The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017716	Lacticaseibacillus paracasei strain TK1501 chromosome, complete genome	2942538	17813	52365	2942538	bacteriocin,protease,transposase	Faecalibacterium_phage(33.33%)	36	NA	NA
WP_003568480.1|17813_18671_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003568482.1|18750_18933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659010.1|18983_19163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568484.1|19651_20887_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_094515888.1|22260_23277_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	9.3e-36
WP_003568488.1|24868_25570_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_003568490.1|25849_26401_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568492.1|26444_27251_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003568494.1|27255_27576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568543.1|27801_28482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003659016.1|28414_28918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094515889.1|28937_31088_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_003568499.1|31432_32206_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003568500.1|32383_32989_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568502.1|33328_33553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568598.1|33708_34386_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_094515890.1|34550_35390_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003568911.1|35568_36984_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003568509.1|37061_37700_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568512.1|37928_39305_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_020751650.1|39496_40741_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.0	7.4e-11
WP_003562527.1|40997_41342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|41417_41777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562542.1|42017_43460_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003562544.1|43654_44290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562546.1|44339_44651_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003568911.1|44867_46283_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003562548.1|46388_46577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562550.1|46708_47320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094515891.1|47677_48151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568611.1|48348_48687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562555.1|49020_49731_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003562558.1|49717_50047_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_003659037.1|50284_50575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562560.1|50927_51143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568613.1|51489_52365_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP017716	Lacticaseibacillus paracasei strain TK1501 chromosome, complete genome	2942538	332075	463576	2942538	protease,transposase	Lactobacillus_phage(26.67%)	103	NA	NA
WP_003568911.1|332075_333491_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003568867.1|334386_335466_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003563162.1|335634_336960_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003563165.1|336996_337335_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003563167.1|337383_337716_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003563169.1|337868_338909_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003563171.1|338893_340687_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003568874.1|341115_342363_-	peptidase T	NA	NA	NA	NA	NA
WP_003568883.1|344359_345001_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003577532.1|345270_345519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094515908.1|346467_347034_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003563183.1|347040_348384_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	6.3e-16
WP_003563185.1|348388_349036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563187.1|349123_349816_+	thiaminase II	NA	NA	NA	NA	NA
WP_003563188.1|349796_350297_+	energy coupling factor transporter S component ThiW	NA	NA	NA	NA	NA
WP_003563190.1|350309_351152_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_003568887.1|351148_351790_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003563195.1|351779_352607_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003563196.1|352991_354440_+	amino acid permease	NA	NA	NA	NA	NA
WP_094515910.1|354760_355547_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003563198.1|355607_355853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094515911.1|355991_357407_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003659718.1|357675_357864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568895.1|358912_359920_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003563204.1|359980_360373_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_003563207.1|360544_362047_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.3e-21
WP_003563209.1|362030_363053_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_003563210.1|363067_364027_+	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_094515912.1|364166_365096_+	ribokinase	NA	NA	NA	NA	NA
WP_003563215.1|365513_367505_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003563217.1|367784_368393_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003563218.1|368494_370024_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003563220.1|370027_370993_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	7.0e-25
WP_003563222.1|371065_372010_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_003659730.1|372212_373595_+	MFS transporter	NA	NA	NA	NA	NA
