|1839409_1839967_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_014481192.1|1840045_1841086_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	42.6	2.2e-61
WP_014481193.1|1841242_1841686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481194.1|1841752_1842427_-	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_014478265.1|1842567_1842930_+	UPF0715 family protein	NA	NA	NA	NA	NA
WP_069837821.1|1842946_1843234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227647.1|1843293_1844160_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003227645.1|1844161_1845232_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	3.1e-05
WP_003227644.1|1845357_1845744_+	VOC family protein	NA	NA	NA	NA	NA
WP_014481195.1|1845865_1846420_+	chromosome-anchoring protein RacA	NA	NA	NA	NA	NA
WP_003242497.1|1846452_1847412_-	AEC family transporter	NA	NA	NA	NA	NA
WP_080480877.1|1847493_1849242_-	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_014478269.1|1849480_1850068_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	45.9	3.1e-36
WP_003151132.1|1850156_1850357_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003221939.1|1850475_1851759_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_003227632.1|1851789_1851951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481197.1|1852165_1853131_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_003227628.1|1853161_1854451_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003227626.1|1854828_1855467_-	fructose-6-phosphate aldolase	NA	A0A0E3FQP8	Synechococcus_phage	45.0	7.3e-47
WP_003243339.1|1855586_1856444_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003227621.1|1856624_1856999_-	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	36.5	2.9e-11
WP_014481199.1|1857164_1857686_+	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_087614167.1|1857789_1858979_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	1.6e-31
WP_003227612.1|1859080_1860688_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	1.0e-153
WP_014481200.1|1860929_1861436_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_069837822.1|1861618_1862758_-	acyl-CoA dehydrogenase AcdA	NA	NA	NA	NA	NA
WP_069837823.1|1862754_1864872_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_017696271.1|1865026_1866223_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_069837824.1|1866235_1867198_+	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	34.2	1.7e-39
WP_003227597.1|1867278_1867551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227570.1|1869180_1870851_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014481216.1|1870847_1871276_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|1871590_1871722_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|1871678_1871831_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_069837825.1|1871855_1873202_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|1873214_1873376_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_069837826.1|1873372_1874092_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.6e-18
WP_069837827.1|1874084_1875395_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_080480890.1|1875384_1876545_+	insulinase family protein	NA	NA	NA	NA	NA
WP_069837829.1|1876549_1877830_+	insulinase family protein	NA	NA	NA	NA	NA
WP_069837830.1|1877826_1878528_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_069837831.1|1878533_1879910_-	YncE family protein	NA	NA	NA	NA	NA
WP_069837832.1|1881529_1882675_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	42.7	3.2e-77
WP_009968329.1|1882658_1882778_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_003227545.1|1883367_1884240_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|1884300_1885131_-	spermidine synthase	NA	NA	NA	NA	NA
WP_069837833.1|1885332_1887408_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_014478299.1|1887435_1887870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244446.1|1888008_1888527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243167.1|1888540_1889200_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|1889308_1889497_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003227535.1|1889539_1889959_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014481228.1|1890078_1891995_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.4	1.9e-143
WP_069837834.1|1892839_1894240_-	MFS transporter	NA	NA	NA	NA	NA
WP_003243988.1|1894239_1894710_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|1894821_1895322_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003243873.1|1895357_1896659_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|1896820_1897045_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003227516.1|1897259_1898036_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_033881831.1|1898179_1899070_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014481232.1|1899238_1900084_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_014481233.1|1900132_1901032_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003235941.1|1901177_1902149_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003227507.1|1902418_1903183_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_014481234.1|1903315_1904095_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_031601099.1|1904110_1905325_-	transaminase BacF	NA	NA	NA	NA	NA
WP_014481236.1|1905325_1906510_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_003242921.1|1906506_1907925_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_003243359.1|1907943_1908705_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_003244300.1|1908707_1909415_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|1909404_1910019_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_014481237.1|1910170_1911409_-	MFS transporter	NA	NA	NA	NA	NA
WP_015250969.1|1911618_1913031_-	amino acid permease	NA	NA	NA	NA	NA
