The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	129054	188157	4014255	transposase,coat,lysis,tRNA,holin,protease	Bacillus_phage(28.57%)	57	NA	NA
WP_087614167.1|129054_130243_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	1.6e-31
WP_003244564.1|130407_131040_+	GTP pyrophosphokinase YwaC	NA	NA	NA	NA	NA
WP_095010532.1|131069_132437_-	aminopeptidase YwaD	NA	NA	NA	NA	NA
WP_095010533.1|132592_133834_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243598.1|134084_134600_-	tyrZ transcriptional regulator YwaE	NA	NA	NA	NA	NA
WP_041351281.1|134750_135464_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_069964388.1|135574_136435_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	26.4	1.4e-05
WP_003227349.1|136484_137327_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_069964387.1|137380_138760_-	SacY negative regulator SacX	NA	NA	NA	NA	NA
WP_069964385.1|141349_142672_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_026113710.1|142763_143441_+	DUF2711 domain-containing protein	NA	NA	NA	NA	NA
WP_003243380.1|143479_143860_-	glyoxalase GlxA	NA	NA	NA	NA	NA
WP_069964384.1|143980_145168_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.7	1.2e-74
WP_015385004.1|145202_145400_-	YwbE family protein	NA	NA	NA	NA	NA
WP_069964383.1|145433_146636_-	MFS transporter	NA	NA	NA	NA	NA
WP_003227371.1|146741_147419_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_014481281.1|147400_147787_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_014481280.1|147892_148798_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041351284.1|148805_149624_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_014481278.1|149620_150289_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_014481277.1|150445_151888_+	ferrous ion permease EfeU	NA	NA	NA	NA	NA
WP_014481276.1|151884_153042_+	iron uptake system lipoprotein EfeM	NA	NA	NA	NA	NA
WP_014481275.1|153060_154311_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_014481274.1|154593_155196_+	DsbA family protein	NA	NA	NA	NA	NA
WP_069964382.1|155225_156767_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_003227392.1|156763_157072_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_003243648.1|157514_157673_-	transcriptional regulator SlrA	NA	NA	NA	NA	NA
WP_014481271.1|158027_158699_+	transcriptional regulator SlrC	NA	NA	NA	NA	NA
WP_003227398.1|158716_159100_+	GtrA family protein	NA	NA	NA	NA	NA
WP_014481270.1|159177_160350_+	galactokinase	NA	NA	NA	NA	NA
WP_095010534.1|160353_161895_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_009968363.1|161965_162211_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_010886637.1|162726_163692_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003227407.1|163719_165669_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003227409.1|165682_166297_+	Quinol oxidase subunit 3	NA	NA	NA	NA	NA
WP_069837848.1|166298_166673_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003227411.1|166714_166978_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_069837847.1|167817_168195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837846.1|168479_169664_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_014478349.1|169871_170621_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_014481266.1|170794_171796_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069964381.1|171833_174254_-|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	36.8	6.9e-21
WP_003222155.1|174782_175085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837843.1|175124_175955_+	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_014481261.1|175993_176764_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_014481260.1|177065_178451_+	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_014481259.1|178447_179887_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.8	3.7e-22
WP_003243437.1|179980_180229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071581866.1|180319_181135_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_038828109.1|181326_182133_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003242965.1|182146_182824_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
WP_014481256.1|182848_184219_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014481255.1|184386_184704_+	YwdI family protein	NA	NA	NA	NA	NA
WP_069964376.1|184723_186046_+	purine permease	NA	NA	NA	NA	NA
WP_003227446.1|186107_186479_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_014481253.1|186522_187068_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_015250957.1|187386_188157_+|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
>prophage 2
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	191642	247168	4014255	bacteriocin,tRNA,coat,protease	Enterobacteria_phage(20.0%)	54	NA	NA
WP_041054693.1|191642_192764_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_017696228.1|192756_193479_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_017696229.1|193481_194501_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_017696230.1|194525_195266_+	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	42.0	7.7e-48
WP_003244201.1|195265_196213_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_069837836.1|196226_197078_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.3	1.7e-38
WP_069837835.1|197070_197526_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003227472.1|197850_198315_+	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_069964374.1|198492_199767_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_014478322.1|199993_201541_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014481239.1|201614_203315_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_015250969.1|203314_204727_+	amino acid permease	NA	NA	NA	NA	NA
WP_095010536.1|204936_206175_+	MFS transporter	NA	NA	NA	NA	NA
WP_095010537.1|206326_206941_+	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_003244300.1|206930_207638_+	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_003243359.1|207640_208402_+	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_003242921.1|208420_209839_+	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_014481236.1|209835_211020_+	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_095010538.1|211020_212220_+	transaminase BacF	NA	NA	NA	NA	NA
WP_046160963.1|212234_213014_-	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_003227507.1|213146_213911_-	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_003235941.1|214180_215152_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_014481233.1|215297_216197_+	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_014481232.1|216245_217091_+	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_095010539.1|217259_218150_+	DMT family transporter	NA	NA	NA	NA	NA
WP_019712820.1|218293_219070_-	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_003222050.1|219284_219509_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_095010540.1|219670_220990_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.3	3.3e-25
