The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449899	446325	515700	5449899	terminase,capsid,integrase,tRNA,head,portal,protease,tail	uncultured_Caudovirales_phage(61.11%)	75	463930:463947	479925:479942
WP_002919147.1|446325_447273_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|447287_447797_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|447925_449050_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|449021_449495_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|449520_450063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|450067_450640_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|450643_451462_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|451458_451716_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|451691_452246_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|458038_458260_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|458553_461664_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|461676_462816_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
WP_004150972.1|463194_463845_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
463930:463947	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|464120_465347_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|465439_466381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|466562_466847_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004150969.1|466857_467637_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|467760_467955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150968.1|468178_468358_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
WP_001549752.1|468350_468539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|468531_468846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|468842_469211_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|469207_469573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|469572_471708_+	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|472050_472386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|472434_472947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|473210_474377_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|474428_474989_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|474990_476232_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|476228_476564_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|476560_476860_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|476859_477303_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004198610.1|477429_477621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113647.1|477578_477935_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|477918_479580_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_004150954.1|479582_479774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462905.1|479927_480224_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
479925:479942	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004144972.1|480248_481214_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_071526683.1|481371_481566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918745.1|481571_482453_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_002918742.1|482464_483916_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
WP_002918740.1|483905_484148_-	membrane protein	NA	NA	NA	NA	NA
WP_002918738.1|484258_485608_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918736.1|485618_486086_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918732.1|486108_486561_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918689.1|486784_487393_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918688.1|487392_488394_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918687.1|488622_488814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918686.1|488893_490834_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_004149975.1|490955_491162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918653.1|491139_492183_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_004149974.1|492253_493246_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918648.1|493245_493734_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002918646.1|493741_494323_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918644.1|494325_495795_+	ribonuclease G	NA	NA	NA	NA	NA
WP_004150952.1|495832_499630_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918642.1|499718_501164_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002918641.1|501199_502129_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002918640.1|502260_502464_+	protein AaeX	NA	NA	NA	NA	NA
WP_002918639.1|502471_503404_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918632.1|503409_505377_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918629.1|505456_505732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918627.1|505782_506049_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002918626.1|506147_506411_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002918625.1|506786_507257_-	arginine repressor	NA	NA	NA	NA	NA
WP_002918570.1|507671_508610_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918568.1|508746_509805_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
WP_002918566.1|509892_511260_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918565.1|511433_511832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004144945.1|512022_513150_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918559.1|513415_513844_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|513859_514252_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_004188421.1|514361_514565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918467.1|514563_515202_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002918465.1|515205_515700_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449899	1350617	1416968	5449899	terminase,holin,capsid,transposase,tail	Salmonella_phage(36.36%)	77	NA	NA
WP_004151980.1|1350617_1352084_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1352151_1353729_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
WP_004243821.1|1353920_1355171_+	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	85.1	1.8e-206
WP_004243823.1|1355187_1355379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243826.1|1355375_1355969_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	2.1e-109
WP_004243831.1|1355965_1356715_-	hypothetical protein	NA	R9VWB9	Serratia_phage	56.1	3.1e-73
WP_004243833.1|1356711_1356870_-	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	80.4	2.5e-17
WP_004243834.1|1356862_1357156_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	1.2e-31
WP_004144294.1|1357265_1357514_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_004243835.1|1357562_1358444_-	DNA recombination protein RecT	NA	T1SBJ5	Salmonella_phage	82.3	1.7e-131
WP_004243836.1|1358440_1359262_-	exonuclease VIII/RecE-like protein	NA	A0A193GYK2	Enterobacter_phage	80.2	8.1e-131
WP_004243838.1|1359258_1359558_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	53.5	1.8e-19
WP_042651015.1|1359565_1360468_-	hypothetical protein	NA	A0A059VK18	Pseudomonas_phage	51.6	2.8e-36
WP_004152539.1|1360880_1361462_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|1361615_1361849_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1361995_1362205_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1362204_1362972_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152535.1|1362968_1363754_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|1363873_1364221_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|1364413_1364824_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|1364807_1364999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|1364995_1365421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|1365417_1366161_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004141386.1|1366331_1366544_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|1366540_1367209_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|1367201_1367441_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|1367440_1367779_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|1367853_1368111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|1368188_1368773_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_020314691.1|1368769_1370245_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.7	3.2e-279
WP_004152473.1|1370288_1370810_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004225268.1|1371305_1371494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152472.1|1371515_1371719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|1371722_1373402_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|1373398_1373704_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152469.1|1373746_1373944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152468.1|1373985_1374384_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004152467.1|1374396_1375404_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_004152466.1|1375413_1375806_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|1375798_1376077_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004153043.1|1376125_1376737_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152463.1|1376736_1379214_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004243848.1|1379215_1379686_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.9	5.0e-45