WP_014481239.1|1913030_1914731_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014478322.1|1914804_1916352_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227482.1|1916578_1917853_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003227472.1|1918030_1918495_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_069837835.1|1918819_1919275_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_069837836.1|1919267_1920119_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.3	1.7e-38
WP_003244201.1|1920132_1921080_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_017696230.1|1921079_1921820_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	42.0	7.7e-48
WP_017696229.1|1921844_1922864_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_017696228.1|1922866_1923589_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_041054693.1|1923581_1924703_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_069837837.1|1924702_1925572_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069837838.1|1925572_1926742_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	27.2	6.5e-17
WP_069837839.1|1926762_1928184_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015250957.1|1928188_1928959_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_069837841.1|1929278_1929809_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
>prophage 10
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	2146844	2202357	4196031	transposase,protease,holin	Klosneuvirus(20.0%)	49	NA	NA
WP_009968420.1|2146844_2147249_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003227015.1|2147218_2147911_+	LrgB family protein	NA	NA	NA	NA	NA
WP_014481442.1|2147950_2148982_-	general stress protein 30	NA	NA	NA	NA	NA
WP_069837891.1|2149074_2150223_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
WP_046161064.1|2150418_2151150_+	gluconate operon transcriptional repressor GntR	NA	NA	NA	NA	NA
WP_014481444.1|2151142_2152684_+	gluconokinase	NA	NA	NA	NA	NA
WP_024571486.1|2152712_2154059_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_069837892.1|2154081_2155488_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	30.6	2.3e-32
WP_015483942.1|2155954_2156518_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_069837893.1|2156531_2158061_+	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.7e-33
WP_017697261.1|2158163_2159603_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_040081205.1|2160174_2160885_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014478516.1|2160975_2161698_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
WP_014481448.1|2161718_2162348_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_069837894.1|2162838_2164764_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_033880917.1|2165214_2165508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481451.1|2166045_2166486_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.4	3.4e-11
WP_014479891.1|2166905_2167664_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_014480339.1|2167660_2169208_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_069837895.1|2169337_2169778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031601173.1|2170185_2171649_+	hypothetical protein	NA	A0A0S2MYH0	Enterococcus_phage	36.0	1.0e-11
WP_121591334.1|2171883_2173770_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	21.8	6.6e-19
WP_031601176.1|2173747_2175781_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_087614191.1|2176297_2177448_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	98.9	9.8e-151
WP_033881129.1|2178146_2178410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880480.1|2178793_2179708_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
WP_014479904.1|2179704_2180022_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_031601181.1|2180286_2183409_-	DEAD/DEAH box helicase	NA	A7WKM3	Acidianus_filamentous_virus	26.4	6.6e-08
WP_014481455.1|2183365_2184274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003226975.1|2184561_2185041_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_014481456.1|2185121_2185292_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_017695771.1|2185476_2185890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080121227.1|2185923_2187150_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	28.9	1.5e-11
WP_069837897.1|2187212_2187383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017695774.1|2187487_2187736_-	DUF2651 domain-containing protein	NA	NA	NA	NA	NA
WP_069837898.1|2187751_2188915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837899.1|2188924_2189662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041337909.1|2189811_2190282_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003226961.1|2191489_2191606_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003226959.1|2191842_2192733_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	2.0e-26
WP_014481465.1|2192805_2194209_-	amino acid permease	NA	NA	NA	NA	NA
WP_033882007.1|2194431_2195637_-	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	2.0e-29
WP_015715048.1|2195968_2196571_-	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
WP_014481469.1|2196632_2197586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015715050.1|2197570_2198125_-	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
WP_014481470.1|2198308_2198944_-	SdpI family protein	NA	NA	NA	NA	NA
WP_015715052.1|2198943_2199228_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
WP_003244510.1|2199454_2200840_+	arginine utilization regulatory protein RocR	NA	NA	NA	NA	NA
WP_046161071.1|2201154_2202357_-|protease	serine protease HtrC	protease	W5SAB9	Pithovirus	40.4	5.9e-13
>prophage 11
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	2914605	3008333	4196031	coat,portal,protease,tail,capsid,holin,integrase,plate,terminase,transposase,head,tRNA	uncultured_Caudovirales_phage(27.08%)	102	2924989:2925007	2968250:2968268
