The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022753	Nocardiopsis gilva YIM 90087 chromosome, complete genome	6142152	10645	48086	6142152	tail,portal,capsid,terminase,head,integrase	Mycobacterium_phage(23.08%)	39	11582:11641	48087:48238
WP_017619417.1|10645_11581_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.1	7.0e-14
11582:11641	attL	CGGTCGCCTCTCACGTTCAGCTGATGTCGGAATCCTCAGCTGTGCGACCGTCGTGCGACT	NA	NA	NA	NA
WP_017619371.1|13377_13572_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_152471663.1|14737_15127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017619374.1|15123_15393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152471665.1|15389_15791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017619376.1|16034_16316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017619377.1|16626_17748_+	radical SAM protein	NA	NA	NA	NA	NA
WP_094932147.1|18896_19223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157745336.1|19228_19621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017619381.1|19791_19983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157745339.1|20007_20172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152471666.1|20990_21260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619385.1|21403_23587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619386.1|23573_24968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619387.1|24971_27614_-	hypothetical protein	NA	I4AZE0	Saccharomonospora_phage	31.2	6.4e-20
WP_017619388.1|27636_27993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619389.1|28013_28382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619390.1|28464_29025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157745342.1|29058_29493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619392.1|29467_29764_-	DUF5403 family protein	NA	NA	NA	NA	NA
WP_017619393.1|29763_30129_-|head,tail	head-tail adaptor protein	head,tail	G1BRB8	Mycobacterium_phage	31.9	2.1e-06
WP_017619394.1|30125_30527_-	hypothetical protein	NA	G9FHK0	Rhodococcus_virus	50.0	2.5e-24
WP_017619395.1|30542_30785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619396.1|30784_31720_-|capsid	phage major capsid protein	capsid	V5R986	Arthrobacter_phage	60.5	1.8e-94
WP_152471667.1|32303_33062_-	hypothetical protein	NA	A0A222ZHI2	Rhodococcus_phage	29.1	5.9e-19
WP_152471668.1|33058_34360_-|portal	phage portal protein	portal	A0A2H4JAT8	uncultured_Caudovirales_phage	57.4	7.3e-126
WP_026125923.1|34395_35973_-|terminase	terminase	terminase	A0A2H5BLJ5	Streptomyces_phage	48.0	2.0e-133
WP_017619401.1|36023_36398_-	hypothetical protein	NA	A0A097EWH3	Mycobacterium_phage	56.1	2.1e-25
WP_017619402.1|37316_38042_-	site-specific DNA-methyltransferase	NA	A0A097EWK8	Mycobacterium_phage	54.9	7.2e-67
WP_017619403.1|38192_38480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619404.1|38476_39232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619405.1|39262_39460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152471670.1|39479_39824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619410.1|43638_44439_-	hypothetical protein	NA	I6WIL9	Mycobacterium_virus	37.6	3.7e-40
WP_017619412.1|44744_45215_-	hypothetical protein	NA	A0A1B0XUC9	Freshwater_phage	39.4	4.8e-11
WP_017619413.1|45211_45484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619415.1|45905_46526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157745345.1|46741_47740_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	32.5	1.5e-09
WP_094932149.1|47594_48086_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
48087:48238	attR	CGGTCGCCTCTCACGTTCAGCTGATGTCGGAATCCTCAGCTGTGCGACCGTCGTGCGACTCGGGTAAAGTGACCTCCGTCGGAGAAACCCCTGCACAGTCGGGGGTTCTCACGGGCCATTAGCTCAATTGGCAGAGCAGCGGACTTTTAATC	NA	NA	NA	NA
>prophage 2
NZ_CP022753	Nocardiopsis gilva YIM 90087 chromosome, complete genome	6142152	127166	138514	6142152	capsid,tail,portal,head	Freshwater_phage(25.0%)	17	NA	NA
