The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041092	Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 chromosome, complete genome	5215652	2653594	2664480	5215652		Escherichia_phage(87.5%)	9	NA	NA
WP_094487985.1|2653594_2656702_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_004176258.1|2656756_2658022_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2658051_2659140_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2659226_2659487_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2659784_2660645_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|2660665_2661427_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_094487986.1|2661687_2662590_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004224682.1|2662601_2663867_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2663859_2664480_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
NZ_CP041092	Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 chromosome, complete genome	5215652	3368606	3378080	5215652	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004224003.1|3368606_3370328_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_094488004.1|3370372_3371074_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3371427_3371646_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3371776_3374056_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3374086_3374404_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3374729_3374951_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3375027_3376968_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3376964_3378080_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 3
NZ_CP041092	Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 chromosome, complete genome	5215652	3863415	3908640	5215652	integrase,terminase,head,tRNA	Enterobacteria_phage(22.0%)	66	3859604:3859649	3905712:3905757
3859604:3859649	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_094488118.1|3863415_3865188_-	GDSL family lipase	NA	A0A286S1P0	Klebsiella_phage	48.1	9.9e-17
WP_094354735.1|3865272_3867750_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	3.6e-198
WP_023328737.1|3867736_3868132_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	55.6	1.2e-36
WP_032419293.1|3868128_3868599_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
WP_094354772.1|3868598_3869018_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	1.2e-29
WP_094488117.1|3869117_3872618_-	tape measure protein	NA	R9TMK1	Aeromonas_phage	50.8	1.4e-171
WP_075394854.1|3872677_3873292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094354737.1|3873343_3873685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032456984.1|3873788_3874169_-	lipoprotein	NA	NA	NA	NA	NA
WP_065801823.1|3874276_3874834_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	89.3	6.7e-89
WP_094354738.1|3875050_3875764_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	6.2e-63
WP_094354739.1|3875830_3876595_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.6	3.6e-40
WP_094354740.1|3876653_3877037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094354741.1|3877033_3877402_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	7.7e-49
WP_085876762.1|3877404_3877767_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	1.9e-20
WP_061357254.1|3877766_3877940_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
WP_094354742.1|3877939_3878320_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	1.6e-28
WP_032428666.1|3878322_3878610_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	75.6	1.4e-13
WP_094488116.1|3878649_3879681_-	encapsulating for peroxidase	NA	A0A0M3LQZ1	Mannheimia_phage	52.3	2.4e-95
WP_023339710.1|3879692_3880127_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	47.8	2.2e-26
WP_094354744.1|3880126_3881506_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.1	5.1e-130
WP_053003098.1|3881558_3881903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094354745.1|3881903_3882914_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	70.5	3.7e-117
WP_094354746.1|3882840_3884310_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.3	2.4e-149
WP_023283353.1|3884322_3885621_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	94.6	1.4e-241
WP_094354747.1|3885604_3886072_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	74.5	2.6e-57
WP_094354748.1|3886103_3886739_-	hypothetical protein	NA	I6S676	Salmonella_phage	82.5	1.9e-103
WP_038421593.1|3886836_3887028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094354749.1|3887134_3887404_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	56.2	1.2e-19
WP_094354750.1|3887294_3887672_-	DUF2570 domain-containing protein	NA	M9NYX9	Enterobacteria_phage	46.2	1.4e-08
WP_094354751.1|3887772_3888276_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	82.0	1.3e-75
WP_004146347.1|3888278_3888593_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_094354773.1|3889134_3889824_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	3.5e-63
WP_032431116.1|3889823_3889964_-	YlcG family protein	NA	NA	NA	NA	NA
WP_094354752.1|3889960_3890323_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	79.8	1.2e-49
WP_094354753.1|3890319_3890610_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	5.3e-45
WP_004884194.1|3890602_3890773_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	65.5	7.2e-10
WP_004884220.1|3890772_3891228_-	dLP12 prophage	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
WP_139988880.1|3891717_3891909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094354755.1|3892300_3892504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094354757.1|3893972_3894488_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.1	2.3e-11
WP_094354758.1|3894484_3894778_-	winged helix-turn-helix transcriptional regulator	NA	O48423	Enterobacteria_phage	63.4	2.1e-25
WP_094354759.1|3894774_3895623_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.4	1.3e-88
WP_094354760.1|3895619_3896480_-	replication protein	NA	K7PGT1	Enterobacteria_phage	52.6	6.6e-59
WP_038435002.1|3896514_3896799_-	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	56.2	1.3e-19
WP_032431544.1|3896839_3897067_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	5.6e-18
WP_065799877.1|3897135_3897858_+	helix-turn-helix domain-containing protein	NA	E7C9R0	Salmonella_phage	62.8	4.2e-75
WP_032429932.1|3898058_3898424_+	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	49.1	1.3e-19
WP_094354761.1|3898889_3899114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704100.1|3899325_3899520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339056.1|3899607_3900003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339054.1|3900135_3900795_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	36.9	6.9e-24