WP_014479022.1|2914605_2915082_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_014479023.1|2915062_2915752_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_014479024.1|2915761_2916217_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003234076.1|2916209_2917250_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.9	8.8e-66
WP_069837285.1|2917475_2919404_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.3e-56
WP_003243499.1|2919529_2920042_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003234073.1|2920038_2920686_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003234072.1|2920707_2920881_+	sec-independent protein translocase protein TatAY	NA	NA	NA	NA	NA
WP_015252680.1|2920887_2921652_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.8	1.5e-22
WP_003225680.1|2921883_2922075_-	YdiK family protein	NA	NA	NA	NA	NA
WP_003234069.1|2922071_2922806_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003155970.1|2923044_2923329_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
WP_003234067.1|2923375_2925007_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	3.7e-159
2924989:2925007	attL	TATGGGCGGAATGATGTAA	NA	NA	NA	NA
WP_069837286.1|2925096_2926296_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	46.3	4.1e-83
WP_069837287.1|2926312_2926819_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	69.9	2.6e-63
WP_080480832.1|2927222_2927588_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	48.7	1.4e-21
WP_069837288.1|2927722_2927959_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069837289.1|2927971_2928286_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	45.3	2.4e-11
WP_069837290.1|2928282_2929011_+	phage regulatory protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	62.5	5.0e-84
WP_069837291.1|2929067_2929637_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	58.5	4.5e-64
WP_069837292.1|2929633_2929891_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	2.2e-10
WP_069837293.1|2929887_2930085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837294.1|2930187_2930538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041339356.1|2930537_2930729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837295.1|2930725_2931643_+	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	62.5	4.7e-87
WP_080480833.1|2931662_2932400_+	hypothetical protein	NA	A0A0A7RVR3	Clostridium_phage	44.9	2.3e-52
WP_069837297.1|2932596_2933289_+	DnaD domain protein	NA	A0A1L2JY26	Aeribacillus_phage	41.0	2.1e-07
WP_069837298.1|2933209_2934025_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.5	1.8e-61
WP_069837300.1|2934255_2934684_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	64.5	6.6e-44
WP_069837301.1|2934764_2934971_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	2.1e-19
WP_069837302.1|2935002_2935287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064911548.1|2935283_2935532_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	42.3	7.8e-05
WP_069837303.1|2935781_2936147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837304.1|2936160_2937363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069150170.1|2937616_2937802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837305.1|2937822_2938284_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	46.0	4.1e-23
WP_069837306.1|2938566_2938881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837307.1|2939282_2939648_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	9.4e-31
WP_019712672.1|2939875_2940391_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	2.8e-33
WP_069837308.1|2940387_2942097_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.5	6.0e-205
WP_041337954.1|2942109_2942301_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_069837309.1|2942301_2943609_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.4	9.3e-105
WP_069837310.1|2943556_2944294_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	57.1	2.6e-56
WP_069837311.1|2944333_2945620_+|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	45.2	2.7e-80
WP_069837312.1|2945646_2946099_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	57.1	1.3e-10
WP_046160658.1|2946116_2946419_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	4.7e-12
WP_069837313.1|2946408_2946723_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	37.3	1.3e-12
WP_060399178.1|2946722_2947121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837314.1|2947117_2947510_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_069837315.1|2947524_2948139_+|tail	phage tail protein	tail	J7KKC8	Streptococcus_phage	35.1	3.7e-11
WP_063695019.1|2948203_2948581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837316.1|2948780_2953268_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.5	1.2e-66
WP_046160652.1|2953261_2954101_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	3.4e-92
WP_069837317.1|2954115_2955819_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	55.5	4.3e-179
WP_069837318.1|2955870_2957427_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	82.9	1.5e-250
WP_069837319.1|2957463_2958585_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.5	7.5e-196
WP_031600553.1|2958600_2958900_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	2.0e-39
WP_031600554.1|2958896_2959067_+	XkdX family protein	NA	NA	NA	NA	NA
WP_069837320.1|2959118_2959331_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
WP_069837321.1|2959345_2959609_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.1e-24
WP_069837322.1|2959666_2960635_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	67.4	1.0e-63
WP_069837323.1|2960668_2961085_-	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	57.2	6.7e-41
WP_069837324.1|2961096_2962716_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.3e-75
WP_069837325.1|2962961_2963621_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	32.9	6.7e-11