WP_003227524.1|221025_221526_+	YwgA family protein	NA	NA	NA	NA	NA
WP_017696247.1|221637_222108_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_095010541.1|222107_223517_+	MFS transporter	NA	NA	NA	NA	NA
WP_095010542.1|224353_226270_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.4	8.7e-144
WP_003227535.1|226389_226809_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003222038.1|226851_227040_-	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003227536.1|227148_227808_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003244446.1|227821_228340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014478299.1|228478_228913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481227.1|228940_231016_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003227543.1|231217_232048_+	spermidine synthase	NA	NA	NA	NA	NA
WP_003227545.1|232108_232981_+	agmatinase	NA	NA	NA	NA	NA
WP_009968329.1|233570_233690_-	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_069837832.1|233673_234819_-	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	42.7	3.2e-77
WP_069837831.1|236438_237815_+	YncE family protein	NA	NA	NA	NA	NA
WP_069837830.1|237820_238522_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_095010543.1|238518_239799_-	insulinase family protein	NA	NA	NA	NA	NA
WP_072592616.1|239803_240964_-	insulinase family protein	NA	NA	NA	NA	NA
WP_095010544.1|240953_242264_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_069837826.1|242256_242976_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.6e-18
WP_003222006.1|242972_243134_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_069837825.1|243146_244493_-	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_010886632.1|244517_244670_-|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_003222002.1|244626_244758_-|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014481216.1|245072_245501_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003227570.1|245497_247168_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	609406	617141	4014255	holin	Anomala_cuprea_entomopoxvirus(50.0%)	9	NA	NA
WP_003243370.1|609406_610549_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
WP_003228349.1|610571_611225_+|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_080478451.1|611244_612156_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046160851.1|612173_612848_+|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_024571735.1|612879_613413_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014480909.1|613696_614842_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_003228370.1|614858_615512_+|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_014480908.1|615523_616444_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014480907.1|616460_617141_+|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
>prophage 4
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	629151	637516	4014255		Bacillus_phage(40.0%)	18	NA	NA
WP_014480897.1|629151_629550_-	helix-turn-helix transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	33.7	4.3e-05
WP_014480896.1|629784_629988_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033881244.1|630039_630231_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.0	1.0e-12
WP_033881245.1|630255_630474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480895.1|630466_631348_+	phage replisome organiser	NA	V9QKF6	Oenococcus_phage	33.1	6.8e-27
WP_014480894.1|631331_632159_+	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.9	3.7e-35
WP_014480892.1|632473_633022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003237439.1|633129_633270_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_003220282.1|633516_633714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480888.1|633756_634119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480887.1|634115_634433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480886.1|634429_634837_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.8	1.3e-25
WP_014480885.1|634833_635091_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	41.7	6.6e-07
WP_069837783.1|635208_635865_+	dUTPase	NA	R9TQ23	Paenibacillus_phage	46.0	5.8e-39
WP_014480883.1|635864_636197_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.3	8.3e-18
WP_014480882.1|636193_636613_+	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	61.2	1.6e-42
WP_014480881.1|636609_636810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600945.1|637063_637516_+	hypothetical protein	NA	S6AVV9	Thermus_phage	56.6	3.4e-38
>prophage 5
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	641200	665222	4014255	plate,capsid,tail,terminase,portal,holin,head,protease	Bacillus_phage(100.0%)	28	NA	NA
WP_046160532.1|641200_641575_+	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	7.5e-60
WP_017697674.1|641954_642488_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
WP_095010570.1|642487_644161_+|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	92.1	1.1e-307
WP_033882051.1|644209_644425_+	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.6	1.3e-24
WP_033882052.1|644430_645678_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	86.5	1.3e-217
WP_095010571.1|645667_646294_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	92.3	4.0e-106
WP_033882054.1|646330_647533_+|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	71.5	3.3e-157
WP_031600935.1|647548_647863_+	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	68.8	6.8e-30
WP_031600934.1|647891_648383_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	69.1	1.3e-27
WP_031600933.1|648398_648746_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	87.0	2.0e-51
WP_033882056.1|648678_649050_+|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	68.3	3.5e-41
WP_033882058.1|649042_649426_+	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	86.6	2.9e-59
WP_031600930.1|649422_649803_+	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	66.1	2.6e-39
WP_017696306.1|649803_650415_+|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	89.7	7.9e-99
WP_003220222.1|650469_650808_+	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	70.5	3.0e-39
WP_017696308.1|650810_650990_+	hypothetical protein	NA	D6R3Z7	Bacillus_phage	68.5	1.6e-12
WP_095010572.1|651002_654881_+|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	81.0	0.0e+00
WP_031600927.1|654880_655720_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	83.2	8.5e-136
WP_031600926.1|655731_657438_+	hypothetical protein	NA	D6R400	Bacillus_phage	81.8	9.4e-267
WP_080480874.1|657474_659049_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	88.5	5.3e-264
WP_069837751.1|659085_660309_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	80.3	9.1e-179
WP_031600923.1|660324_660624_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
