The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028391	Klebsiella pneumoniae strain WCHKP13F2 chromosome, complete genome	5375449	669543	707663	5375449	terminase,lysis,tail,tRNA,head,portal,plate,capsid,integrase	Salmonella_phage(83.33%)	52	668122:668181	701457:701526
668122:668181	attL	TATATGATTTTAAAGCTAAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCG	NA	NA	NA	NA
WP_094617494.1|669543_670572_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	61.1	6.8e-119
WP_094617492.1|670575_671196_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	38.0	4.0e-34
WP_094617490.1|671296_671533_+	regulator	NA	NA	NA	NA	NA
WP_094617488.1|671567_672077_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	84.0	1.6e-76
WP_004174277.1|672084_672285_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	87.7	1.5e-27
WP_094617486.1|672248_672590_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	85.8	5.4e-49
WP_080784239.1|672657_672891_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_094617484.1|672890_673118_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	86.7	1.8e-32
WP_004185730.1|673114_673972_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.6	8.2e-118
WP_094617482.1|673968_676377_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.1	0.0e+00
WP_004144689.1|676563_676752_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	7.9e-26
WP_004185723.1|676765_676999_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	85.7	2.0e-31
WP_004174290.1|677074_677332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094617481.1|677359_677563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032444694.1|677636_678551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032444693.1|678547_679288_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_094617479.1|679319_680357_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.6	1.1e-174
WP_094617477.1|680356_682120_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	92.8	0.0e+00
WP_094617475.1|682260_683094_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.2	8.8e-101
WP_040968800.1|683110_684175_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.3	1.9e-185
WP_004174300.1|684178_684829_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	86.6	9.6e-103
WP_094617473.1|684925_685390_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	7.9e-75
WP_004144701.1|685389_685593_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
WP_004144702.1|685596_685812_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
WP_094617471.1|685792_686302_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.0	9.5e-82
WP_065519557.1|686306_686690_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	44.5	1.2e-17
WP_094617469.1|686686_687115_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	79.6	6.6e-52
WP_077254640.1|687044_687248_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	74.6	4.4e-22
WP_094617467.1|687210_687642_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	5.3e-65
WP_094617465.1|687634_688081_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	75.0	8.1e-53
WP_094617463.1|688149_688722_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	7.9e-77
WP_094617461.1|688718_689081_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	2.6e-49
WP_094617459.1|689067_689976_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.6	1.7e-105
WP_094617516.1|689968_690565_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	53.4	1.2e-51
WP_094617457.1|690569_692753_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0C5Q3R7	Klebsiella_phage	36.4	3.9e-47
WP_094617455.1|692764_692959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094617453.1|692986_694144_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.8	2.5e-45
WP_094617451.1|694293_695466_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.3	5.2e-208
WP_002896201.1|695475_695991_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_004144716.1|696043_696343_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
WP_002896220.1|696357_696477_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_094617449.1|696469_699097_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.4	5.0e-118
WP_004185683.1|699093_699579_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
WP_094617447.1|699575_700673_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.3	3.7e-171
WP_004174338.1|700743_700962_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004144517.1|700974_701352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002917636.1|701679_702186_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
701457:701526	attR	TATATGATTTTAAAGCTAAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_004144518.1|702285_704121_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|704339_706085_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|706196_706412_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_071526681.1|706410_706641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004900709.1|706649_707663_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.4e-108
>prophage 2
NZ_CP028391	Klebsiella pneumoniae strain WCHKP13F2 chromosome, complete genome	5375449	1666821	1673726	5375449	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1666821_1667685_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_094617165.1|1667695_1668469_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	6.6e-26
WP_002912636.1|1668709_1669603_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1669848_1671210_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1671528_1672251_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1672247_1673726_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP028391	Klebsiella pneumoniae strain WCHKP13F2 chromosome, complete genome	5375449	2782832	2793721	5375449		Escherichia_phage(87.5%)	9	NA	NA
WP_020805006.1|2782832_2785940_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2785994_2787260_+	MFS transporter	NA	NA	NA	NA	NA
WP_020805010.1|2787290_2788379_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.8e-210
WP_004176262.1|2788465_2788726_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|2789023_2789884_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2789904_2790666_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2790928_2791831_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004183946.1|2791842_2793108_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|2793100_2793721_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP028391	Klebsiella pneumoniae strain WCHKP13F2 chromosome, complete genome	5375449	3177983	3273413	5375449	terminase,tail,tRNA,head,holin,transposase,portal,capsid,integrase	Klebsiella_phage(48.84%)	104	3170513:3170530	3281678:3281695
3170513:3170530	attL	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