WP_015715413.1|2963785_2964268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121509397.1|2964637_2964847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010329782.1|2964824_2965055_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_069837327.1|2966678_2967113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837328.1|2967118_2967838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837329.1|2967856_2968045_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	58.3	3.1e-14
WP_155119280.1|2968827_2968983_+	hypothetical protein	NA	NA	NA	NA	NA
2968250:2968268	attR	TATGGGCGGAATGATGTAA	NA	NA	NA	NA
WP_014479028.1|2969387_2970191_+	sce7726 family protein	NA	NA	NA	NA	NA
WP_014479029.1|2970191_2971136_+	sce7725 family protein	NA	NA	NA	NA	NA
WP_014479030.1|2971451_2973953_-	glucitol operon transcriptional regulator GutR	NA	NA	NA	NA	NA
WP_033881543.1|2974154_2975216_+	sorbitol dehydrogenase	NA	NA	NA	NA	NA
WP_014479032.1|2975289_2976681_+	MFS transporter	NA	NA	NA	NA	NA
WP_069837330.1|2976775_2977738_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_069837331.1|2977933_2978617_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_041336778.1|2978682_2979708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041352251.1|2979707_2980472_+	YgcG family protein	NA	NA	NA	NA	NA
WP_003234032.1|2980502_2981474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837332.1|2983128_2984550_+	myo-inositol transporter IolT	NA	NA	NA	NA	NA
WP_003234015.1|2984597_2985638_-	(R,R)-butanediol dehydrogenase	NA	NA	NA	NA	NA
WP_003234013.1|2986074_2986446_+	cell wall metabolism protein WalM	NA	NA	NA	NA	NA
WP_014479042.1|2986511_2987558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087614160.1|2987671_2988821_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_014479044.1|2988881_2989040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003234008.1|2989229_2989439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479045.1|2989521_2990337_-	alpha/beta hydrolase	NA	H9NCP0	Mycobacterium_phage	30.8	2.4e-10
WP_014479048.1|2991421_2992963_-|coat	outer spore coat copper-dependent laccase CotA	coat	NA	NA	NA	NA
WP_069837333.1|2993114_2994524_-	GABA permease	NA	NA	NA	NA	NA
WP_032678949.1|2994561_2994849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015382984.1|2994922_2995795_+	manganese transporter MneS	NA	NA	NA	NA	NA
WP_069837334.1|2995945_2996908_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_041056883.1|2996907_2998104_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_014479053.1|2998125_3000339_+	DUF4129 domain-containing protein	NA	NA	NA	NA	NA
WP_003244399.1|3000501_3002043_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.5	5.7e-21
WP_069837335.1|3002151_3002685_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_069837336.1|3002666_3004133_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_095010833.1|3004516_3005839_+	hypoxanthine/guanine permease PbuG	NA	A0A0R6PHV4	Moraxella_phage	30.0	9.9e-38
WP_014479057.1|3006049_3006853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014478984.1|3006980_3008333_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 12
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	3011663	3020029	4196031		Synechococcus_phage(50.0%)	8	NA	NA
WP_003233955.1|3011663_3012959_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
WP_014479060.1|3013032_3013758_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
WP_003219409.1|3013750_3014005_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003243954.1|3014001_3014685_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_069837338.1|3014668_3016897_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	5.5e-158
WP_003233947.1|3016872_3018303_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_014479061.1|3018404_3019445_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
WP_014479062.1|3019441_3020029_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
>prophage 13
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	3067687	3133922	4196031	coat,transposase	Tupanvirus(20.0%)	55	NA	NA
WP_046380839.1|3067687_3068134_+|coat	spore coat protein YeeK	coat	NA	NA	NA	NA
WP_046380840.1|3068248_3068833_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046380841.1|3068912_3069359_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_069837349.1|3069355_3070201_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003219489.1|3070347_3070596_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_003219491.1|3070579_3070843_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_014479096.1|3070857_3071427_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_046380843.1|3071551_3072094_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072173406.1|3072532_3073162_+	YesL family protein	NA	NA	NA	NA	NA
WP_069837350.1|3073158_3074892_+	two-component system sensor histidine kinase YesM	NA	Q9EYF3	Enterobacteria_phage	27.5	6.9e-23
WP_069837351.1|3076098_3077382_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014479106.1|3078311_3079202_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014479107.1|3079217_3080252_+	rhamnogalacturonyl hydrolase YesR	NA	NA	NA	NA	NA
WP_014479108.1|3080274_3082560_+	transcriptional regulator YesS	NA	NA	NA	NA	NA
WP_031600252.1|3082573_3083272_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_014479110.1|3083264_3083927_+	YesU family protein	NA	NA	NA	NA	NA
WP_069837352.1|3083923_3084550_+	YesL family protein	NA	NA	NA	NA	NA
WP_069837353.1|3086567_3088406_+	rhamnogalacturonan lyase	NA	NA	NA	NA	NA
WP_003233813.1|3088564_3089218_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_069837354.1|3089225_3091217_+	beta-galactosidase YesZ	NA	NA	NA	NA	NA