WP_003563228.1|373575_374010_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003563229.1|374006_374570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563232.1|374582_374798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563234.1|375611_376301_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003563236.1|376364_377051_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003568906.1|377562_379089_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	9.6e-53
WP_003563240.1|379360_381457_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003563244.1|381457_381769_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003563247.1|382033_383320_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003563248.1|383336_383759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563251.1|383780_384641_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003563253.1|384754_385396_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003563255.1|385682_386513_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003563257.1|386505_387375_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003563259.1|387414_388410_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_003563261.1|388964_389744_+	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	25.4	1.0e-05
WP_094515913.1|390014_390314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015975057.1|390354_391197_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	100.0	1.6e-158
WP_002816285.1|391250_391502_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_025375948.1|391790_392711_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_094515914.1|395606_396623_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	7.1e-36
WP_191982030.1|398535_399993_+	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_094515915.1|400564_401971_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003568911.1|402301_403717_+|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003563277.1|405554_405926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563273.1|406038_406437_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_094516098.1|406658_406778_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094515915.1|407639_409046_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003563280.1|409220_410063_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003568947.1|411221_411959_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_094515911.1|412056_413472_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003563282.1|414330_416616_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003563285.1|417098_417992_+	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_003563286.1|418158_419643_-	anion permease	NA	NA	NA	NA	NA
WP_060417070.1|419644_420922_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003568957.1|421075_421963_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003563289.1|422236_423079_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_003563290.1|423170_423731_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003563291.1|423732_425433_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	25.0	4.4e-22
WP_003563292.1|425429_426257_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_094515916.1|426586_429565_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.1e-148
WP_003563295.1|429597_431079_+	amino acid permease	NA	NA	NA	NA	NA
WP_003563297.1|431192_432647_+	amino acid permease	NA	NA	NA	NA	NA
WP_094515897.1|433677_435084_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_191982031.1|435206_435530_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003563299.1|436312_436624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563308.1|436918_439453_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003563311.1|439736_440174_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003563323.1|440186_440681_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003563326.1|440833_441697_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003563328.1|441699_442545_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003563330.1|442578_442911_+	PTS sugar transporter	NA	NA	NA	NA	NA
WP_003563332.1|443116_447007_+	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_003563336.1|448134_448797_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003563338.1|448834_449596_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003563340.1|449769_450417_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_003563342.1|450432_450996_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_003563344.1|451053_453018_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_003563346.1|453046_454231_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_003563351.1|455512_456262_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.5	4.2e-25
WP_003563353.1|456271_457150_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003563355.1|457164_457833_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003563357.1|457829_458516_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003563359.1|458942_460211_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	3.5e-48
WP_003563361.1|460612_461143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563363.1|461310_461463_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_003563366.1|461472_462237_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A075KJD2	Lactobacillus_phage	49.2	9.7e-46
WP_094515917.1|462559_463576_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	7.1e-36
>prophage 3
NZ_CP017716	Lacticaseibacillus paracasei strain TK1501 chromosome, complete genome	2942538	1045834	1100031	2942538	integrase,transposase	Lactobacillus_phage(69.23%)	63	1053546:1053560	1093596:1093610
WP_094515917.1|1045834_1046851_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	7.1e-36
