The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	446643	479901	5371030	head,protease,terminase,capsid,portal,tRNA,tail,integrase	uncultured_Caudovirales_phage(73.33%)	35	464251:464268	480246:480263
WP_002919147.1|446643_447591_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|447605_448115_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|448243_449368_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|449339_449813_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|449838_450381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|450385_450958_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|450961_451780_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|451776_452034_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|452009_452564_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|458359_458581_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|458874_461985_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|461997_463137_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|463515_464166_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
464251:464268	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|464441_465668_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|465760_466702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|466883_467168_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|467178_467958_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|468081_468276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|468409_468679_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|468671_468860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|468852_469167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|469163_469532_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|469528_469894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|469893_472029_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|472371_472707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|472755_473268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|473531_474698_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|474749_475310_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|475311_476553_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|476549_476885_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|476881_477181_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|477180_477624_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004198610.1|477750_477942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113647.1|477899_478256_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|478239_479901_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
480246:480263	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	2013232	2069499	5371030	plate,protease,transposase	Microcystis_phage(30.0%)	51	NA	NA
WP_032425077.1|2013232_2013979_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_048289971.1|2014390_2015404_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004145488.1|2016235_2016358_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004148811.1|2016385_2016571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023286625.1|2016975_2017917_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2018010_2019000_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2019025_2020357_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_032425074.1|2020384_2021593_+	propionate kinase	NA	NA	NA	NA	NA
WP_032425474.1|2021621_2023916_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	7.4e-158
WP_009484368.1|2024346_2025462_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|2025571_2026486_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060614333.1|2026495_2027782_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_032425073.1|2027778_2028654_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|2028650_2029370_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|2029375_2030269_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|2030552_2032196_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|2032245_2032722_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020801827.1|2032820_2033747_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032425072.1|2034050_2035346_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	7.4e-62
WP_004175495.1|2035360_2036167_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020801945.1|2036141_2037041_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2037150_2037633_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004197491.1|2037823_2038522_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|2038547_2039087_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2039201_2039531_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899025.1|2040099_2041440_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004184632.1|2041436_2042090_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032425071.1|2042093_2043791_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032425070.1|2044249_2046736_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_032425069.1|2046759_2048091_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_032425473.1|2048135_2049059_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_032425068.1|2049180_2049690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2049686_2050193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032423970.1|2050429_2050939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425067.1|2051232_2052588_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_004200304.1|2052588_2053098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958632.1|2053094_2053601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|2053646_2053877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023317012.1|2053900_2055091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958629.1|2055114_2055420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343203.1|2055441_2056335_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	28.8	8.8e-14
WP_016946122.1|2056518_2057412_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_004184615.1|2057587_2058481_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.2e-12
WP_004184614.1|2059681_2060023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227463.1|2060211_2060469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2060766_2061033_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_064181763.1|2062182_2065593_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004148784.1|2065726_2067490_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_064181764.1|2067489_2068536_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_019704158.1|2068510_2069053_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152261.1|2069055_2069499_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	2747189	2758076	5371030		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2747189_2750297_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2750351_2751617_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2751647_2752736_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2752822_2753083_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2753380_2754241_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2754261_2755023_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2755283_2756186_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2756197_2757463_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2757455_2758076_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	2985148	3023614	5371030	terminase,integrase	uncultured_Caudovirales_phage(34.04%)	56	3014727:3014741	3020736:3020750
WP_004152576.1|2985148_2986015_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|2986014_2986788_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|2986784_2987981_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|2987980_2988334_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|2988335_2988989_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|2989042_2989609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|2989645_2989831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|2989883_2990225_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|2990224_2991247_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|2991249_2991552_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|2991552_2992152_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|2992151_2994155_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|2994144_2994297_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|2994332_2994758_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|2994761_2995202_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|2995212_2996358_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|2996361_2996802_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|2996896_2997283_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|2997282_2997789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2997785_2998205_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|2998173_2998455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|2998494_2999436_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|2999447_2999942_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|2999945_3001148_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3001199_3001748_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3001803_3003255_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3003492_3004893_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3004843_3005596_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3005697_3006018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3006252_3006642_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3006638_3007169_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3007171_3007420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3007825_3008608_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3008604_3009081_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3009077_3010040_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3010041_3011700_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152163.1|3012008_3012302_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
WP_004152162.1|3012276_3012498_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3012595_3013264_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_094620509.1|3013434_3013749_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	99.0	1.3e-49