WP_069703938.1|3093955_3095470_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014479122.1|3095524_3096481_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003242715.1|3096494_3097382_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_069837355.1|3097390_3098731_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_014479125.1|3098805_3099501_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_014479126.1|3099537_3099864_-	heme-degrading oxygenase HmoA	NA	NA	NA	NA	NA
WP_003233803.1|3099967_3100330_-	VOC family protein	NA	NA	NA	NA	NA
WP_069837356.1|3100421_3101012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479128.1|3101209_3102082_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003244522.1|3102235_3102403_+	YezD family protein	NA	NA	NA	NA	NA
WP_014479129.1|3102512_3103157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600260.1|3103275_3103563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087614162.1|3103804_3104917_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_069837357.1|3105138_3106200_-	DUF3900 domain-containing protein	NA	NA	NA	NA	NA
WP_017695589.1|3106349_3109535_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.5	2.3e-80
WP_069837919.1|3109981_3111901_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.5	3.0e-128
WP_014479136.1|3112136_3112901_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003244102.1|3112907_3113876_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-30
WP_069837358.1|3113899_3114811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160185.1|3114839_3116018_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015252589.1|3116018_3116954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479139.1|3116983_3118213_-	MFS transporter	NA	NA	NA	NA	NA
WP_014479140.1|3118324_3119032_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_003233771.1|3119123_3120509_-	amino acid permease	NA	NA	NA	NA	NA
WP_014479141.1|3120758_3122216_+	benzaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003233767.1|3122229_3123090_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.0	2.2e-09
WP_014479142.1|3123224_3125114_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	31.9	6.1e-41
WP_014476106.1|3125236_3125683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479143.1|3125807_3126230_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003233759.1|3126295_3127486_+	MFS transporter	NA	NA	NA	NA	NA
WP_087614160.1|3128022_3129172_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_014479146.1|3129238_3130795_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	9.5e-56
WP_014479147.1|3130967_3132098_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	30.9	2.8e-41
WP_046160188.1|3132166_3132613_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_031600262.1|3132674_3133922_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
>prophage 14
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	3531099	3579067	4196031	transposase,coat,tRNA	Planktothrix_phage(44.44%)	54	NA	NA
WP_087614160.1|3531099_3532250_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_003245356.1|3532427_3532607_+	YjzC family protein	NA	NA	NA	NA	NA
WP_003245236.1|3532653_3532839_-	DUF2929 domain-containing protein	NA	NA	NA	NA	NA
WP_014479433.1|3533087_3533822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479435.1|3533903_3534461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837427.1|3534551_3535505_+	transcriptional regulator Med	NA	NA	NA	NA	NA
WP_046380930.1|3535519_3535711_+	competence protein ComG	NA	NA	NA	NA	NA
WP_003232972.1|3535740_3535980_-|coat	spore coat protein YjzB	coat	NA	NA	NA	NA
WP_003232971.1|3536144_3537083_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003244890.1|3537105_3538347_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003232967.1|3538422_3539208_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|3539398_3540385_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_069837428.1|3540381_3541371_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	G9BWD6	Planktothrix_phage	30.1	9.4e-17
WP_069837429.1|3541458_3543090_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_003245828.1|3543165_3544116_+	oligopeptide ABC transporter permease AppB	NA	NA	NA	NA	NA
WP_014479441.1|3544132_3545044_+	oligopeptide ABC transporter permease AppC	NA	NA	NA	NA	NA
WP_003239298.1|3545249_3546002_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_003245134.1|3546036_3547029_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014479443.1|3547772_3549410_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_014479444.1|3549517_3550453_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|3550456_3551374_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_077670618.1|3551378_3552455_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|3552456_3553374_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	G9BWD6	Planktothrix_phage	34.8	1.6e-23
WP_072592593.1|3553481_3554699_+	MFS transporter	NA	NA	NA	NA	NA
WP_014476435.1|3555621_3556017_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_014479447.1|3556059_3556716_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_119122854.1|3556885_3557026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479448.1|3556992_3557649_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003245684.1|3557643_3557766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479449.1|3557809_3558961_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_014479450.1|3559007_3561020_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|3561057_3561225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245184.1|3561539_3562439_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|3562435_3562834_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_072592594.1|3563088_3563634_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	73.7	5.1e-41