WP_003569800.1|1047243_1048317_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_003569802.1|1048474_1049389_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.6	8.5e-73
WP_072671810.1|1049582_1049693_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_157698600.1|1049879_1050368_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_094515917.1|1050424_1051441_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	7.1e-36
WP_003568911.1|1052091_1053507_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
1053546:1053560	attL	AAATGCAGGAAAACA	NA	NA	NA	NA
WP_003586346.1|1053995_1054856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052915994.1|1055106_1056351_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	1.5e-11
WP_003569846.1|1056543_1057992_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_094515935.1|1058072_1059926_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003604899.1|1060013_1060844_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003585081.1|1061509_1064173_-	YfhO family protein	NA	NA	NA	NA	NA
WP_003569856.1|1064482_1066222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569858.1|1066573_1067503_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	48.1	6.0e-74
WP_003606991.1|1067589_1068228_-	YkyA family protein	NA	NA	NA	NA	NA
WP_094515936.1|1068355_1069321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569868.1|1069384_1069597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566521.1|1070280_1070481_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.2e-19
WP_003569870.1|1070722_1071205_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016367160.1|1071204_1071846_+	glycoside hydrolase family 73 protein	NA	A0A0A7RUS8	Clostridium_phage	46.4	3.2e-26
WP_003566514.1|1072036_1072615_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003566511.1|1072621_1073950_+	purine permease	NA	Q9KX94	Enterobacteria_phage	31.7	1.6e-35
WP_003569875.1|1073970_1075080_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003566506.1|1075149_1076445_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.8	4.2e-17
WP_094515937.1|1076566_1077136_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003585070.1|1077145_1077892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569886.1|1077977_1080233_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.7	9.5e-158
WP_003569888.1|1080698_1081304_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003566496.1|1081475_1082333_+	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_003566494.1|1082546_1083887_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_013245374.1|1084086_1085331_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	2.0e-11
WP_016381465.1|1085482_1086667_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.2	5.6e-226
WP_019892397.1|1087011_1088013_-	hypothetical protein	NA	A0A1S5SA20	Streptococcus_phage	23.9	2.2e-05
WP_003606996.1|1088122_1088326_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	95.5	2.1e-32
WP_094515938.1|1088349_1088490_-	pyridoxamine 5'-phosphate oxidase	NA	A0A0P0I7K6	Lactobacillus_phage	96.8	5.9e-10
WP_094515939.1|1088552_1089383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094515940.1|1089427_1089850_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	96.4	1.6e-74
WP_080647126.1|1089839_1090178_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	99.1	1.0e-55
WP_094515941.1|1090312_1090555_+	helix-turn-helix transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	93.8	1.3e-33
WP_094515942.1|1090551_1090863_+	hypothetical protein	NA	A0A1B0Y2Q8	Lactobacillus_phage	98.1	1.4e-51
WP_094515943.1|1090859_1091069_-	hypothetical protein	NA	A0A1B0Y3M6	Lactobacillus_phage	95.7	5.3e-31
WP_191982028.1|1091156_1091303_+	hypothetical protein	NA	A0A1B0YC03	Lactobacillus_phage	97.9	2.9e-20
WP_003582311.1|1091368_1091917_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	98.9	4.1e-99
WP_016373290.1|1091895_1092117_+	helix-turn-helix domain-containing protein	NA	A0A0P0ID64	Lactobacillus_phage	98.6	2.4e-37
WP_003574532.1|1092357_1092765_+	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	94.1	6.0e-71
WP_094515944.1|1092777_1093635_+	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	97.2	4.4e-156
1093596:1093610	attR	AAATGCAGGAAAACA	NA	NA	NA	NA
WP_094516104.1|1093597_1094422_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	91.6	2.6e-145
WP_094515945.1|1094437_1095286_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	91.0	4.6e-105
WP_094515946.1|1095272_1096055_+	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	89.6	2.1e-128
WP_094515947.1|1096051_1096381_+	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	74.1	2.5e-35
WP_094515948.1|1096381_1096636_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	91.7	2.3e-36
WP_003595408.1|1096632_1096998_+	hypothetical protein	NA	A0A0P0I7M2	Lactobacillus_phage	99.2	6.9e-66
WP_094515949.1|1097105_1097369_+	hypothetical protein	NA	B4XYT2	Lactobacillus_phage	97.7	1.1e-41
WP_094515950.1|1097365_1097929_+	DUF1642 domain-containing protein	NA	Q6J1U8	Lactobacillus_phage	56.8	1.6e-50
WP_094515951.1|1097918_1098098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094515952.1|1098084_1098300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094515953.1|1098292_1098499_+	hypothetical protein	NA	B4XYT6	Lactobacillus_phage	97.1	4.3e-33
WP_019892333.1|1098495_1098756_+	hypothetical protein	NA	B4XYT7	Lactobacillus_phage	51.3	1.2e-08
WP_019892332.1|1098752_1098962_+	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	91.3	4.2e-28
WP_019892330.1|1099181_1099568_+	hypothetical protein	NA	A0A2D1GPA7	Lactobacillus_phage	59.1	1.1e-37
WP_019892328.1|1099560_1099803_+	hypothetical protein	NA	U5U734	Lactobacillus_phage	87.5	3.5e-34
WP_164998035.1|1099872_1100031_+	hypothetical protein	NA	A0A0N7IR95	Lactobacillus_phage	98.1	1.1e-20
>prophage 4