WP_014480879.1|660620_660791_+	XkdX family protein	NA	NA	NA	NA	NA
WP_014480878.1|660844_661267_+|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
WP_014480877.1|661308_662250_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
WP_105778748.1|662289_662892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480875.1|663234_663624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480874.1|663638_665222_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.2e-75
>prophage 6
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	941954	995633	4014255	transposase,coat,holin	Bacillus_phage(20.0%)	45	NA	NA
WP_087614167.1|941954_943144_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	1.6e-31
WP_003243556.1|943246_943792_-	biofilm-surface layer protein BslA	NA	NA	NA	NA	NA
WP_014480661.1|943988_944531_-	transcriptional regulator GbsR	NA	NA	NA	NA	NA
WP_015483611.1|944729_946202_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003243227.1|946218_947427_+|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_069837716.1|947514_948093_+	molybdenum cofactor sulfurase	NA	NA	NA	NA	NA
WP_033881498.1|948098_948587_-	DinB family protein	NA	NA	NA	NA	NA
WP_032727091.1|948754_949279_+	membrane protein	NA	NA	NA	NA	NA
WP_014480656.1|949299_950829_+	flotillin lipid rafts scaffold protein FloT	NA	A0A2I2L4B2	Orpheovirus	27.9	2.7e-07
WP_014480655.1|950846_951368_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003228966.1|951409_951988_-	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_069964279.1|961534_962677_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_080478420.1|962700_963732_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_069964278.1|963728_965183_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_069964277.1|965169_967566_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.2	5.8e-12
WP_003229024.1|967596_968064_-	TspO/MBR family protein	NA	NA	NA	NA	NA
WP_095010592.1|968143_969217_-|coat	spore coat kinase CotI	coat	NA	NA	NA	NA
WP_095010593.1|969406_970540_+|coat	spore coat protein CotSA	coat	NA	NA	NA	NA
WP_003229031.1|970554_971610_+|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_095010594.1|971611_972043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046160769.1|972116_973340_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_069964271.1|973342_974293_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	33.2	1.3e-31
WP_004398478.1|974289_975576_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.8	3.0e-71
WP_069964270.1|975747_976566_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.6	1.7e-51
WP_069837712.1|976574_977294_-	yteA family sporulation protein	NA	NA	NA	NA	NA
WP_015251378.1|977583_978999_+	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_015251379.1|978995_980738_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_069322839.1|980725_981550_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_003229054.1|981584_982400_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_017695439.1|982490_983951_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.9	1.5e-74
WP_003229057.1|983947_985063_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_041337039.1|985342_986263_+	manganese ABC transporter substrate-binding protein/adhesin MntA	NA	NA	NA	NA	NA
WP_017695441.1|986281_987034_+	manganese ABC transporter ATP-binding protein MntB	NA	A0A1V0SE00	Indivirus	27.1	6.0e-16
WP_095010595.1|987039_988347_+	manganese ABC transporter permease MntC	NA	NA	NA	NA	NA
WP_014480632.1|989241_989400_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_014480631.1|989453_990494_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014480630.1|990537_991869_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003219346.1|992074_992323_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003229074.1|992416_992980_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003229076.1|992976_993204_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	2.8e-25
WP_003219361.1|993332_993806_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_014477743.1|993925_994363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080478418.1|994356_994533_-	YtzI protein	NA	NA	NA	NA	NA
WP_003229083.1|994625_995063_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	1.3e-47
WP_014477741.1|995228_995633_+|holin	holin family protein	holin	NA	NA	NA	NA
>prophage 7
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	1190663	1262942	4014255	transposase,coat,tRNA,integrase,protease	Staphylococcus_phage(20.0%)	60	1220339:1220398	1231751:1231813
WP_014480507.1|1190663_1193078_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_014480506.1|1193271_1194210_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003229534.1|1194343_1194601_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003229537.1|1194607_1195141_+	CvpA family protein	NA	NA	NA	NA	NA
WP_014480504.1|1195214_1196927_+	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	24.8	1.4e-12
WP_014480503.1|1196947_1199305_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	43.4	2.9e-16
WP_003237674.1|1199319_1199724_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_069837670.1|1199912_1201595_+	long-chain-fatty-acid--CoA ligase LcfA	NA	A0A2H4PQM9	Staphylococcus_phage	26.3	6.0e-32
WP_014477593.1|1201700_1202285_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_014480501.1|1202299_1203076_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_014480500.1|1203090_1203864_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_014480499.1|1203899_1204877_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_033881448.1|1205094_1206582_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_003222500.1|1206875_1207190_+	thioredoxin	NA	A0A1V0SD63	Indivirus	43.0	3.5e-10
WP_069837669.1|1207325_1209098_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_014480495.1|1209467_1210694_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003222508.1|1210737_1211184_-	YslB family protein	NA	NA	NA	NA	NA
WP_003222512.1|1211476_1212085_+	succinate dehydrogenase cytochrome B558	NA	NA	NA	NA	NA
WP_003229567.1|1212118_1213879_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_003229569.1|1213881_1214643_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_014480494.1|1214703_1215147_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003184172.1|1215262_1215487_+	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	78.7	1.2e-15
WP_003229573.1|1215731_1216172_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010886589.1|1216179_1216998_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003229578.1|1217112_1218213_+	spore germination protein GerM	NA	NA	NA	NA	NA
WP_014480493.1|1218323_1219061_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_015251523.1|1219073_1219670_+	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	33.5	5.5e-12
WP_003229585.1|1219685_1220195_+	metallophosphoesterase	NA	NA	NA	NA	NA