WP_002901088.1|3177983_3178484_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3178600_3179047_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3179030_3179822_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|3179923_3181108_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_094617531.1|3181139_3181832_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|3181977_3182487_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3182473_3182830_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004176548.1|3182819_3183059_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150782.1|3184430_3184532_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3184531_3184606_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3184723_3184849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3184907_3185171_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3185301_3185940_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3186029_3186944_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_071599309.1|3187159_3187351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019705576.1|3187605_3188649_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|3188951_3190160_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004213090.1|3190233_3192018_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3192024_3192915_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3193035_3194544_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3194854_3195541_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3195938_3196118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804935.1|3196157_3196790_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3197380_3197578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004183659.1|3197693_3198704_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|3198700_3200107_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3200162_3201050_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3201066_3201573_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|3201599_3202094_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3202184_3202370_-	general stress protein	NA	NA	NA	NA	NA
WP_021462619.1|3202991_3204185_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3204297_3204525_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004224175.1|3204551_3204731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150797.1|3204973_3205297_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3205289_3205682_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3205678_3206392_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3206664_3206817_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_071983287.1|3207137_3207335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049115092.1|3207466_3208159_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032430712.1|3208514_3209573_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.1	6.1e-14
WP_049115089.1|3209995_3211420_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	54.2	5.9e-97
WP_094617533.1|3211480_3224068_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	48.0	0.0e+00
WP_014228919.1|3224130_3224742_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
WP_017880253.1|3225139_3225850_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	8.5e-137
WP_023289191.1|3225851_3226607_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
WP_017898999.1|3226603_3226942_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
WP_040240643.1|3226941_3230277_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.6	0.0e+00
WP_071600376.1|3230276_3230489_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	87.5	1.4e-31
WP_014228914.1|3230509_3230875_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|3230932_3231394_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_094617535.1|3231425_3231827_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	92.5	3.3e-61
WP_017880258.1|3231823_3232213_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_048290172.1|3232193_3232532_-|head	phage head closure protein	head	Q6UAX3	Klebsiella_phage	84.8	3.7e-50
WP_020317538.1|3232528_3232846_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049115072.1|3232826_3233141_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.2	1.3e-17
WP_049115070.1|3233199_3234486_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	86.2	8.3e-207
WP_049115067.1|3234563_3235484_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.6	2.5e-149
WP_094617537.1|3235520_3236780_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	2.3e-222
WP_074439632.1|3236779_3236959_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	55.9	5.2e-11
WP_012542167.1|3236952_3238674_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
WP_012542168.1|3238673_3239108_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_023289184.1|3239355_3239787_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	1.1e-41
WP_023297386.1|3239783_3240107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3240058_3240421_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_023289182.1|3240747_3240972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049010362.1|3241010_3241463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3242397_3242748_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_048290156.1|3242744_3243242_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	87.0	6.7e-80
WP_017880269.1|3243241_3243457_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_085803555.1|3244561_3245164_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.1	2.4e-76
WP_085803554.1|3245180_3246212_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	2.8e-96
WP_017898980.1|3246211_3246415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049114843.1|3246411_3246804_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	4.7e-12
WP_077263542.1|3246844_3247135_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	4.7e-17
WP_023279529.1|3247146_3247380_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	72.4	1.3e-25
WP_023279530.1|3247661_3249398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279532.1|3249630_3250524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279533.1|3251159_3252059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049245401.1|3252082_3252331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279534.1|3253194_3253635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032415157.1|3253648_3254113_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	69.3	8.5e-61
WP_094617539.1|3254105_3255089_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.8	1.2e-45
WP_017898969.1|3255140_3255695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147982.1|3255697_3255919_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	75.3	1.2e-28
WP_077258685.1|3255994_3256444_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	64.6	1.3e-37
WP_108193615.1|3257032_3257251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3257260_3257455_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3257497_3257842_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_094617541.1|3257983_3260122_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.1	3.3e-99
WP_012542206.1|3260174_3260420_+	excisionase	NA	NA	NA	NA	NA
WP_023279540.1|3260400_3261528_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	5.7e-119