WP_004152159.1|3013741_3013930_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3014099_3014465_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3014457_3014712_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3014727:3014741	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3014898_3015324_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3015320_3015515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3015511_3016339_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3016443_3016962_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3016967_3017678_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3017667_3017892_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3017888_3018101_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3018097_3018577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3018755_3018998_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3018978_3020160_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3020356_3020905_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3020736:3020750	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3021103_3022636_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3022852_3023614_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 5
NZ_CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	3311536	3320461	5371030		Salmonella_phage(33.33%)	7	NA	NA
WP_094620525.1|3311536_3312439_-	hypothetical protein	NA	M1PJH8	Synechococcus_phage	29.5	1.7e-33
WP_094620526.1|3313145_3313964_-	hypothetical protein	NA	A0A2H4J9C3	uncultured_Caudovirales_phage	47.8	1.2e-22
WP_094620527.1|3314041_3316870_-	hypothetical protein	NA	G0X4U7	Salmonella_phage	49.2	1.1e-272
WP_094620528.1|3316883_3317786_-	hypothetical protein	NA	A0A2P1CAM5	Salmonella_phage	33.8	2.8e-15
WP_094620529.1|3317800_3318439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094620530.1|3318542_3319445_-	DUF5309 family protein	NA	H8ZM08	Pseudomonas_phage	31.6	4.1e-27
WP_094620531.1|3319462_3320461_-	hypothetical protein	NA	A0A076G697	Vibrio_phage	37.9	7.5e-06
>prophage 6
NZ_CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	3475324	3565049	5371030	head,protease,terminase,capsid,portal,lysis,plate,tRNA,tail,integrase	Salmonella_phage(57.63%)	98	3530850:3530868	3565124:3565142
WP_002898139.1|3475324_3476617_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3476707_3478051_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3478059_3478671_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3478793_3483047_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3483182_3483677_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3484209_3485178_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3485292_3487059_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3487059_3488781_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3488825_3489527_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3489880_3490099_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3490219_3492499_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3492529_3492847_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3493172_3493394_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_071528213.1|3493348_3493531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150848.1|3493470_3495411_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3495407_3496523_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3496669_3498328_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3498747_3499443_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3499558_3500458_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3500601_3502254_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3502264_3503233_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_085666582.1|3503183_3503387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896408.1|3503444_3503879_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3504030_3505749_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3505787_3506789_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3506799_3508242_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3508329_3509343_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3509339_3510170_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3510201_3511341_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004147767.1|3511393_3511573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896394.1|3512218_3512734_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3512960_3513689_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3513709_3514441_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3514447_3515164_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3515163_3515832_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3516015_3516747_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3516789_3518262_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3518258_3518975_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3519053_3520181_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3520222_3520711_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3520768_3521614_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_094620507.1|3521610_3522564_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3522574_3523708_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3523871_3524984_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3525332_3525812_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3525900_3526803_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3527624_3527912_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3528114_3528378_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3528384_3528768_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3529034_3530720_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3530850:3530868	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3530940_3531159_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011797.1|3531249_3532350_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_000980413.1|3532346_3532832_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_065519278.1|3532828_3535906_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.6	0.0e+00
WP_000763311.1|3535898_3536018_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3536032_3536335_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3536389_3536905_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_053881089.1|3536914_3538087_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	1.3e-203
WP_044077513.1|3538826_3539333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023211040.1|3539335_3539746_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	1.1e-19
WP_001340317.1|3539726_3539960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065519277.1|3539962_3541447_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.1	3.9e-152
WP_053881087.1|3541443_3542049_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	8.9e-111
WP_053881086.1|3542041_3542950_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	5.0e-142
WP_000177590.1|3542936_3543296_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993775.1|3543292_3543871_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000829157.1|3543939_3544386_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_021534468.1|3544378_3544810_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_094342962.1|3544772_3544976_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	71.6	2.6e-22
WP_065519276.1|3544905_3545334_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.4	8.4e-47
WP_000727850.1|3545330_3545708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341072.1|3545709_3546183_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_021523866.1|3546202_3546418_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	6.9e-26
WP_000868175.1|3546421_3546625_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_053881084.1|3546624_3547089_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	9.3e-76
WP_053881083.1|3547184_3547835_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.2e-110
WP_000742511.1|3547838_3548897_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216238.1|3548913_3549747_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_001098431.1|3549889_3551656_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000520376.1|3551655_3552687_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.6	1.3e-170
WP_016245842.1|3552712_3553675_-	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	30.2	1.8e-20
WP_016245841.1|3553679_3554249_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001316229.1|3554599_3554905_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3554843_3555032_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_065519275.1|3555185_3557600_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
WP_024242284.1|3557596_3558454_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	8.6e-160
WP_000196280.1|3558450_3558753_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_001556503.1|3558749_3558977_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_001244165.1|3558976_3559210_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000963473.1|3559277_3559619_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001556502.1|3559700_3559949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065519274.1|3560034_3560331_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.2	1.1e-21
WP_000460893.1|3560338_3560848_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000035244.1|3560880_3561102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009714.1|3561227_3562109_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	45.3	6.4e-41
WP_000047742.1|3562189_3563392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000584504.1|3563393_3563915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290942.1|3563996_3565049_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	6.1e-107
3565124:3565142	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 7
NZ_CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	4010163	4067671	5371030	head,protease,lysis,tRNA,integrase,transposase	Escherichia_phage(25.0%)	76	4003376:4003422	4053611:4053657