1220339:1220398	attL	AGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCGGGAGTTCGAATCTCTCCTGGGAC	NA	NA	NA	NA
WP_105778747.1|1220663_1221551_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014480491.1|1221704_1221881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033881452.1|1221888_1222185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837668.1|1222973_1224131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017418302.1|1224342_1227549_+	type I restriction-modification system endonuclease	NA	Q5YA94	Bacillus_phage	29.5	1.7e-06
WP_069837667.1|1227681_1229112_+	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	25.9	5.9e-28
WP_014480487.1|1229108_1230428_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	1.3e-16
WP_087614160.1|1231878_1233029_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
1231751:1231813	attR	AGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCGGGAGTTCGAATCTCTCCTGGGACGTA	NA	NA	NA	NA
WP_069837666.1|1233163_1233988_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_038827685.1|1234789_1235125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480476.1|1235937_1237662_+	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.2	2.4e-60
WP_004399096.1|1237658_1238177_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003222549.1|1238200_1239229_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_033881607.1|1239215_1240772_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
WP_014480473.1|1240792_1241890_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_003229604.1|1241939_1243358_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_095010611.1|1243370_1243970_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_014480470.1|1244088_1245093_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014480469.1|1245320_1246595_+	trigger factor	NA	NA	NA	NA	NA
WP_003229613.1|1246866_1248129_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
WP_095010612.1|1248282_1249941_+|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_014480468.1|1250121_1252446_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
WP_003229621.1|1252442_1253030_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014477563.1|1253051_1253549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399038.1|1253778_1255146_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003222575.1|1255153_1255984_+	protein HemX	NA	NA	NA	NA	NA
WP_014480467.1|1256016_1256961_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_014480466.1|1256950_1257739_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014480465.1|1257735_1258710_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014480464.1|1258739_1260032_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_014480463.1|1260162_1261884_+|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_014480462.1|1261916_1262942_+|coat	spore coat protein CotN	coat	NA	NA	NA	NA
>prophage 8
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	1375062	1427282	4014255	transposase,coat,protease	Corynebacterium_phage(20.0%)	51	NA	NA
WP_003229836.1|1375062_1375572_-|protease	cysteine protease YraA	protease	NA	NA	NA	NA
WP_014480388.1|1375704_1376754_-	formaldehyde dehydrogenase AdhA	NA	A0A2K9L339	Tupanvirus	41.8	8.6e-69
WP_014480387.1|1376884_1377079_-	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_014480386.1|1377261_1377684_+	aldehyde stress transcriptional regulator AdhR	NA	NA	NA	NA	NA
WP_003246006.1|1377946_1378246_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014480384.1|1378261_1378459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229843.1|1378477_1379614_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.1	2.2e-14
WP_009967868.1|1379632_1380001_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_003229845.1|1380018_1380264_-|coat	spore coat protein F-like protein YraG	coat	NA	NA	NA	NA
WP_004398984.1|1380526_1380913_+	VOC family protein	NA	NA	NA	NA	NA
WP_119123071.1|1381055_1381157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004399021.1|1381427_1381787_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_004398671.1|1381839_1382196_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_038829669.1|1382602_1383418_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003229850.1|1383554_1383818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480377.1|1384254_1385070_+	chitosanase	NA	A0A223LHY0	Streptomyces_phage	33.2	3.7e-19
WP_029318151.1|1385228_1386209_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_046160630.1|1386344_1386875_+	RNA polymerase sigma factor SigZ	NA	A0A1V0DZZ1	Clostridioides_phage	24.8	2.1e-07
WP_033881351.1|1387829_1387991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072175780.1|1388277_1388355_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_032726255.1|1388929_1389637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480371.1|1390017_1390815_-	glutamate racemase	NA	NA	NA	NA	NA
WP_014480369.1|1392600_1393455_+	aminoglycoside 6-adenylyltransferase AadK	NA	E4ZFP8	Streptococcus_phage	58.6	9.7e-95
WP_014480368.1|1393674_1394178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072592606.1|1395009_1395381_+	YrdB family protein	NA	NA	NA	NA	NA
WP_014480365.1|1395609_1396176_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_046160628.1|1396837_1398070_+	cytochrome P450	NA	NA	NA	NA	NA
WP_017697606.1|1398339_1398615_+	barnase inhibitor	NA	NA	NA	NA	NA
WP_021480168.1|1398938_1399412_+	azlBCD operon transcriptional regulator AzlB	NA	NA	NA	NA	NA
WP_095010626.1|1400680_1402003_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_014480357.1|1402680_1403616_+	CDF family zinc transporter CzcD	NA	NA	NA	NA	NA
WP_095010627.1|1403703_1404741_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	26.5	8.3e-16
WP_014480355.1|1404860_1405727_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014480354.1|1405852_1406818_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014477437.1|1406835_1406979_+	YrzO family protein	NA	NA	NA	NA	NA
WP_019712547.1|1407268_1408573_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_031600262.1|1408818_1410066_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_014480337.1|1410500_1410791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480339.1|1410950_1412498_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014479891.1|1412494_1413253_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_123772462.1|1414552_1414756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014477426.1|1415063_1415576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480334.1|1415647_1416007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480333.1|1416103_1416556_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014480332.1|1416654_1417095_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014480331.1|1417497_1417785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480328.1|1419906_1421034_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	48.8	5.0e-91