WP_004150800.1|3261645_3262896_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3263136_3263787_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|3263803_3264262_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3264318_3265425_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004140557.1|3265479_3266121_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004176557.1|3266124_3267495_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
WP_015958193.1|3267549_3267912_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032410214.1|3267995_3268802_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150807.1|3269085_3269757_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_004147969.1|3269756_3271223_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_004176560.1|3271308_3272430_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_094617543.1|3272411_3272618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190938.1|3272921_3273413_-|transposase	transposase	transposase	NA	NA	NA	NA
3281678:3281695	attR	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
>prophage 5
NZ_CP028391	Klebsiella pneumoniae strain WCHKP13F2 chromosome, complete genome	5375449	3517851	3527315	5375449	tRNA,protease	Brazilian_cedratvirus(16.67%)	9	NA	NA
WP_004209699.1|3517851_3519573_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3519617_3520319_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3520672_3520891_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3521011_3523291_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3523321_3523639_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3523964_3524186_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_071526620.1|3524119_3524323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094617652.1|3524262_3526203_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	3.2e-37
WP_002896440.1|3526199_3527315_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 6
NZ_CP028391	Klebsiella pneumoniae strain WCHKP13F2 chromosome, complete genome	5375449	4009815	4054461	5375449	terminase,tRNA,head,holin,integrase	Escherichia_phage(26.53%)	64	4004270:4004315	4051534:4051579
4004270:4004315	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_094617325.1|4009815_4012293_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	2.7e-198
WP_094617328.1|4012279_4012675_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	55.6	9.5e-37
WP_065953617.1|4012671_4013142_-	DUF1833 family protein	NA	R9TPR6	Aeromonas_phage	41.0	3.3e-28
WP_064144792.1|4013141_4013618_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.4	6.7e-37
WP_094617330.1|4013660_4013906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094617331.1|4013905_4017343_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	46.2	1.8e-152
WP_064141846.1|4017437_4017941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023297299.1|4018040_4018421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064141847.1|4018537_4019053_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	70.1	1.6e-60
WP_094617334.1|4019269_4019977_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	58.4	1.0e-73
WP_004151263.1|4020029_4020782_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004178853.1|4020850_4021243_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	3.3e-34
WP_094617336.1|4021239_4021665_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_023301678.1|4021667_4022030_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	3.3e-20
WP_094617338.1|4022029_4022203_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	1.9e-13
WP_040206659.1|4022202_4022583_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	4.1e-29
WP_057729233.1|4022585_4022852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057729234.1|4022884_4023940_-	hypothetical protein	NA	A0A291AXD4	Shigella_phage	53.2	1.0e-101
WP_057729235.1|4023936_4024398_-	hypothetical protein	NA	B1GS72	Salmonella_phage	51.0	2.9e-29
WP_094617341.1|4024397_4025753_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.9	1.9e-129
WP_094617390.1|4025982_4026981_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.8	5.4e-113
WP_064189753.1|4026916_4028368_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	53.5	1.1e-122
WP_094617343.1|4028379_4029948_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	91.2	1.1e-301
WP_094617345.1|4029944_4030595_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	88.4	1.2e-100
WP_032428651.1|4031076_4031427_-	hypothetical protein	NA	H2EQH5	Salmonella_phage	38.9	2.1e-11
WP_040172849.1|4031423_4031918_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	93.3	1.9e-87
WP_019704119.1|4031895_4032120_-|holin	holin	holin	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
WP_032413621.1|4033168_4033669_-	antiterminator	NA	G8C7V7	Escherichia_phage	92.1	2.5e-87
WP_087833398.1|4033665_4033806_-	YlcG family protein	NA	NA	NA	NA	NA
WP_094617347.1|4033802_4034438_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	73.2	1.3e-80
WP_049089532.1|4034430_4034601_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	3.7e-14
WP_001548464.1|4034606_4035203_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	1.2e-56
WP_074422708.1|4035372_4035657_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_050885305.1|4035666_4035966_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_094617349.1|4036317_4036539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094617351.1|4037464_4037860_-	hypothetical protein	NA	K7P881	Enterobacteria_phage	57.4	4.9e-17
WP_094617353.1|4037859_4038513_-	hypothetical protein	NA	H2BD37	Pseudomonas_phage	44.2	1.8e-24
WP_094617355.1|4038790_4039459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023341873.1|4039455_4039758_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046659687.1|4039754_4040492_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	3.1e-65
WP_064155319.1|4040488_4041454_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.0	2.6e-64
WP_040218315.1|4041513_4042311_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	71.5	2.5e-89
WP_004141720.1|4042397_4042718_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_004194000.1|4042758_4042986_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_094617357.1|4043054_4043777_+	helix-turn-helix domain-containing protein	NA	E7C9R0	Salmonella_phage	62.4	2.1e-74
WP_020804196.1|4043799_4043919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094617359.1|4044096_4044384_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	83.2	7.8e-41
WP_020947964.1|4044380_4045049_+	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	73.4	3.4e-79
WP_020947965.1|4045045_4045450_+	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	73.9	7.1e-48
WP_008807814.1|4045956_4046163_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_085841924.1|4046243_4046528_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	60.6	4.4e-28
WP_094617361.1|4046537_4047452_+	DNA recombinase	NA	G8C7T0	Escherichia_phage	90.5	7.3e-157
WP_059064910.1|4047448_4047931_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	93.1	4.8e-75
WP_094617363.1|4047964_4048270_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094617365.1|4048266_4048923_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.0	9.3e-114
WP_017898877.1|4048919_4049141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032438135.1|4049137_4049674_+	hypothetical protein	NA	J9Q748	Salmonella_phage	74.3	1.6e-71
