The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449904	446276	479534	5449904	tRNA,capsid,head,terminase,integrase,portal,tail,protease	uncultured_Caudovirales_phage(73.33%)	33	463884:463901	479879:479896
WP_002919147.1|446276_447224_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|447238_447748_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|447876_449001_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|448972_449446_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|449471_450014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|450018_450591_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|450594_451413_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|451409_451667_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|451642_452197_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|457992_458214_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|458507_461618_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|461630_462770_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|463148_463799_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
463884:463901	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|464074_465301_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|465393_466335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|466516_466801_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|466811_467591_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|468042_468312_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|468304_468493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|468485_468800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|468796_469165_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|469161_469527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|469526_471662_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|472004_472340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|472388_472901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|473164_474331_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|474382_474943_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|474944_476186_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|476182_476518_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|476514_476814_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|476813_477257_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|477532_477889_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|477872_479534_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
479879:479896	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449904	1350572	1398341	5449904	holin,capsid,terminase,integrase,tail	Salmonella_phage(41.67%)	58	1353136:1353150	1365603:1365617
WP_004151980.1|1350572_1352039_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1352106_1353684_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1353136:1353150	attL	TCTGCCGCTTCCGCC	NA	NA	NA	NA
WP_004243821.1|1353875_1355126_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	1.8e-206
WP_004243823.1|1355142_1355334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243826.1|1355330_1355924_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	2.1e-109
WP_004243831.1|1355920_1356670_-	hypothetical protein	NA	R9VWB9	Serratia_phage	56.1	3.1e-73
WP_004243833.1|1356666_1356825_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.4	2.5e-17
WP_004243834.1|1356817_1357111_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	1.2e-31
WP_004144294.1|1357220_1357469_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_004243835.1|1357517_1358399_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.3	1.7e-131
WP_004243836.1|1358395_1359217_-	exonuclease VIII/RecE-like protein	NA	A0A193GYK2	Enterobacter_phage	80.2	8.1e-131
WP_004243838.1|1359213_1359513_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	53.5	1.8e-19
WP_042651015.1|1359520_1360423_-	hypothetical protein	NA	A0A059VK18	Pseudomonas_phage	51.6	2.8e-36
WP_004152539.1|1360835_1361417_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|1361570_1361804_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1361950_1362160_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1362159_1362927_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152535.1|1362923_1363709_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|1363828_1364176_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|1364368_1364779_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|1364762_1364954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|1364950_1365376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|1365372_1366116_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
1365603:1365617	attR	GGCGGAAGCGGCAGA	NA	NA	NA	NA
WP_004141386.1|1366286_1366499_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|1366495_1367164_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|1367156_1367396_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|1367395_1367734_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|1367808_1368066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|1368143_1368728_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_020314691.1|1368724_1370200_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.7	3.2e-279
WP_004152473.1|1370243_1370765_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004152472.1|1371470_1371674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|1371677_1373357_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|1373353_1373659_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|1373940_1374339_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004152467.1|1374351_1375359_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_004152466.1|1375368_1375761_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|1375753_1376032_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004153043.1|1376080_1376692_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152463.1|1376691_1379169_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004243848.1|1379170_1379641_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.9	5.0e-45
WP_004243851.1|1379633_1380131_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	7.5e-23
WP_004243852.1|1380143_1382888_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	1.2e-93
WP_004243853.1|1382887_1386277_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152458.1|1386286_1386901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|1387175_1387574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152456.1|1387578_1387761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|1387951_1388647_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_157833602.1|1388730_1388919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152454.1|1389027_1389225_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152453.1|1389228_1389486_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004152765.1|1389914_1391399_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002913857.1|1391934_1394196_+|tail	tail fiber protein	tail	A0A0A8J9V7	Klebsiella_phage	35.8	3.7e-69
WP_004146394.1|1394458_1394863_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_002913854.1|1394849_1395155_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	1.6e-39
WP_002913853.1|1395144_1395774_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_002913851.1|1395770_1396253_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	2.8e-59
WP_004152009.1|1396472_1398341_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 3
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449904	1727065	1733972	5449904	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1727065_1727929_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1727939_1728713_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_002912636.1|1728955_1729849_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1730094_1731456_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1731774_1732497_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1732493_1733972_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 4
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449904	2076062	2132547	5449904	plate,protease,transposase	Staphylococcus_phage(16.67%)	52	NA	NA
WP_002910830.1|2076062_2076809_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_004199384.1|2077220_2078234_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|2078226_2079027_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2079013_2079187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2079804_2080746_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2080839_2081829_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2081854_2083186_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|2083213_2084422_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|2084450_2086745_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004219578.1|2087175_2088291_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2088400_2089315_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2089324_2090602_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2090598_2091474_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|2091470_2092190_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2092195_2093089_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2093372_2095016_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2095065_2095542_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2095640_2096567_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2096870_2098166_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004152314.1|2098180_2098987_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152315.1|2098961_2099861_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2099970_2100453_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2100643_2101342_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|2101367_2101952_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2102021_2102351_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910647.1|2102437_2102683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910645.1|2102919_2104260_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2104256_2104910_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2104913_2106611_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2109574_2110930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|2110930_2111440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2111436_2111943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2112179_2112689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153456.1|2114339_2115263_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
WP_004199326.1|2115404_2115587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2115583_2115913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2115909_2116416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|2116461_2116692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004158974.1|2116797_2117883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|2117929_2118235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2118256_2119150_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004152633.1|2119333_2120227_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910539.1|2120402_2121296_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2121471_2122362_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2122698_2123679_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_029779706.1|2123802_2124039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227463.1|2124227_2124485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2124782_2125049_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2125052_2126210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2126193_2129604_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2129737_2131501_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002910494.1|2131500_2132547_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 5