WP_004243851.1|1379678_1380176_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	7.5e-23
WP_004243852.1|1380188_1382933_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	1.2e-93
WP_004243853.1|1382932_1386322_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152458.1|1386331_1386946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004221292.1|1386978_1387131_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	85.7	1.9e-14
WP_004152457.1|1387220_1387619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152456.1|1387623_1387806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|1387996_1388692_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_004152454.1|1389072_1389270_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152453.1|1389273_1389531_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004243906.1|1389621_1389882_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	65.1	7.1e-25
WP_004152765.1|1389959_1391444_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|1391443_1391695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913857.1|1391979_1394241_+|tail	tail fiber protein	tail	A0A0A8J9V7	Klebsiella_phage	35.8	3.7e-69
WP_004146394.1|1394503_1394908_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_002913854.1|1394894_1395200_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	1.6e-39
WP_002913853.1|1395189_1395819_+	glycoside hydrolase	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_002913851.1|1395815_1396298_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	2.8e-59
WP_004152009.1|1396517_1398386_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004162150.1|1398369_1399548_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_002913847.1|1399841_1401074_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913846.1|1401171_1402059_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913843.1|1402155_1402347_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
WP_002913841.1|1402699_1404928_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913839.1|1404981_1406514_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913838.1|1406517_1408578_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004152007.1|1408758_1409400_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913836.1|1409396_1410434_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_002913833.1|1410697_1411591_+	beta-glucoside kinase	NA	NA	NA	NA	NA
WP_002913829.1|1411600_1413034_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913827.1|1413251_1413878_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913824.1|1413973_1415260_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|1415358_1416060_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913812.1|1416056_1416968_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
>prophage 3
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449899	1727110	1734017	5449899		Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1727110_1727974_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1727984_1728758_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_002912636.1|1729000_1729894_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1730139_1731501_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1731819_1732542_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1732538_1734017_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 4
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449899	2102964	2133555	5449899	transposase,plate	Microcystis_virus(33.33%)	31	NA	NA
WP_002910645.1|2102964_2104305_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2104301_2104955_+	type VI secretion system protein ImpK	NA	NA	NA	NA	NA
WP_004152317.1|2104958_2106656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004221091.1|2107114_2108308_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_020320395.1|2108273_2109596_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004152319.1|2109619_2110975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|2110975_2111485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2111481_2111988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2112224_2112734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152320.1|2113027_2114308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|2114339_2115308_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|2115449_2115632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2115628_2115958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2115954_2116461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|2116506_2116737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|2117974_2118280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2118301_2119195_+	sulfatase-modifying factor 1	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004152633.1|2119378_2120272_+	sulfatase-modifying factor 1	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910539.1|2120447_2121341_+	sulfatase-modifying factor 1	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2121516_2122407_+	sulfatase-modifying factor 1	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2122743_2123724_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_071531187.1|2123762_2123885_-	ABC transporter	NA	NA	NA	NA	NA
WP_029779706.1|2123847_2124084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227463.1|2124272_2124530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2124827_2125094_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2125097_2126255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2126238_2129649_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2129782_2131546_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002910494.1|2131545_2132592_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910493.1|2132572_2133109_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152261.1|2133111_2133555_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449899	2796251	2807138	5449899		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2796251_2799359_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2799413_2800679_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2800709_2801798_-	hypothetical protein	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2801884_2802145_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2802442_2803303_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2803323_2804085_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2804345_2805248_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2805259_2806525_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2806517_2807138_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449899	3034633	3074404	5449899	terminase,protease,transposase	uncultured_Caudovirales_phage(35.42%)	57	NA	NA
WP_004152576.1|3034633_3035500_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3035499_3036273_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3036269_3037466_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3037465_3037819_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3037820_3038474_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3038527_3039094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3039130_3039316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3039368_3039710_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3039709_3040732_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3040734_3041037_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3041037_3041637_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3041636_3043640_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3043629_3043782_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3043817_3044243_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|3044569_3045761_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|3045702_3045993_-	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|3046003_3047149_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3047152_3047593_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3047687_3048074_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3048073_3048580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3048576_3048996_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3048964_3049246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3049285_3050227_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3050238_3050733_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3050736_3051939_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3051990_3052539_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3052594_3054046_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3054283_3055684_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3055634_3056387_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3056488_3056809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3057043_3057433_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3057429_3057960_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3057962_3058211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3058616_3059399_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3059395_3059872_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3059868_3060831_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3060832_3062491_-	helicase conserved C-terminal domain protein	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152163.1|3062798_3063092_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