WP_023339053.1|3900796_3901465_+	AAA family ATPase	NA	G9L667	Escherichia_phage	44.3	1.1e-48
WP_094354763.1|3901476_3902181_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	40.2	3.0e-25
WP_094354764.1|3902192_3902369_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	48.0	7.7e-07
WP_094354765.1|3902365_3903022_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	6.0e-113
WP_009483861.1|3903018_3903237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094354766.1|3903233_3903917_+	morphogenetic protein	NA	Q71T76	Escherichia_phage	56.7	2.0e-58
WP_062920935.1|3903913_3904105_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	59.3	1.1e-11
WP_094354767.1|3904101_3904320_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_071531921.1|3904321_3904657_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094354768.1|3904533_3905697_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	1.7e-203
WP_094488115.1|3905766_3906090_-	hypothetical protein	NA	NA	NA	NA	NA
3905712:3905757	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_094488114.1|3906128_3906995_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.2	4.5e-31
WP_004143016.1|3906996_3907209_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_094488113.1|3907254_3908640_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.7	9.3e-47
>prophage 1
NZ_CP041093	Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence	250990	9137	23567	250990		Salmonella_phage(28.57%)	22	NA	NA
WP_065813311.1|9137_9458_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	1.3e-28
WP_004026416.1|9538_9853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197205.1|9973_10225_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026415.1|10390_10609_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_040209848.1|10701_11199_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.0e-23
WP_004197241.1|11195_11384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074423693.1|11861_12089_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.9e-10
WP_065813310.1|12085_12730_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
WP_065813309.1|12730_13054_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	2.0e-13
WP_024198083.1|13146_13533_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_065813313.1|15683_15878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197220.1|16179_16386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197207.1|16469_16742_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
WP_004883232.1|17022_17310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197199.1|17764_18289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197222.1|18352_19120_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	62.7	3.5e-43
WP_004197242.1|19375_19561_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	67.4	1.6e-10
WP_040222756.1|19570_20020_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	43.7	1.7e-18
WP_040222755.1|20089_20698_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	41.6	2.6e-25
WP_094339572.1|20985_21441_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_065813308.1|21412_21667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094089184.1|22325_23567_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	2.5e-11
>prophage 2
NZ_CP041093	Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence	250990	37868	79275	250990	transposase	uncultured_Caudovirales_phage(22.22%)	37	NA	NA
WP_143995106.1|37868_39050_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_000589001.1|39197_40538_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003030308.1|40958_42197_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.4	2.4e-09
WP_001515348.1|42672_43245_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_020277922.1|43444_44368_+	cation transporter	NA	NA	NA	NA	NA
WP_100280317.1|44411_44606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|44630_44870_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_094339436.1|44869_45088_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	72.1	2.2e-19
WP_139607415.1|45062_46231_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_004181898.1|46355_46514_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_071527912.1|47734_48091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181901.1|48288_48666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072196720.1|48846_49035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409777.1|48991_49288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181903.1|49355_50423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181904.1|50578_50926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181905.1|51004_51238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181906.1|51780_52137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181907.1|52190_52964_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	48.0	5.1e-10
WP_004181908.1|52966_54103_-	S49 family peptidase	NA	G0YPK2	Erwinia_phage	32.0	4.4e-10
WP_004181910.1|54111_54786_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_004181912.1|54798_55896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032438003.1|55898_58025_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_078207740.1|58014_60963_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_004196318.1|60976_61765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026319.1|61764_62229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528223.1|63168_63582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032438005.1|63774_64299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196331.1|64315_64858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196361.1|65223_66261_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_004181920.1|66304_67660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196345.1|67661_71630_+	traG-like region family protein	NA	NA	NA	NA	NA
WP_004181922.1|71680_71986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196338.1|72874_73231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012579081.1|75884_76808_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001617865.1|76887_77763_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_000608644.1|78012_79275_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 3
NZ_CP041093	Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence	250990	91563	139391	250990	protease,transposase,integrase	Caulobacter_phage(17.65%)	51	117140:117158	144549:144567
WP_001567368.1|91563_92967_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|92995_93628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094339518.1|93823_94117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181717.1|94214_94613_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004181718.1|95016_95835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032455404.1|95945_96440_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	34.2	6.1e-17