NZ_CP017716	Lacticaseibacillus paracasei strain TK1501 chromosome, complete genome	2942538	1103161	1126373	2942538	capsid,terminase,tail,portal,holin	Lactobacillus_phage(62.5%)	26	NA	NA
WP_019892314.1|1103161_1104379_+	hypothetical protein	NA	A0A2D1GPQ9	Lactobacillus_phage	98.0	1.7e-238
WP_094515954.1|1104514_1105048_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	94.8	1.6e-63
WP_094515955.1|1105025_1106342_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	60.1	8.9e-156
WP_094515956.1|1106405_1107953_+|portal	phage portal protein	portal	M1IFC5	Streptococcus_phage	46.7	2.2e-121
WP_094515957.1|1107952_1109098_+|capsid	capsid protein	capsid	O03929	Lactobacillus_phage	43.9	2.7e-68
WP_094515958.1|1109107_1109434_+	hypothetical protein	NA	A0A0P0IJR5	Lactobacillus_phage	87.0	1.7e-47
WP_094515959.1|1109430_1109796_+	hypothetical protein	NA	A0A1Q1PVR6	Bacillus_phage	52.3	5.9e-17
WP_094515960.1|1109911_1110505_+	phage scaffolding protein	NA	Q9T1B8	Listeria_phage	41.3	4.2e-20
WP_094515961.1|1110520_1111510_+|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	48.9	1.3e-61
WP_094515962.1|1111576_1111996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094515963.1|1111985_1112336_+|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	34.0	6.0e-11
WP_094515964.1|1112335_1112704_+|capsid	capsid protein	capsid	M1HNV2	Streptococcus_phage	32.3	2.3e-05
WP_094515965.1|1112700_1113093_+|capsid	minor capsid protein	capsid	O03934	Lactobacillus_phage	39.2	4.2e-21
WP_094515966.1|1113099_1113567_+|capsid	capsid protein	capsid	O03972	Lactobacillus_phage	61.1	1.1e-44
WP_094516105.1|1113584_1113821_+	Ig domain-containing protein	NA	B8QTT6	Erwinia_phage	57.3	2.2e-09
WP_094515967.1|1113886_1114318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094515968.1|1114310_1114931_+	hypothetical protein	NA	O03936	Lactobacillus_phage	42.9	1.1e-31
WP_094515969.1|1114949_1119581_+	tape measure protein	NA	O03937	Lactobacillus_phage	50.5	6.8e-118
WP_094515970.1|1119577_1121485_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	46.0	7.1e-146
WP_094515971.1|1121485_1123993_+|tail	phage tail protein	tail	A8YQK1	Lactobacillus_phage	65.6	0.0e+00
WP_094515972.1|1124002_1124293_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	79.2	1.1e-37
WP_094515973.1|1124285_1124417_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	90.7	6.1e-17
WP_016373433.1|1124447_1124834_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	100.0	2.5e-66
WP_094515974.1|1124814_1125057_+	hypothetical protein	NA	U5U779	Lactobacillus_phage	96.2	2.1e-23
WP_094515975.1|1125046_1125319_+|holin	holin	holin	Q9MCC7	Lactobacillus_phage	98.9	1.4e-42
WP_094515976.1|1125320_1126373_+	peptidoglycan recognition protein	NA	A0A0P0I386	Lactobacillus_phage	93.4	4.1e-196
>prophage 5
NZ_CP017716	Lacticaseibacillus paracasei strain TK1501 chromosome, complete genome	2942538	1906049	1979507	2942538	protease,transposase	Burkholderia_virus(21.43%)	59	NA	NA
WP_003566268.1|1906049_1906811_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
WP_003566270.1|1906985_1907753_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003566272.1|1908061_1909657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094515911.1|1910205_1911621_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_094516018.1|1911927_1912257_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003566277.1|1912633_1913278_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_013245859.1|1913603_1915097_-	protein kinase	NA	M1HHG8	Acanthocystis_turfacea_Chlorella_virus	30.0	3.9e-14
WP_003566280.1|1915465_1915678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566282.1|1915977_1916454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566286.1|1916915_1917140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094516019.1|1917577_1918993_-	group II intron reverse transcriptase domain-containing protein	NA	NA	NA	NA	NA
WP_003566290.1|1919138_1919291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566292.1|1919592_1921146_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.4	1.8e-14
WP_003566294.1|1921318_1922245_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	4.1e-30
WP_003566296.1|1922400_1922763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566298.1|1922809_1923100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003570749.1|1923163_1924573_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003566302.1|1924904_1925381_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003566303.1|1925385_1927677_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003566305.1|1928700_1928895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016386493.1|1928966_1930796_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003566310.1|1930851_1931757_+	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003570777.1|1931814_1932276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566315.1|1932387_1933740_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003566318.1|1933726_1934692_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003566320.1|1934849_1935509_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003566321.1|1935859_1937668_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003566323.1|1937680_1938439_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.9e-33
WP_003566325.1|1938739_1940395_+	amino acid permease	NA	NA	NA	NA	NA
WP_003566327.1|1940530_1941412_+	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_003566329.1|1941549_1942845_+	GTPase HflX	NA	NA	NA	NA	NA
WP_013245374.1|1942933_1944178_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	2.0e-11
WP_003566331.1|1944452_1945451_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_003570789.1|1945760_1948085_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_003566334.1|1948372_1949422_-	EpsG family protein	NA	NA	NA	NA	NA
WP_094516020.1|1949499_1950135_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_003566338.1|1950192_1950885_-	tyrosine-protein kinase modulator	NA	NA	NA	NA	NA