WP_046160622.1|1421772_1422168_-	VOC family protein	NA	NA	NA	NA	NA
WP_014480326.1|1423108_1423999_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014480325.1|1424165_1425554_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_031600262.1|1426034_1427282_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
>prophage 9
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	1648111	1698422	4014255	transposase,protease	Bacillus_phage(27.78%)	53	NA	NA
WP_031600262.1|1648111_1649359_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_043857754.1|1649553_1649859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095010816.1|1649871_1651287_-	lipase	NA	NA	NA	NA	NA
WP_031600651.1|1651336_1651702_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_031600262.1|1651756_1653004_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_033885488.1|1653125_1653590_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_088272387.1|1653984_1655100_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	71.9	1.9e-146
WP_069964197.1|1655456_1655684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272385.1|1655740_1656820_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_031600262.1|1656906_1658154_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_031600650.1|1658375_1659098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600649.1|1659381_1660236_+	C1 family peptidase	NA	A0A1X6WFA2	Pacmanvirus	29.5	3.4e-23
WP_033881339.1|1660259_1660580_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_031600648.1|1660653_1661619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600647.1|1662003_1662723_-	hypothetical protein	NA	D2XR29	Bacillus_phage	37.8	7.2e-43
WP_003230479.1|1664781_1664994_-	spore germination protein	NA	NA	NA	NA	NA
WP_003230483.1|1665157_1665364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072692690.1|1665306_1665546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095010640.1|1665784_1666336_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003230488.1|1666570_1666915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964193.1|1667308_1668394_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
WP_014480161.1|1668404_1669052_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
WP_038828558.1|1669066_1670263_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_003223915.1|1670295_1670760_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_003223910.1|1670872_1671247_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_014480159.1|1671260_1671785_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_014477220.1|1672064_1672820_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_003223904.1|1672809_1673403_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
WP_014477219.1|1673457_1673997_+	YpuI family protein	NA	NA	NA	NA	NA
WP_014480157.1|1674119_1675268_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.5	6.0e-23
WP_004398980.1|1675255_1675846_+	spore maturation protein SbmA	NA	NA	NA	NA	NA
WP_003230509.1|1675850_1676387_+	spore maturation protein SpmB	NA	NA	NA	NA	NA
WP_004398815.1|1676478_1677213_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_014480156.1|1677306_1677846_+	thiol-disulfide oxidoreductase ResA	NA	NA	NA	NA	NA
WP_014480155.1|1677842_1679471_+	cytochrome c biogenesis protein ResB	NA	NA	NA	NA	NA
WP_014480154.1|1679490_1680666_+	cytochrome c biogenesis protein ResC	NA	NA	NA	NA	NA
WP_003246107.1|1680746_1681469_+	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	42.2	2.7e-45
WP_095010641.1|1681465_1683235_+	sensor histidine kinase ResE	NA	W8CYF6	Bacillus_phage	39.3	9.2e-39
WP_003230521.1|1683437_1684022_+	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_069837608.1|1684094_1685057_+	sigma-X negative effector	NA	NA	NA	NA	NA
WP_014480151.1|1685168_1685936_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_046160519.1|1685977_1687555_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	35.4	5.8e-37
WP_004399159.1|1688051_1688624_+	riboflavin transporter FmnP	NA	NA	NA	NA	NA
WP_003225461.1|1688663_1688912_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	56.8	1.6e-18
WP_014480149.1|1689177_1690236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480148.1|1690228_1691719_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.3	3.2e-61
WP_072173318.1|1691778_1692348_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004398603.1|1692298_1693021_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014480147.1|1693083_1693527_+	YpbF family protein	NA	NA	NA	NA	NA
WP_003230533.1|1694549_1695134_+	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_003230536.1|1695289_1696564_+	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_014480145.1|1696671_1697646_+	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_014480144.1|1697765_1698422_+|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
>prophage 10
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	1897071	1907763	4014255	holin,transposase	Bacillus_phage(75.0%)	10	NA	NA
WP_154217702.1|1897071_1898508_-	NAD(P)-binding protein	NA	A0A2K9L022	Tupanvirus	23.7	5.7e-07
WP_015251922.1|1898635_1899193_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.1	5.3e-102
WP_014479999.1|1899293_1901096_+	type II toxin-antitoxin system toxin ribonuclease YobL	NA	A0A1P8CWI7	Bacillus_phage	87.0	1.3e-218
WP_003231326.1|1901105_1901564_+	type II toxin-antitoxin system antitoxin YobK	NA	NA	NA	NA	NA
WP_095010662.1|1901656_1902115_+	SMI1 / KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	82.2	1.2e-67
WP_014479997.1|1902170_1902725_+	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	91.3	4.3e-96
WP_014479996.1|1902784_1903318_+	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	97.2	2.9e-97
WP_072592542.1|1903606_1903690_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_033881859.1|1903949_1904309_+	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
WP_031600262.1|1906515_1907763_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
>prophage 11
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	1978656	2045439	4014255	transposase,coat,protease	Bacillus_phage(58.82%)	64	NA	NA
WP_072592538.1|1978656_1979049_+|coat	outer spore coat protein CotM	coat	NA	NA	NA	NA
WP_003231580.1|1979282_1979711_+	DUF2621 domain-containing protein	NA	NA	NA	NA	NA
WP_010886519.1|1979741_1980233_-	CcdC family protein	NA	NA	NA	NA	NA
WP_003245707.1|1980311_1980674_-	response regulator	NA	NA	NA	NA	NA
WP_003231585.1|1980762_1981470_-	cytochrome c-type biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_010886518.1|1981689_1981863_+	aspartyl-phosphate phosphatase YnzD	NA	NA	NA	NA	NA
WP_003221221.1|1981936_1982155_-	YneF family protein	NA	NA	NA	NA	NA
WP_095010666.1|1982218_1982683_-	sporulation inhibitor of replication protein SirA	NA	NA	NA	NA	NA
WP_014476936.1|1982835_1984839_-	transketolase	NA	NA	NA	NA	NA
WP_003231595.1|1985007_1985241_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_014479938.1|1985304_1985958_-	recombinase family protein	NA	NA	NA	NA	NA