WP_014479452.1|3563837_3564410_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_041850975.1|3564534_3564903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|3564931_3565567_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|3565585_3566386_+	NAD kinase	NA	NA	NA	NA	NA
WP_072592595.1|3566448_3567300_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003232912.1|3567312_3568047_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A8E2N0	Enterococcus_phage	24.8	7.2e-06
WP_069837430.1|3568282_3570127_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_014479456.1|3570375_3571086_+	thiaminase II	NA	NA	NA	NA	NA
WP_014479457.1|3571060_3571678_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_014479458.1|3571661_3572771_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_072592596.1|3572770_3572971_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_072592522.1|3572967_3573738_+	thiazole synthase	NA	NA	NA	NA	NA
WP_014479461.1|3573734_3574745_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_014479462.1|3574763_3575579_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|3575714_3576491_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_031600370.1|3576591_3577275_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_014479464.1|3577367_3577817_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_014479465.1|3577944_3578433_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_014479466.1|3578584_3579067_-|coat	spore coat protein X	coat	NA	NA	NA	NA
>prophage 15
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	3621093	3699614	4196031	portal,holin,terminase,transposase,tRNA	uncultured_Caudovirales_phage(28.21%)	83	NA	NA
WP_031600391.1|3621093_3622305_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
WP_014479509.1|3622435_3622942_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009967031.1|3623160_3623556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479511.1|3623784_3624264_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003232825.1|3624303_3624498_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_014479512.1|3624629_3624959_-	YjdJ family protein	NA	NA	NA	NA	NA
WP_080480847.1|3625507_3626488_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_014479515.1|3626620_3626854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837442.1|3627106_3628510_+	peptidoglycan-N-acetylmuramic acid deacetylase PdaC	NA	NA	NA	NA	NA
WP_014479517.1|3628549_3629023_-	YjfA family protein	NA	NA	NA	NA	NA
WP_014476499.1|3629146_3629314_-	putative motility protein	NA	NA	NA	NA	NA
WP_033881521.1|3630349_3630748_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_014479521.1|3630848_3631424_-	YjgB family protein	NA	NA	NA	NA	NA
WP_069837443.1|3631569_3634527_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_069837444.1|3634519_3635065_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_014479525.1|3635276_3635921_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_072592527.1|3635995_3636622_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003232791.1|3636652_3636931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479527.1|3637321_3638512_+	monooxygenase YjiB	NA	NA	NA	NA	NA
WP_038828749.1|3638534_3639713_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	28.3	5.6e-08
WP_003232781.1|3639753_3639942_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	3.4e-21
WP_069837445.1|3640115_3640928_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003232776.1|3642557_3643310_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_003232774.1|3643309_3644062_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	6.4e-18
WP_014479530.1|3644181_3645156_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
WP_003220510.1|3646172_3646595_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_003232765.1|3646634_3647813_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069837447.1|3648010_3649432_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_015383410.1|3650982_3651996_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_069837448.1|3652001_3653021_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_046160300.1|3653045_3654125_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_046160301.1|3654121_3654958_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	30.4	2.7e-09
WP_069837449.1|3655005_3656274_+	MFS transporter	NA	NA	NA	NA	NA
WP_069837450.1|3656361_3657363_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_069837451.1|3657438_3658881_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_069837452.1|3658877_3660371_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_014476525.1|3660409_3661174_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014478984.1|3661484_3662837_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_014479541.1|3662979_3663444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087614160.1|3664734_3665885_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_015252291.1|3666297_3667434_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003245487.1|3667423_3667558_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_014479545.1|3667955_3668909_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
WP_014479546.1|3668948_3669326_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
WP_014479547.1|3669430_3670033_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	48.7	1.4e-44
WP_003245071.1|3670109_3670946_+	manganese catalase	NA	NA	NA	NA	NA
WP_003232721.1|3670989_3671586_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|3671748_3672090_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232712.1|3672268_3672448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232710.1|3672434_3673271_+	hypothetical protein	NA	S6BFM4	Thermus_phage	27.8	6.7e-24
WP_080478406.1|3673170_3673971_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
WP_032677395.1|3673970_3674138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160305.1|3674222_3674573_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_014476537.1|3674569_3674776_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