WP_062920936.1|4049670_4049892_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_019704094.1|4049891_4050131_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	5.9e-10
WP_004223135.1|4050143_4050479_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_108193618.1|4050475_4051519_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	85.3	4.2e-177
WP_004143017.1|4051949_4052816_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4051534:4051579	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4052817_4053030_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_020803895.1|4053075_4054461_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
NZ_CP028389	Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence	166034	2955	44785	166034	integrase,transposase	Escherichia_phage(41.67%)	55	2337:2350	10357:10370
2337:2350	attL	AACTTAAAAGACAT	NA	NA	NA	NA
WP_004197635.1|2955_3750_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_017899884.1|3947_4964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389906.1|4974_5289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380813.1|5315_5675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023785.1|5879_6185_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001568025.1|6186_6405_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_071571078.1|6456_6651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100792567.1|6574_6913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017899886.1|7035_7233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023783.1|7222_7513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023782.1|7509_8637_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_015344964.1|8670_10263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023780.1|10469_11249_-	hypothetical protein	NA	NA	NA	NA	NA
10357:10370	attR	AACTTAAAAGACAT	NA	NA	NA	NA
WP_013023779.1|11261_11762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023778.1|12036_12300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023777.1|12296_12863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023776.1|12893_13388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048337418.1|13431_13800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098931.1|13833_14037_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_017899889.1|14085_14343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009653916.1|14418_14673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013609504.1|14808_15585_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_017899891.1|15825_16149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077268901.1|16327_16561_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	51.3	1.7e-17
WP_013023770.1|17387_18569_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_048337419.1|18932_19145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025999349.1|19266_19455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023768.1|19760_20618_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|20610_20688_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152385.1|20919_21171_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_052145515.1|21306_21816_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	3.7e-17
WP_001323889.1|21989_23567_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001067855.1|23890_24595_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000880559.1|24656_25364_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000240536.1|25350_26202_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|26506_27322_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|27382_28186_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|28185_29022_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|29082_29787_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|30019_30880_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|31666_32371_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|32560_33376_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|33526_34231_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|34352_35258_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|35254_36493_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|36492_37077_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336397.1|37022_37379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|37569_38334_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001297012.1|38421_38535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|38840_39341_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|39359_39539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|39468_40308_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_065908739.1|40798_41443_+	quinolone resistance pentapeptide repeat protein QnrB91	NA	NA	NA	NA	NA
WP_003833285.1|41484_41937_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_000050481.1|43243_44785_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP028389	Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence	166034	49513	103213	166034	integrase,transposase	Escherichia_phage(17.65%)	65	57033:57073	99232:99272
WP_000845048.1|49513_50527_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_023145375.1|50465_50780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|50997_51702_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|52078_52321_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|52352_53030_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804063.1|53108_54308_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|54574_54880_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214121.1|54907_56122_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_094545105.1|56338_57067_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
57033:57073	attL	TAAGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG	NA	NA	NA	NA
WP_001143759.1|57068_60074_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.8	0.0e+00
WP_001217881.1|60236_60794_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_013213985.1|60916_61897_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_004199234.1|62716_63598_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213987.1|64832_65129_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_013213989.1|65457_65883_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213990.1|65993_66272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389868.1|67640_68066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389867.1|68078_68519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389866.1|68590_68878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389865.1|68986_69190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389864.1|69285_69495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389863.1|69628_69892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389862.1|69978_70632_-	ParA family protein	NA	NA	NA	NA	NA
WP_053389861.1|70799_71252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249811.1|71511_72186_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	41.8	2.4e-16