WP_003231598.1|1985976_1986294_-	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003238209.1|1986443_1987061_+	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	2.5e-15
WP_014479937.1|1987609_1988029_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	66.1	2.0e-40
WP_031600569.1|1988146_1988686_+	YndM family protein	NA	NA	NA	NA	NA
WP_014479934.1|1988712_1989471_-	gamma-polyglutamate hydrolase PghL	NA	O64134	Bacillus_phage	52.9	3.3e-54
WP_095010667.1|1990099_1991740_-	YndJ family transporter	NA	NA	NA	NA	NA
WP_014479930.1|1991721_1992354_-	DUF4166 domain-containing protein	NA	NA	NA	NA	NA
WP_014479929.1|1992358_1993165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231626.1|1995825_1996014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967329.1|1996819_1997218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231634.1|1997471_1997660_+	twin-arginine translocase TatAC	NA	NA	NA	NA	NA
WP_014479921.1|1997834_1998035_+|coat	spore coat protein CotC	coat	NA	NA	NA	NA
WP_014479920.1|1998280_1998637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121509411.1|1999551_1999839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479918.1|1999961_2000801_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	5.6e-164
WP_003231643.1|2001075_2001240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881937.1|2001646_2001910_+|coat	spore coat protein CotU	coat	NA	NA	NA	NA
WP_003245820.1|2002510_2002945_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	93.0	2.0e-72
WP_029317844.1|2002974_2003436_-	DUF2691 family protein	NA	NA	NA	NA	NA
WP_033881939.1|2005184_2006600_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_014479910.1|2007012_2007648_+	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.5	7.7e-73
WP_014479909.1|2008132_2009632_-	xylulokinase	NA	NA	NA	NA	NA
WP_014479908.1|2009782_2011120_-	xylose isomerase	NA	NA	NA	NA	NA
WP_046381052.1|2011357_2012512_+	ROK family protein	NA	NA	NA	NA	NA
WP_014479906.1|2012649_2014251_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_046381051.1|2014281_2015673_-	MFS transporter	NA	NA	NA	NA	NA
WP_014479902.1|2016469_2016940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479901.1|2017079_2017244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479898.1|2018755_2018986_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	75.0	2.1e-20
WP_029726895.1|2019527_2019908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160432.1|2019985_2020888_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046160431.1|2020966_2021503_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_031600262.1|2022086_2023334_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_072592598.1|2024262_2024697_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014479887.1|2024880_2025132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479885.1|2026462_2026954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881290.1|2027192_2027483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964163.1|2028574_2030458_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	61.3	3.4e-124
WP_017697662.1|2030478_2030787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015483256.1|2030840_2031140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095010668.1|2031178_2031304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600540.1|2031413_2032748_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003238341.1|2032806_2033214_-	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_014479845.1|2033323_2034589_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_015483254.1|2034606_2035869_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003231746.1|2036001_2036970_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_014479843.1|2037610_2038378_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
WP_087614160.1|2038463_2039614_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_003245105.1|2039731_2040352_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_014478984.1|2040512_2041865_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_003231754.1|2041977_2042967_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_014479842.1|2042984_2045087_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231758.1|2045046_2045439_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
>prophage 12
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	2456908	2504880	4014255	plate,terminase,portal,holin,protease	uncultured_Caudovirales_phage(31.82%)	51	NA	NA
WP_014479598.1|2456908_2457868_+|protease	serine protease Isp	protease	A0A127AWU5	Bacillus_phage	49.5	5.6e-75
WP_069837457.1|2458283_2460572_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003245084.1|2460746_2461217_+	guanine deaminase	NA	S4VYZ2	Pandoravirus	45.8	1.8e-26
WP_014479594.1|2461464_2461875_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_014479593.1|2462016_2462460_+	organic hydroperoxide resistance transcriptional regulator OhrR	NA	NA	NA	NA	NA
WP_003232574.1|2462490_2462916_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069837456.1|2463041_2464289_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.4	3.3e-99
WP_014479591.1|2464300_2465398_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.1	4.3e-71
WP_021479442.1|2465748_2466651_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_014476583.1|2466721_2467039_-	multidrug efflux SMR transporter subunit YkkD	NA	NA	NA	NA	NA
WP_015383469.1|2467038_2467377_-	multidrug efflux SMR transporter subunit YkkC	NA	NA	NA	NA	NA
WP_069964129.1|2467598_2468117_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014479587.1|2468106_2468634_-	DinB family protein	NA	NA	NA	NA	NA
WP_095010681.1|2468725_2469457_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_017695103.1|2469605_2469830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964128.1|2469906_2471106_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003232595.1|2471343_2471862_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003232599.1|2472970_2474020_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_003232600.1|2474062_2475052_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
WP_014479583.1|2475064_2475955_-	gamma-D-glutamyl-L-lysine dipeptidyl-peptidase	NA	A0A0A8WIF2	Clostridium_phage	45.8	5.3e-19
WP_014479582.1|2475971_2477051_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_031600421.1|2477047_2478007_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_031600419.1|2478094_2479744_-	dipeptide ABC transporter substrate-binding protein DppE	NA	NA	NA	NA	NA
WP_014479578.1|2479746_2480754_-	dipeptide ABC transporter ATP-binding subunit DppD	NA	G9BWD6	Planktothrix_phage	28.7	1.8e-15
WP_069964127.1|2480758_2481721_-	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_003245446.1|2481726_2482653_-	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_014479576.1|2482669_2483494_-	D-aminopeptidase DppA	NA	NA	NA	NA	NA
