The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019985	Alkalihalobacillus clausii strain DSM 8716 chromosome, complete genome	4517459	188244	197982	4517459		Synechococcus_phage(25.0%)	9	NA	NA
WP_094423539.1|188244_189780_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.0	6.9e-75
WP_035204825.1|189776_190361_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	4.2e-25
WP_094423540.1|190357_191395_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.6	6.1e-67
WP_094423541.1|191418_192831_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.2	1.9e-50
WP_094423542.1|192806_195032_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.3	5.7e-163
WP_094423543.1|195015_195699_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_011245883.1|195695_195947_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A1D7SRI3	Cyanophage	34.6	2.1e-05
WP_094423544.1|195939_196659_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	43.7	2.8e-47
WP_094423545.1|196683_197982_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.9	6.5e-18
>prophage 2
NZ_CP019985	Alkalihalobacillus clausii strain DSM 8716 chromosome, complete genome	4517459	294946	356837	4517459	integrase,holin,tail,transposase	Bacillus_phage(29.41%)	46	326206:326220	342899:342913
WP_063609918.1|294946_296218_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_094423626.1|296522_296927_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_094423627.1|297656_298505_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_094423628.1|298799_299204_-	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_094423629.1|299397_300333_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094423630.1|300409_301423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063608837.1|303871_304306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169715988.1|304426_306484_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	80.3	0.0e+00
WP_169715894.1|306434_308660_+	YtxH domain-containing protein	NA	A0A1S5SF30	Streptococcus_phage	56.7	2.6e-160
WP_169715989.1|308668_309679_+	bifunctional lysozyme/C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	68.2	2.2e-130
WP_094423632.1|309694_310582_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	48.0	1.2e-71
WP_017795862.1|310598_310766_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094423633.1|311089_311842_+	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	31.3	4.3e-06
WP_042532680.1|314219_314825_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094423634.1|314921_315635_+	GAP family protein	NA	NA	NA	NA	NA
WP_042532676.1|315659_315881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094423635.1|315984_317136_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_094423636.1|318026_318281_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063608852.1|320763_321873_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_063608853.1|321926_322601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063608854.1|322786_323383_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094429137.1|324066_324831_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.9	2.7e-40
WP_094429138.1|324830_326375_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
326206:326220	attL	TGATCTAGTTTTTTC	NA	NA	NA	NA
WP_094423637.1|328396_330322_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_018705605.1|330308_331076_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	4.0e-31
WP_018705604.1|331283_331955_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	9.8e-26
WP_077113179.1|331951_332977_+	sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	21.9	2.7e-06
WP_018709270.1|334236_334422_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_088053189.1|334460_335672_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	32.9	2.5e-43
WP_094423638.1|335728_337276_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.4	1.2e-21
WP_094423639.1|337477_339688_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_062750332.1|339677_340853_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_094429139.1|340852_341809_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_094423640.1|341937_342438_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_094423641.1|342611_343556_+	metallophosphoesterase	NA	NA	NA	NA	NA
342899:342913	attR	GAAAAAACTAGATCA	NA	NA	NA	NA
WP_062750335.1|343641_343848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062750336.1|344409_344646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169715895.1|344710_346711_-	penicillin-binding transpeptidase domain-containing protein	NA	NA	NA	NA	NA
WP_094423643.1|347145_347634_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	1.1e-18
WP_169715896.1|347812_348385_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_094423645.1|348470_349241_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	53.5	1.0e-55
WP_094423646.1|349530_349959_-|holin	phage holin family protein	holin	U5PVI4	Bacillus_phage	53.2	8.1e-26
WP_094423647.1|350056_350287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169715897.1|350288_354278_-|tail	phage tail protein	tail	Q5YA57	Bacillus_phage	34.7	3.5e-78
WP_157730324.1|354295_355015_-|tail	phage tail family protein	tail	Q2I8E9	Bacillus_phage	34.1	3.5e-05
WP_094423650.1|355031_356837_-	hypothetical protein	NA	W8EBC4	Geobacillus_phage	39.4	3.5e-17
>prophage 3