WP_072161072.1|73265_73457_-	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053389859.1|73641_73896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389858.1|74204_74576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389871.1|74660_75209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389857.1|75246_75702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389856.1|75694_76531_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_053389855.1|76533_78573_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_053389870.1|79595_80309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389854.1|80320_81337_+	CpaF family protein	NA	NA	NA	NA	NA
WP_053389853.1|81869_82211_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_053389869.1|82372_82651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389852.1|82628_82988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389851.1|83003_85583_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_053389850.1|85579_86395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389849.1|86394_86850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389848.1|86898_87873_+	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
WP_053389847.1|87883_88606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389846.1|88610_89456_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_053389845.1|89457_90900_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_053389844.1|90880_91399_+	pilus assembly protein PilL	NA	NA	NA	NA	NA
WP_053389843.1|91408_91606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389842.1|91602_92295_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	59.6	1.3e-25
WP_108193612.1|92295_92655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389841.1|92657_92984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389840.1|92988_93261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389839.1|93490_93727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839878.1|93844_95236_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|95272_95845_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|95981_96572_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_077256884.1|96622_97198_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.3	1.6e-45
WP_000780222.1|97344_97626_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|97606_97936_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_048337415.1|98171_98429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|98462_99167_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004152383.1|99354_99663_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
99232:99272	attR	CTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCTTA	NA	NA	NA	NA
WP_014343480.1|99659_100310_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_014343481.1|100365_101010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072101986.1|101059_101656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013609537.1|101822_102416_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023834.1|102487_103213_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
>prophage 1
NZ_CP028390	Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence	208166	155441	207437	208166	protease,transposase,integrase	Caulobacter_phage(15.0%)	50	161150:161165	203543:203558
WP_004225018.1|155441_156437_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|156642_157656_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|157768_158296_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_077250518.1|158309_161267_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
161150:161165	attL	GCAGCAGAGAATGACA	NA	NA	NA	NA
WP_004144375.1|162108_162969_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_011251321.1|164700_165336_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_094617612.1|165672_166914_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
WP_004026611.1|166998_167574_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_004026609.1|167660_168239_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|168277_169318_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|169341_169797_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_094617614.1|169819_170971_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004210240.1|170967_171552_-	tellurium resistance protein	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
WP_023302789.1|171863_172922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049125915.1|172933_174076_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.0	8.3e-33
WP_004181732.1|174068_174842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094617616.1|174843_175923_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	8.6e-40
WP_014386544.1|175922_176879_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_016947106.1|176889_178113_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_004026591.1|178115_178574_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_014386542.1|179053_179692_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|179716_180358_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_004026585.1|180358_180997_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004210269.1|181089_182130_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_094617618.1|182129_183863_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_094617620.1|183890_185390_+	kinase	NA	NA	NA	NA	NA
WP_004196929.1|185768_186251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038992151.1|186526_186931_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_004118062.1|187478_187757_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004181742.1|187850_188063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900808.1|188694_188967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900807.1|188963_189416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|190666_191551_+	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_108193614.1|192153_192522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094617624.1|192740_193808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946352.1|193893_194148_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_094617626.1|194324_195461_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004026552.1|195526_195844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|195994_196318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094617628.1|196314_197073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386528.1|197069_198029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409750.1|198071_198479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213821.1|198488_198932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213807.1|200195_201164_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004902302.1|201432_203025_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|203055_203406_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|203402_203843_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
203543:203558	attR	TGTCATTCTCTGCTGC	NA	NA	NA	NA
WP_004902307.1|204039_204222_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|205299_206271_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004211841.1|206270_207437_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