WP_014479575.1|2483623_2484442_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_033881739.1|2484610_2485960_+|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	34.1	3.4e-25
WP_014479573.1|2486459_2487431_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	41.3	2.5e-62
WP_014479572.1|2487442_2489593_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_014479571.1|2489809_2490760_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_003218470.1|2492732_2493350_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_095010682.1|2493362_2494364_+	inorganic phosphate transporter	NA	E5ES24	Ostreococcus_lucimarinus_virus	28.7	8.6e-10
WP_003244695.1|2494473_2495220_+	toxin-antitoxin-antitoxin system toxin SpoIISA	NA	NA	NA	NA	NA
WP_003232646.1|2495219_2495390_+	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
WP_003232648.1|2495475_2495613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021479459.1|2495650_2496544_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.7	1.8e-83
WP_014479566.1|2496556_2496820_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
WP_069964126.1|2496832_2497102_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.6	1.4e-23
WP_014479564.1|2497154_2497994_-	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_014479563.1|2498040_2498205_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
WP_046160312.1|2498201_2498531_-|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	42.3	1.0e-15
WP_069964125.1|2498542_2500606_-|terminase	terminase	terminase	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
WP_003232665.1|2500608_2500881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014476551.1|2500877_2501456_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.9e-15
WP_003232669.1|2501439_2502486_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
WP_014479560.1|2502478_2502904_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.0e-12
WP_003244812.1|2502961_2503228_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_003245730.1|2503227_2504205_-	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_014479559.1|2504220_2504880_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
>prophage 13
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	2510057	2527307	4014255	portal,terminase	Bacillus_phage(35.29%)	24	NA	NA
WP_014479556.1|2510057_2510504_-	hypothetical protein	NA	A0A0A7RTY8	Clostridium_phage	36.8	1.0e-10
WP_014479555.1|2510595_2511039_-	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	44.5	1.9e-25
WP_014479554.1|2511040_2512441_-	hypothetical protein	NA	A0A0A7S087	Clostridium_phage	39.3	3.0e-77
WP_003232679.1|2512437_2512656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232680.1|2512659_2513100_-	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
WP_003245226.1|2513112_2513598_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_009967053.1|2513594_2513951_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_014479552.1|2513947_2514331_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_003232690.1|2514352_2515288_-	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_014479551.1|2515313_2516141_-	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
WP_032725514.1|2516160_2517648_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_003232697.1|2517651_2518953_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
WP_003244697.1|2518949_2519747_-|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_095010683.1|2519862_2520372_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.4e-21
WP_121591707.1|2520492_2520687_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_021479479.1|2520690_2521041_-	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_003245588.1|2521125_2521293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080478406.1|2521292_2522093_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
WP_003232710.1|2521992_2522829_-	hypothetical protein	NA	S6BFM4	Thermus_phage	27.8	6.7e-24
WP_003232712.1|2522815_2522995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232719.1|2523173_2523515_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232721.1|2523677_2524274_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_014476529.1|2525936_2526314_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	4.7e-17
WP_014479545.1|2526353_2527307_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
>prophage 14
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	2567821	2615958	4014255	transposase,tRNA,coat	Bacillus_phage(42.86%)	49	NA	NA
WP_014479511.1|2567821_2568301_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_009967031.1|2568529_2568925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479509.1|2569143_2569650_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_031600262.1|2569697_2570945_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_072592525.1|2571017_2571509_-	YjdF family protein	NA	NA	NA	NA	NA
WP_014479507.1|2571678_2572626_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_014479506.1|2572640_2574593_-	PTS mannose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_014479505.1|2574741_2576688_-	mannose transport/utilization transcriptional regulator ManR	NA	NA	NA	NA	NA
WP_033881593.1|2576995_2577313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080480846.1|2577427_2577745_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_046160292.1|2579267_2579687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160291.1|2579705_2580209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160290.1|2580600_2581086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157698102.1|2581690_2581861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095010695.1|2582043_2582436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095010696.1|2582450_2582762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041351654.1|2582943_2583171_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153529706.1|2583232_2583385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837436.1|2583424_2583712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837435.1|2585019_2586435_-	lipase	NA	NA	NA	NA	NA
WP_069837434.1|2586485_2586851_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_069837433.1|2586890_2587691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837432.1|2587877_2588522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837431.1|2588762_2589545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479487.1|2591845_2592061_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_031600382.1|2592126_2593644_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_095010697.1|2595340_2596510_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	41.8	4.1e-88
WP_106610850.1|2597449_2597725_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014479481.1|2597890_2598262_+	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.8	5.1e-16