NZ_CP019985	Alkalihalobacillus clausii strain DSM 8716 chromosome, complete genome	4517459	3006069	3070424	4517459	coat,tRNA,protease,transposase	Moraxella_phage(22.22%)	60	NA	NA
WP_094426740.1|3006069_3007020_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	54.8	4.4e-88
WP_094426742.1|3007165_3008695_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_094426744.1|3008827_3010327_-	glycosyltransferase family 2 protein	NA	C1KFU0	Lactobacillus_virus	34.0	1.4e-67
WP_094426745.1|3010579_3010990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094426747.1|3011283_3012948_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_094426749.1|3013282_3015013_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	28.8	2.6e-62
WP_062749640.1|3015009_3015528_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_011247486.1|3015566_3016592_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_094426752.1|3016578_3018123_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_094426754.1|3018133_3019228_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_094426757.1|3019244_3020657_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_094426759.1|3020656_3021250_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_094426762.1|3021519_3022578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094426765.1|3022687_3023992_+	trigger factor	NA	NA	NA	NA	NA
WP_011247479.1|3024336_3025608_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.6	2.5e-147
WP_094426767.1|3025765_3027433_+|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	28.0	6.0e-24
WP_094426769.1|3027641_3029969_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.3	8.8e-183
WP_094426771.1|3029965_3030559_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_094426773.1|3030765_3032130_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_094426775.1|3032146_3032962_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_094426778.1|3032973_3033909_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_094426780.1|3033905_3034664_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_094426783.1|3034660_3035638_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_094426786.1|3035642_3036935_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_157730447.1|3037163_3038303_+	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_094426791.1|3038310_3039189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094426792.1|3039185_3040184_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_094426794.1|3040433_3041198_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_094426796.1|3041147_3041360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094426798.1|3041773_3044416_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.2	1.6e-156
WP_094426801.1|3044481_3045792_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_094426804.1|3045937_3046657_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_094426806.1|3046715_3047807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094426808.1|3047943_3049890_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_094426811.1|3050169_3050745_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_094426813.1|3050758_3051451_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_062749586.1|3051687_3052722_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_094426816.1|3052733_3053615_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_011247455.1|3053611_3054136_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_063608457.1|3054216_3054900_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_011247453.1|3054929_3055724_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_094426819.1|3055836_3056355_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011247451.1|3056399_3056846_-	molybdenum cofactor biosynthesis protein C	NA	NA	NA	NA	NA
WP_094426822.1|3057011_3057575_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_094426824.1|3057615_3058533_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_157730448.1|3058639_3059368_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_094426830.1|3059360_3060206_+	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_094426833.1|3060266_3061760_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_011247445.1|3061898_3062207_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_094426835.1|3062212_3062551_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_011247443.1|3062556_3062835_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011247442.1|3063060_3063351_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	52.7	1.5e-10
WP_094426837.1|3063420_3064566_+	amidohydrolase	NA	NA	NA	NA	NA
WP_157730449.1|3064724_3064883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094426839.1|3064875_3065520_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_094426842.1|3065573_3066695_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_094426843.1|3066858_3067557_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_094426845.1|3067616_3069092_+	amidase	NA	NA	NA	NA	NA
WP_094426848.1|3069213_3069690_+	DinB family protein	NA	NA	NA	NA	NA
WP_094423643.1|3069935_3070424_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	1.1e-18
>prophage 4
NZ_CP019985	Alkalihalobacillus clausii strain DSM 8716 chromosome, complete genome	4517459	3206601	3249473	4517459	terminase,holin,protease,portal,capsid,head,integrase,tail	Bacillus_phage(52.94%)	56	3206437:3206482	3249593:3249638