4003376:4003422	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|4010163_4012641_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|4012627_4013023_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|4013019_4013490_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004165520.1|4013489_4013909_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004151253.1|4014008_4017455_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|4017547_4018051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|4018178_4018964_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|4019029_4019743_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|4019732_4019903_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|4020002_4020362_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|4020378_4020849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|4021142_4021397_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|4021399_4022155_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|4022330_4023008_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|4023060_4023813_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|4023881_4024274_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|4024270_4024696_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|4024698_4025061_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|4025060_4025234_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|4025233_4025614_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|4025616_4025856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|4025866_4026961_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|4026972_4027401_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|4027404_4028790_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|4028862_4029339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|4029380_4030385_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|4030359_4031781_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|4031793_4033266_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|4033265_4033868_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|4034238_4034568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|4034673_4035138_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|4035134_4035665_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|4035667_4035916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644626.1|4036652_4037699_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004151283.1|4037926_4038616_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|4038612_4039143_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|4039135_4039273_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|4039269_4039905_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|4039897_4040068_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4040067_4040523_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151290.1|4040775_4041024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151291.1|4041023_4041671_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|4041843_4042686_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|4042792_4043299_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|4043295_4043589_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151296.1|4043588_4045019_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151297.1|4045008_4045908_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_001548453.1|4046132_4046354_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|4046394_4046628_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|4046755_4047445_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4047795_4048011_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151303.1|4048110_4048305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4048393_4048678_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|4048693_4049539_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|4049535_4050216_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4050212_4050371_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4050367_4051024_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4051020_4051788_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4051784_4052003_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4052004_4052220_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4052221_4052557_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_071531173.1|4052553_4053597_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.2	2.5e-177
WP_004143017.1|4054027_4054894_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4053611:4053657	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4054895_4055108_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4055153_4056539_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004151319.1|4056714_4057209_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004151320.1|4057212_4057935_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004151321.1|4058042_4058381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004143004.1|4058377_4058545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151322.1|4058477_4058987_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004143002.1|4058983_4060051_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004151323.1|4060162_4061239_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_085955245.1|4061483_4062675_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004147400.1|4063979_4066394_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004151324.1|4066390_4067077_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
WP_002892267.1|4067044_4067671_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 8
NZ_CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	4267400	4279054	5371030	integrase	Enterobacteria_phage(70.0%)	13	4267850:4267864	4290907:4290921
WP_004144574.1|4267400_4268504_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4267850:4267864	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4268514_4269768_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4270120_4271311_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4271298_4272249_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_094684957.1|4272248_4272674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4273242_4273809_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4273826_4274072_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4274068_4274806_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4275347_4275614_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4275610_4276168_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4276164_4276392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4276388_4276709_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4276720_4279054_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4290907:4290921	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 1
NZ_CP028804	Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence	323934	107708	153767	323934	transposase,protease	uncultured_Caudovirales_phage(30.77%)	47	NA	NA
WP_000427619.1|107708_108713_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004217321.1|110047_110752_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004153729.1|111607_112435_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|112431_113295_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|113303_114131_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|114139_115150_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|115143_116013_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004159231.1|116718_117045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032188295.1|117096_117183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|117221_118202_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152118.1|120188_120470_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|120504_121074_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|121188_123984_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|123983_124181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|124418_125168_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|125154_126117_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|127959_129306_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|129517_130000_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|129987_130254_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004152108.1|130429_130684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152107.1|130759_131017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|131065_131269_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152105.1|131302_131671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|131714_132209_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152103.1|132239_132815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152102.1|132802_133072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152101.1|133429_133780_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|133829_134192_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|134209_135961_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|136008_137298_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|137310_137736_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152096.1|137768_138305_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152095.1|140201_140564_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004182005.1|140639_141185_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_085903505.1|141193_141904_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004152092.1|141903_142230_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152091.1|142561_143059_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_031944101.1|143108_143618_-	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152086.1|145360_145540_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004152085.1|145771_146206_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152084.1|146422_147823_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|147819_148500_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|148554_149484_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|149488_149869_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001242438.1|149908_150805_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|150804_152622_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_000019473.1|152786_153767_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 2
NZ_CP028804	Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence	323934	213092	305990	323934	bacteriocin,transposase,integrase	Escherichia_phage(42.86%)	104	255245:255304	308642:308657
WP_032425473.1|213092_214016_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_011977735.1|214474_215161_+	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
WP_004208838.1|215244_215616_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_004178060.1|215669_216038_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_004178059.1|216051_216357_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_004152602.1|216376_216943_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_004152601.1|216929_217670_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_004152600.1|217669_219094_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_004152599.1|219086_219683_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_004152598.1|219705_220275_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_004152597.1|220406_220817_+	lipase chaperone	NA	NA	NA	NA	NA