WP_014479480.1|2598624_2599146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010329852.1|2599158_2599506_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	67.6	8.6e-18
WP_014479476.1|2601543_2602734_+	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_014479474.1|2603380_2604553_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_003232857.1|2604545_2605667_-	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	3.7e-17
WP_003245358.1|2606022_2606745_+	esterase family protein	NA	NA	NA	NA	NA
WP_003232861.1|2606781_2607297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479473.1|2607300_2607723_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087614160.1|2607877_2609027_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_003232866.1|2609084_2609339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479472.1|2609455_2611735_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.9	3.5e-91
WP_014479471.1|2611808_2612063_-	sporulation-specific transcription regulator SopVIF	NA	NA	NA	NA	NA
WP_003232872.1|2612195_2612345_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_014479470.1|2612426_2612633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014476457.1|2612914_2613271_-	sporulation protein YjcA	NA	NA	NA	NA	NA
WP_014479468.1|2613430_2613817_+|coat	spore coat protein V	coat	NA	NA	NA	NA
WP_014479467.1|2613856_2614177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479466.1|2614261_2614744_+|coat	spore coat protein X	coat	NA	NA	NA	NA
WP_003239243.1|2614895_2615384_+|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_003244982.1|2615511_2615958_+|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
>prophage 15
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	3168136	3176502	4014255		Synechococcus_phage(50.0%)	8	NA	NA
WP_014479062.1|3168136_3168724_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
WP_014479061.1|3168720_3169761_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
WP_003233947.1|3169862_3171293_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_069837338.1|3171268_3173497_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	5.5e-158
WP_003243954.1|3173480_3174164_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003219409.1|3174160_3174415_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014479060.1|3174407_3175133_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
WP_003233955.1|3175206_3176502_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
>prophage 16
NZ_CP022890	Bacillus subtilis strain DKU_NT_02 chromosome, complete genome	4014255	3923006	3978623	4014255	transposase,protease,holin	Klosneuvirus(18.75%)	50	NA	NA
WP_014481472.1|3923006_3924209_+|protease	serine protease HtrC	protease	W5SAB9	Pithovirus	40.4	5.9e-13
WP_157698106.1|3924229_3924361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003244510.1|3924522_3925908_-	arginine utilization regulatory protein RocR	NA	NA	NA	NA	NA
WP_015715052.1|3926133_3926418_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
WP_014481470.1|3926417_3927053_+	SdpI family protein	NA	NA	NA	NA	NA
WP_015715050.1|3927236_3927791_+	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
WP_014481469.1|3927775_3928729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033882007.1|3929722_3930928_+	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	2.0e-29
WP_014481465.1|3931150_3932554_+	amino acid permease	NA	NA	NA	NA	NA
WP_003226959.1|3932626_3933517_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	2.0e-26
WP_003226961.1|3933752_3933869_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_041337908.1|3933869_3934967_-	response regulator aspartate phosphatase RapG	NA	D6R410	Bacillus_phage	39.6	4.6e-73
WP_014481463.1|3935077_3935548_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_095010801.1|3935689_3936427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481461.1|3936437_3937595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481460.1|3937610_3937859_+	DUF2651 domain-containing protein	NA	NA	NA	NA	NA
WP_014481459.1|3937963_3938134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481458.1|3938196_3939423_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.3	1.1e-11
WP_014481457.1|3939456_3939870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481456.1|3940054_3940225_+	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_003226975.1|3940305_3940785_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_014481455.1|3941072_3941981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031601181.1|3941937_3945060_+	DEAD/DEAH box helicase	NA	A7WKM3	Acidianus_filamentous_virus	26.4	6.6e-08
WP_014479904.1|3945324_3945642_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033881055.1|3945638_3946553_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
WP_033881129.1|3946936_3947200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087614191.1|3947898_3949048_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	98.9	9.8e-151
WP_031601176.1|3949565_3951599_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_121591334.1|3951576_3953463_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	21.8	6.6e-19
WP_031601173.1|3953852_3955316_-	hypothetical protein	NA	A0A0S2MYH0	Enterococcus_phage	36.0	1.0e-11
WP_095010802.1|3955794_3956115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480339.1|3956244_3957792_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014479891.1|3957788_3958547_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_014481451.1|3958966_3959407_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.4	3.4e-11
WP_033880917.1|3959944_3960238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837894.1|3960688_3962614_-	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_014481448.1|3963104_3963734_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_014478516.1|3963754_3964477_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
WP_040081205.1|3964567_3965278_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017697260.1|3965621_3965852_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_095010803.1|3965865_3967305_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_069837893.1|3967407_3968937_-	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.7e-33
WP_015483942.1|3968950_3969514_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_069837892.1|3969980_3971387_-	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	30.6	2.3e-32
WP_024571486.1|3971409_3972756_-	gluconate permease GntP	NA	NA	NA	NA	NA
WP_069964431.1|3972784_3974326_-	gluconokinase	NA	NA	NA	NA	NA
WP_003243132.1|3974318_3975050_-	gluconate operon transcriptional repressor GntR	NA	NA	NA	NA	NA
WP_088272596.1|3975245_3976394_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.6	1.5e-50
WP_014481442.1|3976486_3977518_+	general stress protein 30	NA	NA	NA	NA	NA
WP_009968420.1|3978218_3978623_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