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449904	2796206	2807081	5449904		Escherichia_phage(85.71%)	8	NA	NA
WP_004151613.1|2796206_2799314_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2799368_2800634_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2800664_2801753_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2801839_2802100_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2802397_2803258_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2803278_2804040_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2804301_2805204_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210516.1|2806460_2807081_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449904	3034577	3074349	5449904	terminase,transposase,integrase	uncultured_Caudovirales_phage(35.42%)	57	3065462:3065476	3071471:3071485
WP_004152576.1|3034577_3035444_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3035443_3036217_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3036213_3037410_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3037409_3037763_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3037764_3038418_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3038471_3039038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|3039080_3039263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3039312_3039654_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3039653_3040676_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3040678_3040981_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3040981_3041581_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3041580_3043584_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3043573_3043726_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3043761_3044187_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|3044513_3045705_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|3045646_3045937_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|3045947_3047093_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3047096_3047537_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3047631_3048018_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3048017_3048524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3048520_3048940_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3048908_3049190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3049229_3050171_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3050182_3050677_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3050680_3051883_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3051934_3052483_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3052538_3053990_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3054227_3055628_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3055578_3056331_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3056432_3056753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3056987_3057377_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3057373_3057904_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3057906_3058155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3058560_3059343_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3059339_3059816_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3059812_3060775_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3060776_3062435_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3063011_3063233_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3063330_3063999_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3064169_3064484_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3064476_3064665_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3064834_3065200_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3065192_3065447_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3065418_3065637_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3065462:3065476	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3065633_3066059_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3066055_3066250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3066246_3067074_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3067178_3067697_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3067702_3068413_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3068402_3068627_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3068623_3068836_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3068832_3069312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3069490_3069733_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3069713_3070895_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3071091_3071640_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3071471:3071485	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3071838_3073371_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3073587_3074349_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 7
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449904	3107282	3167399	5449904	holin,transposase,terminase,integrase,tail	Enterobacteria_phage(20.0%)	70	3107064:3107079	3164705:3164720
3107064:3107079	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3107282_3107954_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3108140_3108968_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3109043_3110309_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3110310_3110730_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3110809_3112294_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|3113191_3113614_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3114206_3114911_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152703.1|3115159_3117103_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|3117344_3117944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|3118168_3118900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644627.1|3118903_3121858_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152652.1|3121934_3125003_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|3124999_3125380_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|3125389_3125872_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|3126052_3126517_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152648.1|3126831_3127167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3127357_3128338_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004217331.1|3128450_3131348_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|3131609_3131801_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|3132025_3132382_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|3132458_3132665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|3132802_3133285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|3133338_3134511_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|3134534_3134927_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|3134923_3135475_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|3135476_3135860_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|3135846_3136080_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|3136089_3136344_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|3136345_3136741_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_142689607.1|3136781_3137054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190653.1|3137062_3138016_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|3138026_3138812_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_019405022.1|3139342_3140455_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|3140438_3141839_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|3141838_3143146_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|3143123_3144128_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|3144990_3145236_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|3146194_3146470_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|3146466_3146811_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|3146807_3147347_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3147343_3147643_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|3148121_3149168_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3149393_3150083_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3150082_3150223_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3150219_3150858_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3150850_3151519_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3151515_3151683_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3151663_3152131_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3152651_3153680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3153887_3154133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3154188_3154491_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3154487_3155336_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3155332_3156193_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3156278_3156500_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3156540_3156768_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3156879_3157578_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3157600_3157720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3157865_3158942_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3159023_3159227_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3159655_3159850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3159938_3160223_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3160238_3161084_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3161080_3161368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3161369_3162050_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3162046_3162475_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3162471_3163134_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|3163341_3164529_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3164705_3165596_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3164705:3164720	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3165595_3166588_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3166589_3167399_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 8
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449904	3543693	3637844	5449904	tRNA,plate,transposase,capsid,head,terminase,lysis,integrase,portal,tail,protease	Salmonella_phage(55.93%)	93	3599219:3599237	3637919:3637937