WP_003570792.1|1951128_1952568_-	histidine kinase	NA	NA	NA	NA	NA
WP_003566340.1|1952582_1953719_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003566341.1|1953773_1954739_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.8	3.9e-07
WP_003566343.1|1955149_1956823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566345.1|1956977_1958717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094516021.1|1958912_1960994_-	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_003566349.1|1961132_1962620_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_003566350.1|1962870_1963911_+	acyltransferase	NA	NA	NA	NA	NA
WP_003566352.1|1964038_1965031_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	35.4	6.5e-42
WP_003566354.1|1965102_1966245_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	28.6	5.2e-27
WP_003566356.1|1966506_1967373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041091597.1|1967529_1968936_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094516022.1|1969167_1970412_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.7	1.7e-10
WP_003566555.1|1970552_1971953_-	sugar transferase	NA	NA	NA	NA	NA
WP_003566557.1|1972083_1972824_-	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	27.4	2.2e-10
WP_003566559.1|1972845_1973601_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003566560.1|1973685_1974636_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.9	1.5e-35
WP_003566562.1|1974779_1975442_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003566566.1|1975457_1976102_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003566568.1|1976103_1976928_-	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004561979.1|1977061_1977793_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	2.7e-37
WP_013245374.1|1978262_1979507_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	2.0e-11
>prophage 6
NZ_CP017716	Lacticaseibacillus paracasei strain TK1501 chromosome, complete genome	2942538	1984897	2046103	2942538	tRNA,protease,integrase,transposase	Faecalibacterium_phage(18.18%)	41	2043928:2043947	2047309:2047328
WP_003570829.1|1984897_1986172_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	43.1	2.7e-85
WP_003566598.1|1986705_1987650_-	cation transporter	NA	NA	NA	NA	NA
WP_003566600.1|1987824_1988160_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003566602.1|1988334_1989264_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003566613.1|1989711_1991490_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_003566615.1|1991739_1994148_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.0	1.2e-12
WP_003566619.1|1995801_1996971_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_003659327.1|1996967_1998110_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_016379636.1|1998106_2000206_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_003566632.1|2000582_2001614_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003570836.1|2001880_2002771_-	sortase	NA	NA	NA	NA	NA
WP_003580111.1|2003128_2003959_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	26.5	2.4e-18
WP_003570838.1|2004425_2006357_-	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_003570841.1|2006790_2007192_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003570843.1|2007826_2009977_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.7	2.3e-121
WP_003570845.1|2010358_2011123_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003588306.1|2011300_2012194_+	LCP family protein	NA	NA	NA	NA	NA
WP_094515911.1|2013541_2014957_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_003570926.1|2015355_2016036_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_094516024.1|2016281_2017298_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	8.4e-37
WP_003570929.1|2017462_2018212_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_003588334.1|2018227_2019145_-	tyrosine-protein kinase modulator	NA	NA	NA	NA	NA
WP_003574021.1|2020234_2021155_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_094516025.1|2021320_2022601_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_094516026.1|2022668_2023685_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	3.2e-36
WP_094516027.1|2023804_2025208_-	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003574021.1|2025311_2026232_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003580147.1|2027073_2027793_+	acyltransferase	NA	NA	NA	NA	NA
WP_003659358.1|2028072_2028573_-	QueT transporter family protein	NA	NA	NA	NA	NA
WP_003570956.1|2028684_2029398_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_003566696.1|2029394_2029619_-	DUF2829 domain-containing protein	NA	A8AT88	Listeria_phage	34.4	1.0e-08
WP_003570981.1|2031986_2032730_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003570983.1|2033007_2033754_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_020967568.1|2034099_2036682_-	AAA family ATPase	NA	U5J9B0	Bacillus_phage	25.5	1.5e-50
WP_003570989.1|2036722_2037313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003570991.1|2037738_2038344_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003570994.1|2039029_2039842_-	sugar kinase	NA	NA	NA	NA	NA
WP_003570997.1|2040844_2041651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003570999.1|2041698_2043834_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_134791049.1|2043899_2045081_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
2043928:2043947	attL	ACGCTTGGGAAAAGCGTAAA	NA	NA	NA	NA
WP_003571004.1|2045176_2046103_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	48.7	1.1e-78
WP_003571004.1|2045176_2046103_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	48.7	1.1e-78
2047309:2047328	attR	TTTACGCTTTTCCCAAGCGT	NA	NA	NA	NA
>prophage 7
NZ_CP017716	Lacticaseibacillus paracasei strain TK1501 chromosome, complete genome	2942538	2279524	2396474	2942538	bacteriocin,tRNA,protease,transposase	Streptococcus_phage(22.22%)	110	NA	NA