3206437:3206482	attL	AGATTCCGGTTCTCGCGTTGTGGGTTCGAATCCTGCTAGGCGCGTC	NA	NA	NA	NA
WP_094427099.1|3206601_3207561_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	36.2	1.4e-49
WP_169715953.1|3207772_3207910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427102.1|3208008_3208752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427104.1|3208802_3209066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169715954.1|3209046_3209448_+	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	52.3	1.6e-31
WP_011246179.1|3209882_3210359_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	39.7	5.5e-23
WP_094427107.1|3210355_3212050_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	53.9	1.3e-172
WP_094427109.1|3212059_3212260_+	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	68.5	4.5e-11
WP_094427112.1|3212265_3213555_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.0	2.9e-151
WP_094427114.1|3213511_3214144_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	67.8	2.9e-72
WP_094427116.1|3214184_3215432_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	46.3	1.2e-88
WP_157730463.1|3215516_3216002_+	Ig-like domain-containing protein	NA	A0A0S2MY17	Enterococcus_phage	37.1	4.2e-10
WP_094427120.1|3215994_3216291_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J6E5	uncultured_Caudovirales_phage	44.2	3.7e-09
WP_169715955.1|3216268_3216622_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_094427123.1|3216626_3217031_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_094427125.1|3217027_3217387_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_157730465.1|3217399_3218011_+	hypothetical protein	NA	A0A0S2SXT6	Bacillus_phage	34.2	1.6e-22
WP_094427131.1|3218151_3218502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427134.1|3218516_3218747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427136.1|3218764_3223447_+|tail	phage tail tape measure protein	tail	A0A0C5AJ16	Paenibacillus_phage	47.5	6.7e-97
WP_157730466.1|3223448_3224288_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	34.4	1.0e-32
WP_094427141.1|3224311_3226963_+	peptidase G2	NA	D6R401	Bacillus_phage	36.6	1.4e-139
WP_094427143.1|3229259_3229634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427145.1|3229626_3229797_+	XkdX family protein	NA	A0A142F1G4	Bacillus_phage	68.0	9.1e-13
WP_094427147.1|3229860_3230499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427149.1|3230502_3231894_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_094427151.1|3231930_3232341_+|holin	phage holin family protein	holin	D6R405	Bacillus_phage	52.7	1.1e-30
WP_094427153.1|3232343_3233231_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7RTQ5	Clostridium_phage	37.9	4.2e-24
WP_094427156.1|3233266_3233695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157730467.1|3234046_3234880_-	hypothetical protein	NA	O64130	Bacillus_phage	48.4	4.6e-65
WP_094429270.1|3234936_3235299_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_094427160.1|3235420_3235615_-	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	62.7	2.4e-09
WP_094427161.1|3236011_3236788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041823719.1|3236937_3237390_-	ImmA/IrrE family metallo-endopeptidase	NA	R9TQI1	Paenibacillus_phage	54.2	3.4e-38
WP_041823722.1|3237389_3237725_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	41.9	1.0e-15
WP_094427162.1|3237989_3238163_+	helix-turn-helix domain-containing protein	NA	A0A0M3ULF9	Bacillus_phage	71.9	7.6e-15
WP_094427164.1|3238216_3238486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427166.1|3238448_3238766_-	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	49.0	4.8e-15
WP_094427169.1|3238828_3239611_+	phage antirepressor KilAC domain-containing protein	NA	A8ATN0	Listeria_phage	44.9	4.2e-52
WP_094427172.1|3239745_3240060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427174.1|3240060_3240246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169715956.1|3240250_3240403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427176.1|3240479_3241028_+	host-nuclease inhibitor Gam family protein	NA	Q9ZXC8	Bacillus_phage	53.3	1.1e-46
WP_094427177.1|3241037_3241991_+	AAA family ATPase	NA	A0A0S2SY47	Bacillus_phage	58.5	2.1e-98
WP_094427179.1|3242006_3242444_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	53.8	2.0e-40
WP_094427181.1|3242501_3244856_+	DNA primase	NA	A0A0S2SXQ4	Bacillus_phage	58.6	1.5e-267
WP_094427183.1|3245099_3245534_+	hypothetical protein	NA	A0A0S2SXU2	Bacillus_phage	38.1	7.5e-19
WP_094427186.1|3245537_3246068_+	ERCC4 domain-containing protein	NA	A0A0S2SXQ1	Bacillus_phage	68.0	9.3e-64
WP_094427189.1|3246064_3246337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427191.1|3246339_3246690_+	DUF3310 domain-containing protein	NA	A0A223LJ95	Bacillus_phage	53.6	3.9e-10
WP_094429271.1|3246868_3247285_+	methyltransferase domain-containing protein	NA	A0A059T693	Listeria_phage	70.5	5.1e-57
WP_094427193.1|3247316_3247676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427195.1|3247831_3248149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427197.1|3248212_3248797_+	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	49.7	1.6e-40
WP_094427199.1|3248799_3249000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094427202.1|3249017_3249473_+	transcriptional regulator	NA	A0A0S2SXN1	Bacillus_phage	46.0	1.9e-28
3249593:3249638	attR	AGATTCCGGTTCTCGCGTTGTGGGTTCGAATCCTGCTAGGCGCGTC	NA	NA	NA	NA