WP_014479550.1|3674891_3675401_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	6.5e-22
WP_003244697.1|3675516_3676314_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_003232697.1|3676310_3677612_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
WP_032725514.1|3677615_3679103_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_014479551.1|3679122_3679950_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
WP_003232690.1|3679975_3680911_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_014479552.1|3680932_3681316_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_009967053.1|3681312_3681669_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003245226.1|3681665_3682151_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_003232680.1|3682163_3682604_+	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
WP_003232679.1|3682607_3682826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479554.1|3682822_3684223_+	hypothetical protein	NA	A0A0A7S087	Clostridium_phage	39.3	3.0e-77
WP_014479555.1|3684224_3684668_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	44.5	1.9e-25
WP_014479556.1|3684759_3685206_+	hypothetical protein	NA	A0A0A7RTY8	Clostridium_phage	36.8	1.0e-10
WP_014479557.1|3685247_3685388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600410.1|3685388_3690392_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	44.8	6.4e-37
WP_014479559.1|3690384_3691044_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
WP_003245730.1|3691059_3692037_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_003244812.1|3692036_3692303_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_014479560.1|3692360_3692786_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.0e-12
WP_014476551.1|3693808_3694387_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.9e-15
WP_003232665.1|3694383_3694656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479561.1|3694658_3696722_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
WP_014479562.1|3696733_3697063_+	hypothetical protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	40.7	1.3e-15
WP_014479563.1|3697059_3697224_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
WP_014479564.1|3697270_3698110_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_014479565.1|3698162_3698432_+	phage-like element PBSX protein XhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	1.4e-23
WP_014479566.1|3698444_3698708_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
WP_014479567.1|3698720_3699614_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
>prophage 16
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	3814539	3871332	4196031	transposase	Bacillus_phage(40.0%)	57	NA	NA
WP_014478984.1|3814539_3815892_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_031600262.1|3816138_3817386_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_014479651.1|3817458_3818181_-	hypothetical protein	NA	U5Q0C0	Bacillus_phage	68.3	3.1e-33
WP_014479652.1|3818517_3820638_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_014478926.1|3822441_3823566_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_014479654.1|3824043_3825225_-	aminotransferase A	NA	NA	NA	NA	NA
WP_003245246.1|3825426_3825588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014476655.1|3825791_3826703_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.8	8.0e-47
WP_003232406.1|3826746_3827211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479656.1|3827336_3828629_-	MFS transporter	NA	NA	NA	NA	NA
WP_072174092.1|3828704_3829199_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_015483175.1|3829255_3830116_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015383534.1|3830258_3831023_+	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	39.4	8.0e-40
WP_003232391.1|3831086_3832310_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153952136.1|3832682_3832856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003218671.1|3832930_3833170_+	DUF1797 family protein	NA	NA	NA	NA	NA
WP_003232389.1|3833279_3833798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010886502.1|3833931_3834129_+	antirepressor AbbA	NA	NA	NA	NA	NA
WP_014479659.1|3834266_3834710_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_014479660.1|3834856_3835738_+	transcriptional regulator CcpC	NA	NA	NA	NA	NA
WP_014479661.1|3835849_3836326_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	35.7	3.2e-15
WP_014479662.1|3836315_3837209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479663.1|3837224_3837680_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	33.9	1.3e-13
WP_003218680.1|3837784_3838495_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_014476668.1|3838564_3839689_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003232382.1|3839750_3839996_+	YkuS family protein	NA	NA	NA	NA	NA
WP_003244994.1|3840032_3840836_-	small-conductance mechanosensitive channel protein MscT	NA	NA	NA	NA	NA
WP_003245371.1|3841072_3841615_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_014479665.1|3841684_3842131_+	thiol-disulfide oxidoreductase YkuV	NA	A0A127AW88	Bacillus_phage	47.9	5.9e-35
WP_003232378.1|3842596_3843172_+	transcriptional regulator Rok	NA	NA	NA	NA	NA
WP_087614170.1|3843239_3844390_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_014479669.1|3844502_3845468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479670.1|3845604_3846204_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_014479671.1|3846254_3847274_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_014479672.1|3847291_3848584_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_014479673.1|3848544_3849066_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_003232367.1|3849065_3849539_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_014476678.1|3849531_3849765_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_069837480.1|3849988_3851746_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.5	1.8e-63