WP_094516046.1|2279524_2281018_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003567231.1|2281165_2282146_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003567233.1|2282261_2282933_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003567235.1|2283116_2283947_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094516047.1|2284092_2284932_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003567240.1|2284944_2285961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567242.1|2285967_2286342_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567244.1|2286505_2287777_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003567246.1|2288093_2288870_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003567248.1|2288887_2289775_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	8.9e-35
WP_003567250.1|2289958_2290855_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567252.1|2290957_2292073_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003567254.1|2292094_2293459_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|2293475_2294018_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003567258.1|2294238_2294529_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567260.1|2294645_2295023_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003571381.1|2295267_2296587_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	9.2e-60
WP_003571383.1|2296909_2298256_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003567265.1|2298483_2299584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003576229.1|2299580_2300777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567269.1|2300839_2301718_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003567271.1|2301879_2303934_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.5e-64
WP_094516048.1|2304090_2306721_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.2	1.4e-88
WP_003567275.1|2306882_2307506_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003567277.1|2308006_2308678_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003567279.1|2309187_2310309_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567280.1|2310322_2310607_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003571392.1|2310797_2311913_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|2312100_2312307_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|2312439_2312697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2312767_2312974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567290.1|2313198_2313450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567292.1|2313777_2315010_+	MFS transporter	NA	NA	NA	NA	NA
WP_003567294.1|2315088_2316345_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	1.6e-98
WP_003567296.1|2316433_2317267_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	2.1e-46
WP_003567298.1|2317583_2317778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003571396.1|2318031_2318568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567302.1|2318756_2319980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567303.1|2320569_2321397_-	class C sortase	NA	NA	NA	NA	NA
WP_003571398.1|2321403_2322963_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_003571400.1|2322959_2324282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003571401.1|2324283_2327289_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003567312.1|2327566_2328124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094516049.1|2328218_2329415_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003659566.1|2329623_2330679_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003567322.1|2331694_2332024_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567324.1|2332020_2332809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567326.1|2332861_2333650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2333694_2333973_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567331.1|2333996_2334281_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567333.1|2334473_2334770_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|2334871_2336227_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2336532_2336844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567340.1|2336916_2337267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094516050.1|2337440_2338820_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_003567347.1|2338830_2341023_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.7	8.1e-37
WP_003571414.1|2341488_2341626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002816285.1|2342004_2342256_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_015975057.1|2342309_2343152_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	100.0	1.6e-158
WP_003659579.1|2343359_2343557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567354.1|2344103_2344343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191982021.1|2344602_2344776_-|bacteriocin	bacteriocin leader domain-containing protein	bacteriocin	NA	NA	NA	NA
WP_003567358.1|2344810_2344999_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567359.1|2345320_2345545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567363.1|2346345_2347158_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003567365.1|2347714_2348047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567367.1|2348298_2348490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003571419.1|2348802_2349138_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567372.1|2349256_2349853_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003659595.1|2350123_2350432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567374.1|2350567_2350783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567376.1|2350779_2351013_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_094516052.1|2351284_2352238_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	4.8e-10