WP_017619498.1|127166_127886_-	hypothetical protein	NA	A0A1B0XTM3	Freshwater_phage	37.4	1.7e-28
WP_017619499.1|127885_128065_-	hypothetical protein	NA	A0A1B0XTL8	Freshwater_phage	52.7	1.7e-06
WP_017619500.1|128061_128496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619501.1|128503_129115_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_017619502.1|129124_129538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026125942.1|129916_131395_-|capsid	phage major capsid protein	capsid	A0A1B3B249	Gordonia_phage	62.9	5.8e-164
WP_017619505.1|131394_132378_-	hypothetical protein	NA	G9FHH6	Rhodococcus_phage	60.5	2.9e-58
WP_152471686.1|132367_133666_-|portal	phage portal protein	portal	A0A1B3AYS8	Gordonia_phage	55.6	1.0e-132
WP_157745357.1|133757_133910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026125944.1|133919_135413_-	hypothetical protein	NA	G9FHH3	Rhodococcus_phage	47.2	1.5e-122
WP_017619509.1|135777_136071_-	HNH endonuclease	NA	Q19XW0	Mycobacterium_phage	40.9	6.2e-09
WP_017619510.1|136353_136569_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_026125945.1|136596_136785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152471679.1|136861_137104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619513.1|137107_137446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619514.1|137442_138156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017619515.1|138148_138514_-	hypothetical protein	NA	A0A1W6JS65	Salmonella_phage	34.5	4.0e-05
>prophage 3
NZ_CP022753	Nocardiopsis gilva YIM 90087 chromosome, complete genome	6142152	2819450	2839975	6142152	portal,tail,capsid,terminase,head,protease	Streptomyces_phage(25.0%)	24	NA	NA
WP_017616823.1|2819450_2819885_+	AAA family ATPase	NA	A0A160DHT4	Gordonia_phage	39.1	1.6e-08
WP_083919679.1|2820011_2820485_+|terminase	phage terminase small subunit P27 family	terminase	A0A2K9VGJ6	Pontimonas_phage	38.5	7.4e-20
WP_152471481.1|2820528_2821983_+|terminase	terminase large subunit	terminase	A0A2K9VGS4	Pontimonas_phage	51.2	3.1e-133
WP_157745557.1|2821979_2822144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152471480.1|2822251_2823400_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	36.8	4.5e-55
WP_017616818.1|2823396_2824182_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	38.0	4.2e-12
WP_017616817.1|2824243_2825503_+|capsid	phage major capsid protein	capsid	A0A1J0GV00	Halomonas_phage	37.3	1.3e-60
WP_017616816.1|2825533_2825932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017616815.1|2826003_2826174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017616814.1|2826177_2826729_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_152471479.1|2826764_2827196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152471478.1|2827213_2827657_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_017616811.1|2827665_2827860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017616810.1|2827859_2828348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017616809.1|2828344_2828851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152471477.1|2829267_2832657_+|tail	phage tail tape measure protein	tail	A0A249XNT7	Brevibacterium_phage	32.4	3.4e-58
WP_017616806.1|2832669_2833638_+	hypothetical protein	NA	A0A291LH57	Streptomyces_phage	26.1	9.5e-14
WP_017616805.1|2833639_2834812_+	hypothetical protein	NA	A0A291LHA1	Streptomyces_phage	32.0	7.9e-31
WP_017616804.1|2834811_2835792_+	hypothetical protein	NA	A0A2K9V3F4	Faecalibacterium_phage	32.7	3.2e-09
WP_152471475.1|2835815_2836106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083919678.1|2836102_2836666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017616802.1|2836685_2837417_+	hypothetical protein	NA	A0A0R8VCQ3	Thermobifida_phage	40.2	3.2e-30
WP_017616801.1|2837465_2837717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017616800.1|2837713_2839975_+	hypothetical protein	NA	A0A0K1Y5U2	Streptomyces_phage	46.1	2.8e-109