WP_004181719.1|96622_97894_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_004181720.1|98886_99489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065892222.1|99748_100480_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_016947102.1|100712_101471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181725.1|101536_101926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119906220.1|101953_102283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004210231.1|102510_103158_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_065892223.1|103494_104736_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	24.7	1.8e-09
WP_004026611.1|104820_105396_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_004026609.1|105482_106061_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|106099_107140_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|107163_107619_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_025368659.1|107641_108793_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_094339517.1|108789_109374_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	34.9	7.0e-12
WP_065813316.1|109684_110743_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_065813322.1|110754_111897_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	8.3e-33
WP_004181732.1|111889_112663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065813317.1|112664_113744_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	1.1e-39
WP_065813318.1|113743_114700_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_065813319.1|114710_115934_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_012540108.1|115936_116395_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
117140:117158	attL	CGGCTTTGTTGAATAAATC	NA	NA	NA	NA
WP_000480968.1|117346_118183_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|118182_118986_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000134999.1|119399_120041_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_029404405.1|121001_121538_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	85.2	4.9e-44
WP_139607425.1|121663_122248_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|122216_123230_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|123396_124239_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000050382.1|124334_124943_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|125000_125792_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|126053_127313_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|127405_128197_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|128366_128699_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_072078461.1|128838_129024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|129878_130670_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|131138_131384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|131421_132285_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_032492336.1|132430_133660_-	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_088172497.1|133960_134161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139607417.1|135110_135305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|135250_135955_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_094339573.1|136105_136921_+	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.9	3.3e-161
WP_001183556.1|137057_137459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|137498_138203_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_143995107.1|138311_139391_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
144549:144567	attR	GATTTATTCAACAAAGCCG	NA	NA	NA	NA
>prophage 4
NZ_CP041093	Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence	250990	226883	236736	250990	transposase	Escherichia_phage(25.0%)	15	NA	NA
WP_065813289.1|226883_227462_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	56.2	1.6e-40
WP_004181824.1|227452_227767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120493.1|227891_228302_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	60.8	4.6e-42
WP_065813290.1|228486_228846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026468.1|229076_229520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074423687.1|229561_229765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|229773_230034_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004196690.1|230066_230501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049130464.1|230497_231241_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.4e-60
WP_025368641.1|231367_232783_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	6.9e-106
WP_025368640.1|232872_234075_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	40.7	2.1e-34
WP_065813291.1|234652_234901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181829.1|234928_235246_+	DUF3846 domain-containing protein	NA	A0A2H4P7A4	Pseudomonas_phage	46.5	6.0e-10
WP_125482818.1|235366_235645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094487782.1|235812_236736_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	3.5e-175
>prophage 1
NZ_CP041095	Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed3, complete sequence	70501	49946	64153	70501	transposase,integrase	Escherichia_phage(28.57%)	17	47937:47952	55478:55493
47937:47952	attL	TTATTTCCCGCCTGGA	NA	NA	NA	NA
WP_086556681.1|49946_50624_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	8.7e-22
WP_032440556.1|50753_51239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440555.1|51323_51572_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	51.5	1.6e-10
WP_032440554.1|52356_53415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440553.1|53407_53617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015344981.1|53688_53973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440552.1|54112_54754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493286.1|54989_55319_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|55299_55581_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
55478:55493	attR	TTATTTCCCGCCTGGA	NA	NA	NA	NA
WP_077256884.1|55727_56303_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.3	1.6e-45
WP_012477564.1|56353_56944_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001067855.1|57496_58201_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001348195.1|58293_58668_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_089586275.1|58732_59380_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000427620.1|60814_61819_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_039026396.1|63020_63335_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039026397.1|63331_64153_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	28.7	3.5e-09