WP_002898139.1|3543693_3544986_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3545076_3546420_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3546428_3547040_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3547162_3551416_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3551551_3552046_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3552551_3553547_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3553661_3555428_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3555428_3557150_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3557194_3557896_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3558249_3558468_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3558588_3560868_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3560898_3561216_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3561541_3561763_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3561839_3563780_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3563776_3564892_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3565038_3566697_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3567116_3567812_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3567927_3568827_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3568970_3570623_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3570633_3571602_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3571813_3572248_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3572399_3574118_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3574156_3575158_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3575168_3576611_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3576698_3577712_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3577708_3578539_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3578570_3579710_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3580587_3581103_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3581329_3582058_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3582078_3582810_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3582816_3583533_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3583532_3584201_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3584384_3585116_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3585158_3586631_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3586627_3587344_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3587422_3588550_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3588591_3589080_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3589137_3589983_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3589979_3590933_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3590943_3592077_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3592240_3593353_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3593701_3594181_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3594269_3595172_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3595993_3596281_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3596483_3596747_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3596753_3597137_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3597403_3599089_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3599219:3599237	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3599308_3599527_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3599618_3600719_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3600715_3601201_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3601197_3603825_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3603817_3603937_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3603951_3604251_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3604303_3604819_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3604828_3606001_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3606139_3607216_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3607245_3607449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3607445_3608177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3608180_3611132_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3611133_3611733_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3611725_3612634_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3612620_3612983_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3612979_3613552_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_000019473.1|3614116_3615097_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002896175.1|3615535_3615982_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3615974_3616406_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3616501_3616930_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3616926_3617310_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3617314_3617824_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3617804_3618020_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3618023_3618227_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3618226_3618691_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3618786_3619437_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3619440_3620499_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3620515_3621349_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3621491_3623258_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3623257_3624283_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3624344_3626087_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3626362_3627040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3627154_3627388_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3627398_3627587_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3627740_3630155_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3630151_3631009_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3631005_3631233_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3631232_3631466_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3631533_3631875_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3631838_3632039_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3632046_3632556_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3632588_3632810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3632955_3633834_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3633845_3634790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3634888_3636373_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|3636791_3637844_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3637919:3637937	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 9
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449904	4082954	4128229	5449904	head,integrase,lysis,tRNA	Escherichia_phage(26.42%)	63	4076167:4076213	4125301:4125347
4076167:4076213	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|4082954_4085432_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|4085418_4085814_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|4085810_4086281_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004165520.1|4086280_4086700_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004151253.1|4086799_4090246_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|4090338_4090842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|4090969_4091755_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|4091820_4092534_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|4092523_4092694_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|4092793_4093153_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|4093169_4093640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|4093933_4094188_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|4094190_4094946_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|4095121_4095799_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|4095851_4096604_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|4096672_4097065_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|4097061_4097487_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|4097489_4097852_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|4097851_4098025_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|4098024_4098405_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|4098407_4098647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|4098657_4099752_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|4099763_4100192_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|4100195_4101581_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|4101653_4102130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|4102171_4103176_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|4103150_4104572_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|4104584_4106057_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|4106056_4106659_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|4107029_4107359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|4107464_4107929_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|4107925_4108456_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|4108458_4108707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151283.1|4109616_4110306_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|4110302_4110833_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|4110825_4110963_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|4110959_4111595_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|4111587_4111758_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4111757_4112213_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|4112713_4113361_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|4113533_4114376_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|4114482_4114989_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|4114985_4115279_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151296.1|4115278_4116709_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151297.1|4116698_4117598_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_001548453.1|4117822_4118044_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|4118084_4118318_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|4118445_4119135_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4119485_4119701_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151303.1|4119800_4119995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4120083_4120368_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|4120383_4121229_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|4121225_4121906_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4121902_4122061_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4122057_4122714_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4122710_4123478_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4123474_4123693_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4123694_4123910_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4123911_4124247_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151318.1|4124123_4125287_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|4125717_4126584_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4125301:4125347	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4126585_4126798_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4126843_4128229_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 10
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449904	4337766	4349420	5449904	integrase	Enterobacteria_phage(70.0%)	13	4338216:4338230	4361273:4361287