WP_014479676.1|3851757_3853572_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	7.2e-55
WP_014479677.1|3853681_3854377_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_014479678.1|3854381_3855515_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014479679.1|3855515_3856208_+	ABC transporter ATP-binding protein YknY	NA	G9BWD6	Planktothrix_phage	39.9	1.3e-36
WP_014479680.1|3856204_3857398_+	sporulation-delaying-protein transporter subunit SkiZ	NA	NA	NA	NA	NA
WP_014479681.1|3857677_3858433_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003244923.1|3858429_3859341_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_014479682.1|3859355_3861263_+	PTS fructose EIIABC component	NA	NA	NA	NA	NA
WP_003232348.1|3861407_3861989_+	Signal peptidase I T	NA	NA	NA	NA	NA
WP_003232345.1|3862022_3862292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232344.1|3862472_3864095_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.0	7.6e-48
WP_017696822.1|3864151_3865063_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_014478984.1|3865191_3866544_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_003232341.1|3866673_3867906_-	aminopeptidase	NA	NA	NA	NA	NA
WP_003238865.1|3868015_3868150_-	protein YkpC	NA	NA	NA	NA	NA
WP_026113694.1|3868250_3869258_-	cell shape-determining protein MreBH	NA	NA	NA	NA	NA
WP_003244728.1|3869541_3869820_+	transcriptional regulator AbhA	NA	A0A2I7SC16	Paenibacillus_phage	47.3	7.4e-12
WP_014478926.1|3870207_3871332_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP022891	Bacillus subtilis strain DKU_NT_03 chromosome, complete genome	4196031	4132158	4178443	4196031	coat,protease,terminase,transposase,tRNA	Bacillus_phage(50.0%)	49	NA	NA
WP_014478984.1|4132158_4133511_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_014664026.1|4133756_4135286_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_003231834.1|4135287_4135719_+	RicAFT regulatory complex protein RicA	NA	NA	NA	NA	NA
WP_003231833.1|4135980_4136526_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_046160418.1|4136658_4139235_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.7	2.4e-40
WP_041516431.1|4139250_4141134_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.3	7.6e-68
WP_031600520.1|4142243_4142492_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	44.9	4.6e-05
WP_033881685.1|4142542_4142905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479826.1|4143177_4143927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600526.1|4145852_4146002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033881687.1|4146070_4146388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600528.1|4146563_4146809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033881688.1|4146798_4147413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033881690.1|4147425_4147650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041516434.1|4147646_4148021_+	HNH endonuclease	NA	Q38456	Bacillus_phage	87.1	1.3e-64
WP_017697674.1|4148400_4148934_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
WP_031600262.1|4149184_4150432_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_072592534.1|4151478_4151934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479830.1|4152088_4152646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479831.1|4152766_4153381_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003231786.1|4153519_4153876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080480852.1|4153954_4154779_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_069837520.1|4154889_4156218_-|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.6	9.3e-28
WP_014476869.1|4156442_4156676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245758.1|4156955_4157663_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_003245175.1|4157732_4158185_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003245163.1|4158198_4158552_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_080480853.1|4158565_4158883_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_029317825.1|4159019_4159295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231769.1|4159383_4159797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837521.1|4159896_4160841_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003221097.1|4160880_4161102_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_014479841.1|4161297_4161570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245262.1|4161651_4161882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231758.1|4162123_4162516_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|4162475_4164578_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|4164595_4165585_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|4165634_4166255_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_014479843.1|4166318_4167086_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
WP_003231746.1|4167726_4168695_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_015483254.1|4168827_4170090_+	GTPase HflX	NA	NA	NA	NA	NA
WP_014479845.1|4170107_4171373_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003238341.1|4171482_4171890_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_031600540.1|4171948_4173283_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_095010668.1|4173392_4173518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015483256.1|4173556_4173856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697662.1|4173909_4174218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697663.1|4174238_4176122_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	61.3	5.2e-125
WP_014478926.1|4177318_4178443_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