WP_003567380.1|2352442_2353177_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003567382.1|2353202_2354366_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003567384.1|2354627_2356004_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003567386.1|2356136_2356895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567390.1|2357186_2358794_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003567392.1|2359181_2361899_+	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	28.7	4.1e-62
WP_003567394.1|2362198_2362564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567396.1|2362717_2364091_-	MFS transporter	NA	NA	NA	NA	NA
WP_003567398.1|2364130_2365660_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003567401.1|2365905_2366097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094516053.1|2366225_2366864_+	cation transporter	NA	NA	NA	NA	NA
WP_003567405.1|2366884_2367217_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003567408.1|2367337_2368279_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567411.1|2368275_2369172_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003567413.1|2369168_2369912_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.1e-12
WP_003571433.1|2370187_2371654_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003567416.1|2371854_2372124_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003567418.1|2372212_2372332_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003567420.1|2372532_2373450_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567422.1|2373689_2374331_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003567423.1|2374448_2375081_-	NUDIX hydrolase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003567424.1|2375237_2375762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567426.1|2376024_2377860_+	membrane protein	NA	NA	NA	NA	NA
WP_003571436.1|2378010_2378913_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567431.1|2379154_2379304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191982022.1|2379909_2380752_-	FliK family flagellar hook-length control protein	NA	NA	NA	NA	NA
WP_003568911.1|2380905_2382321_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_191982023.1|2382444_2383857_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_003567435.1|2384031_2385219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157698601.1|2385475_2386741_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	39.2	6.7e-84
WP_003567437.1|2388043_2388208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567439.1|2388590_2388947_-	CrcB family protein	NA	NA	NA	NA	NA
WP_003567441.1|2388940_2389351_-	CrcB family protein	NA	NA	NA	NA	NA
WP_003659617.1|2389941_2390229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659618.1|2390405_2391692_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.6	4.8e-106
WP_003571450.1|2391767_2394023_+	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.1	1.2e-38
WP_041091597.1|2395067_2396474_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017716	Lacticaseibacillus paracasei strain TK1501 chromosome, complete genome	2942538	2417333	2472810	2942538	tRNA,integrase,transposase	Streptococcus_phage(52.63%)	74	2411328:2411347	2444943:2444962
2411328:2411347	attL	TTACGAGCCTTCTTCAGACC	NA	NA	NA	NA
WP_019864310.1|2417333_2418722_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	61.6	1.1e-151
WP_019864308.1|2418711_2418987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094516055.1|2418989_2419847_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_019864304.1|2419843_2420431_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_094516056.1|2420513_2420774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094516057.1|2421075_2422266_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	44.1	4.3e-93
WP_094516058.1|2422255_2422582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094516059.1|2422712_2423447_+	site-specific DNA-methyltransferase	NA	A0A2K8IKC3	Lactococcus_phage	53.6	7.3e-67
WP_003606383.1|2423545_2423767_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.6	1.7e-27
WP_094516060.1|2423770_2424268_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	44.6	2.2e-35
WP_094516061.1|2424329_2424722_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	70.0	1.1e-45
WP_094516062.1|2424705_2427171_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	65.0	0.0e+00
WP_094516063.1|2427157_2429260_+	conjugal transfer protein	NA	A0A1S5SF30	Streptococcus_phage	52.3	6.6e-145
WP_094516064.1|2429256_2430252_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	60.3	6.6e-111
WP_032799524.1|2430261_2430795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019860875.1|2430791_2431715_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	38.3	1.9e-56
WP_094516065.1|2432130_2433471_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	38.6	1.1e-84
WP_191982024.1|2433696_2434284_+	hypothetical protein	NA	K4I413	Acidithiobacillus_phage	32.0	3.5e-19
WP_003663191.1|2434283_2435042_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	35.8	1.4e-41
WP_003663192.1|2435038_2435245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094516066.1|2435501_2435687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094516067.1|2435676_2435883_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_094515914.1|2436994_2438011_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	7.1e-36
WP_094516068.1|2439013_2439805_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_041091597.1|2439944_2441351_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094516069.1|2441509_2441845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019857340.1|2442085_2442484_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_050571013.1|2443040_2443379_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019857345.1|2443440_2444709_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A097BYJ7	Leuconostoc_phage	23.8	6.8e-20