WP_004144574.1|4337766_4338870_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4338216:4338230	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4338880_4340134_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4340486_4341677_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4341664_4342615_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4342614_4343040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4343608_4344175_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4344192_4344438_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4344434_4345172_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4345713_4345980_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4345976_4346534_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4346530_4346758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4346754_4347075_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4347086_4349420_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4361273:4361287	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 1
NZ_CP022692	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence	207351	1727	130776	207351	transposase,integrase,protease	Escherichia_phage(20.45%)	116	78579:78594	138796:138811
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032418015.1|4961_5885_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	1.6e-175
WP_004197688.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|7416_8871_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11193_13191_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17548_19024_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19016_19697_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19886_21272_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21300_21654_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21767_23060_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23070_26217_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26870_29318_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29589_30327_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
WP_004152083.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33115_34012_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34051_34432_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34436_35366_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35420_36101_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36097_37498_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37714_38149_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38380_38560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40302_40812_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40861_41359_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41690_42017_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|42016_42727_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42735_43281_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43356_43719_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|45615_46152_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46184_46610_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46622_47912_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|47959_49711_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49728_50091_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50140_50491_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50848_51118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51105_51681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51711_52206_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52249_52618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52651_52855_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52903_53161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53236_53491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53666_53933_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53920_54403_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|54614_55961_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|57803_58766_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|58752_59502_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|59739_59937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|59936_62732_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|62846_63416_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|63450_63732_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|63975_64239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|64253_64517_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|65718_66699_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|67907_68777_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|68770_69781_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|69789_70617_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|70625_71489_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|71485_72313_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|73168_73873_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044117068.1|75176_75845_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000018329.1|76034_76850_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|77000_77705_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|77826_78732_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
78579:78594	attL	TGAAGCGGCCGGTGGC	NA	NA	NA	NA
WP_000004159.1|78728_79967_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|79966_80551_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|81043_81808_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|82034_82340_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|82350_83556_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|83711_83915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|84042_84882_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|84875_85223_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|85386_86178_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|86183_86474_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|86585_87083_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|87227_88241_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|88443_88794_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|88919_89480_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_040179220.1|89482_92449_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000656305.1|92515_92893_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|93093_93753_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_016197752.1|94730_94961_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_004118216.1|94960_96349_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_000005560.1|96341_97454_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118217.1|97450_98086_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_004114613.1|98642_99020_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
WP_004152557.1|99016_99364_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_000019473.1|102811_103792_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118832.1|104386_106120_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|106127_107075_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|107119_108724_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|108736_109657_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152279.1|109656_110505_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|110501_111095_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|111091_112219_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|112503_112671_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118235.1|113773_114295_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004118237.1|114291_115245_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004152280.1|115330_117655_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118241.1|117699_118602_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|118598_119597_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004152281.1|119593_120550_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|120550_121318_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|121416_121710_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071527925.1|122040_122283_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152284.1|122661_123672_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004152286.1|124132_125215_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152287.1|125336_128411_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|128462_129716_+	lactose permease	NA	NA	NA	NA	NA
WP_048270450.1|129852_130776_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	1.6e-175
138796:138811	attR	TGAAGCGGCCGGTGGC	NA	NA	NA	NA
>prophage 1
NZ_CP022693	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence	113222	11258	45142	113222	transposase,integrase	Escherichia_phage(25.0%)	31	NA	NA
WP_004152342.1|11258_12527_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152341.1|12646_13120_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011977773.1|13211_13442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|14333_15116_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|15115_15448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|15454_15811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|15878_16208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|16235_16544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|16589_16796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|17448_17679_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|17675_18092_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004152334.1|18165_18876_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072093211.1|19607_19733_+	mercury transporter	NA	NA	NA	NA	NA
WP_001340589.1|19768_20191_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|20242_21937_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|21954_22317_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|22313_22550_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|22546_23254_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|23292_24597_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000027057.1|25164_26025_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|27768_28473_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152403.1|28545_31443_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_004152402.1|31531_32152_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152400.1|33317_33677_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152398.1|34180_35365_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|35641_36961_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|37210_38092_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|38379_39159_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|39155_40181_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|40287_43317_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|43426_45142_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
>prophage 1
NZ_CP022694	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_03, complete sequence	43380	30847	41145	43380	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_004199413.1|30847_33865_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_002903955.1|35073_35976_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|36237_36999_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|37019_37880_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|38016_38721_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549892.1|39113_39353_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001549893.1|39439_40102_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|40482_41145_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