WP_004152596.1|220821_221112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004171484.1|221135_221354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152595.1|221354_221672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152594.1|221738_222143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004171485.1|222444_222837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152592.1|222908_225548_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_004152591.1|225547_225937_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_004152590.1|225936_226563_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_004178057.1|226573_227566_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_015065635.1|227578_228217_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_004153093.1|228264_230220_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_004152683.1|230251_230488_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_004152684.1|230484_230670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152685.1|230715_231042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152686.1|231062_231815_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_004152687.1|231825_232065_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_004152688.1|232036_232609_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_004152689.1|232601_233030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178055.1|233016_234387_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_108479757.1|234386_237236_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_004153030.1|237241_237769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152629.1|237958_238690_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_004152630.1|239049_241359_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_004153029.1|241358_246620_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_004152303.1|246699_247425_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.4	5.5e-06
WP_004178053.1|247582_248179_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_004152301.1|248198_248546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178052.1|248760_249306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178051.1|249662_251984_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|251985_252264_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004152294.1|252532_253084_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
WP_004199332.1|253404_253683_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|253899_253977_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|253969_254827_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
255245:255304	attL	AGAGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGA	NA	NA	NA	NA
WP_001067855.1|255311_256016_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
255245:255304	attL	AGAGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGA	NA	NA	NA	NA
WP_094684987.1|255961_256390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|256328_257342_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|257486_257984_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|258095_258386_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|258391_259183_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|259346_259694_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|259687_260527_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|260456_260636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|260654_260927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427619.1|261108_262113_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|262340_263546_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|263556_263862_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|263877_264060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|264088_264853_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|265043_265400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|265345_265930_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|265929_267168_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|267164_268070_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|268191_268896_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|269046_269862_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
268904:269727	attR	TCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAG	NA	NA	NA	NA
WP_044117068.1|270051_270720_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
268904:269727	attR	TCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAG	NA	NA	NA	NA
WP_000427619.1|271011_272016_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|274945_275650_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067858.1|275830_276535_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_002063889.1|277546_278089_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|278101_278962_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|279068_279773_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013362816.1|280095_281628_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_013362817.1|282156_282606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100249774.1|283120_283231_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
WP_013362818.1|283235_283973_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362819.1|284098_284194_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|284328_285033_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|285154_286060_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|286056_287295_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|287294_287879_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336397.1|287824_288181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|288371_289136_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_094226279.1|289164_289347_+	resolvase	NA	NA	NA	NA	NA
WP_001276635.1|289338_290328_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087810.1|290324_290561_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000995361.1|290557_290923_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000761850.1|291034_291673_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000149288.1|291687_293373_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
WP_000732290.1|293444_293720_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294666.1|293735_294086_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000414383.1|294157_294592_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_000427623.1|294691_295696_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001326390.1|296311_296713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988731.1|296826_297552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032410269.1|297526_297730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257735.1|297684_301938_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_001326394.1|301909_302350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|302988_303591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|303821_304142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932880.1|304160_304448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|304440_304977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|304979_305990_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
308642:308657	attR	TAATTATGATAATTAC	NA	NA	NA	NA
>prophage 1
NZ_CP028805	Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence	131028	15530	26689	131028		Escherichia_phage(50.0%)	11	NA	NA
WP_004118283.1|15530_16397_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_011977818.1|17506_18712_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_086523286.1|18708_19686_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_013214011.1|19767_21039_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_001568036.1|21038_21470_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_009483812.1|21628_21880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|21879_23364_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152353.1|23612_24584_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_013214012.1|24586_25258_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|25320_25551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|25987_26689_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 2
NZ_CP028805	Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence	131028	103804	130635	131028	transposase,bacteriocin	Salmonella_phage(27.27%)	25	NA	NA
WP_004201219.1|103804_105343_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_099459485.1|105455_105713_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_013213996.1|105942_106494_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	6.2e-18
WP_004099069.1|106813_107092_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_014386216.1|107307_107385_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_013213997.1|107377_108235_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_047662916.1|108539_108728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032446864.1|108871_109060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013213998.1|109551_110793_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_013213999.1|110800_111694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706023.1|111697_113695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213995.1|113691_114603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213994.1|114988_115321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213991.1|116256_116730_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138014.1|117267_120234_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|120237_120798_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_013213990.1|122340_122619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213989.1|122729_123155_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213987.1|123483_123780_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004199234.1|125014_125896_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213985.1|126050_127031_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_001217881.1|127153_127711_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001067858.1|128027_128732_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_087759376.1|128829_129949_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_022631495.1|129996_130635_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	65.5	8.3e-75