WP_016382649.1|2444917_2445310_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
2444943:2444962	attR	TTACGAGCCTTCTTCAGACC	NA	NA	NA	NA
WP_003567485.1|2445323_2445770_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003567488.1|2446013_2446625_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567491.1|2446704_2447763_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003567493.1|2447764_2448475_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.9	2.2e-31
WP_003567496.1|2448648_2448870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567498.1|2449155_2449917_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567500.1|2450012_2450756_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003567501.1|2450769_2451564_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_003567503.1|2451556_2452423_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	5.0e-14
WP_003567505.1|2452398_2453235_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	1.9e-23
WP_003567507.1|2453378_2454050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567509.1|2454466_2454850_-	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_003567511.1|2454871_2455810_-	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_003567514.1|2455884_2456274_-	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_003567516.1|2456294_2456660_-	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_003567518.1|2456693_2456810_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_003567521.1|2456837_2457056_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003567523.1|2457199_2457856_-	adenylate kinase	NA	NA	NA	NA	NA
WP_003567525.1|2458003_2459329_-	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_003567527.1|2459328_2459769_-	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_003567529.1|2459802_2459988_-	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_003567531.1|2459999_2460503_-	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_003567533.1|2460525_2460885_-	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_003567536.1|2460922_2461453_-	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_003567538.1|2461483_2461882_-	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_003567540.1|2461907_2462093_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003567542.1|2462107_2462650_-	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_003567544.1|2462674_2462986_-	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_003567546.1|2463015_2463384_-	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_003567548.1|2463415_2463679_-	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_003567550.1|2463699_2463894_-	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_003567551.1|2463883_2464318_-	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_003571453.1|2464321_2464984_-	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_003567555.1|2464997_2465351_-	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_003567557.1|2465368_2465650_-	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_003567560.1|2465689_2466526_-	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_003567562.1|2466554_2466857_-	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_003567564.1|2466856_2467480_-	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_003567566.1|2467502_2468135_-	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_003567567.1|2468160_2468469_-	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_003567569.1|2468793_2469231_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_003567571.1|2469373_2469937_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003567572.1|2470216_2471251_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_013245374.1|2471565_2472810_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	2.0e-11
>prophage 9
NZ_CP017716	Lacticaseibacillus paracasei strain TK1501 chromosome, complete genome	2942538	2893626	2906395	2942538	capsid,terminase,head,tail,portal,integrase	Lactobacillus_phage(33.33%)	17	2893510:2893529	2908394:2908413
2893510:2893529	attL	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
WP_003571952.1|2893626_2894784_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.0	5.1e-46
WP_003571954.1|2894879_2895533_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003571956.1|2895661_2895940_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032774358.1|2896005_2896416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003571962.1|2896764_2897040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003571964.1|2897036_2897225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032774359.1|2897208_2898021_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	32.5	6.7e-13
WP_003571968.1|2898024_2899620_+	hypothetical protein	NA	A0A0M4RE09	Enterococcus_phage	31.3	2.6e-40
WP_003571970.1|2899940_2900111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191978565.1|2900186_2900561_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	38.9	4.2e-10
WP_094516095.1|2900685_2901156_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	29.3	1.9e-07
WP_003571974.1|2901152_2902856_+|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	40.0	1.9e-118
WP_003571976.1|2902821_2903001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003571978.1|2903005_2904190_+|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.0	1.5e-61
WP_003571979.1|2904176_2905718_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.5	1.6e-39
WP_003571981.1|2905779_2906070_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003571983.1|2906053_2906395_+|head	phage head closure protein	head	I7AUE6	Enterococcus_phage	39.7	5.5e-09
2908394:2908413	attR	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