WP_004152162.1|3063066_3063288_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3063385_3064054_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3064224_3064539_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3064531_3064720_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3064889_3065255_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3065247_3065502_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152156.1|3065688_3066114_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3066110_3066305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3066301_3067129_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3067233_3067752_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3067757_3068468_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3068457_3068682_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3068678_3068891_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3068887_3069367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3069545_3069788_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3069768_3070950_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3071146_3071695_+|protease	protease PfpI family	protease	NA	NA	NA	NA
WP_004152145.1|3071893_3073426_-	phosphohydrolase	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3073642_3074404_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 7
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449899	3107337	3167453	5449899	terminase,holin,integrase,transposase,tail	Klebsiella_phage(24.56%)	73	3107119:3107134	3164759:3164774
3107119:3107134	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3107337_3108009_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3108195_3109023_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3109098_3110364_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3110365_3110785_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3110864_3112349_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3112348_3112600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152776.1|3113246_3113669_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_004166391.1|3113746_3114196_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	98.0	1.4e-73
WP_001067855.1|3114261_3114966_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004153425.1|3115012_3115123_-	DNA invertase	NA	A0A286S1P7	Klebsiella_phage	100.0	4.6e-10
WP_004152703.1|3115214_3117158_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|3117399_3117999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152701.1|3118032_3118227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|3118223_3118955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644627.1|3118958_3121913_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152652.1|3121989_3125058_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|3125054_3125435_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|3125444_3125927_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|3126107_3126572_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152648.1|3126886_3127222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3127412_3128393_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004217331.1|3128505_3131403_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_004217333.1|3132080_3132437_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_004217335.1|3132513_3132690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|3132857_3133340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|3133393_3134566_-	hypothetical protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|3134589_3134982_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|3134978_3135530_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|3135531_3135915_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|3135901_3136135_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|3136144_3136399_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|3136400_3136796_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004190653.1|3137117_3138071_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|3138081_3138867_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_019405022.1|3139397_3140510_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|3140493_3141894_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|3141893_3143201_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|3143178_3144183_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004244013.1|3144731_3144917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218558.1|3145045_3145291_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_019405025.1|3146104_3146299_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
WP_004190672.1|3146249_3146525_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|3146521_3146866_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|3146862_3147402_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004218567.1|3147398_3147710_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
WP_004232548.1|3149447_3150137_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3150136_3150277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218533.1|3150273_3150912_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3150904_3151573_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3151569_3151737_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3151717_3152185_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3152705_3153734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3153941_3154187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3154242_3154545_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3154541_3155390_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3155386_3156247_-	phage replication protein O	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3156332_3156554_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3156594_3156822_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3156933_3157632_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3157654_3157774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3157919_3158996_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3159077_3159281_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3159709_3159904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3159992_3160277_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3160292_3161138_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201102.1|3161423_3162104_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3162100_3162529_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3162525_3163188_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004190725.1|3163184_3163499_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_004153574.1|3163395_3164583_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3164759_3165650_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3164759:3164774	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3165649_3166642_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3166643_3167453_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 8
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449899	3543746	3637897	5449899	capsid,plate,integrase,tRNA,head,transposase,portal,protease,tail	Salmonella_phage(55.93%)	99	3599272:3599290	3637972:3637990
WP_002898139.1|3543746_3545039_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3545129_3546473_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3546481_3547093_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_004150846.1|3547215_3551469_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3551604_3552099_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
WP_002898019.1|3552631_3553600_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3553714_3555481_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3555481_3557203_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3557247_3557949_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3558302_3558521_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3558641_3560921_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3560951_3561269_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3561594_3561816_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_071528213.1|3561770_3561953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150848.1|3561892_3563833_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3563829_3564945_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3565091_3566750_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3567169_3567865_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3567980_3568880_+	membrane protein	NA	NA	NA	NA	NA
WP_002896412.1|3569023_3570676_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3570686_3571655_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_085666582.1|3571605_3571809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896408.1|3571866_3572301_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3572452_3574171_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3574209_3575211_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3575221_3576664_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_002896399.1|3576751_3577765_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3577761_3578592_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3578623_3579763_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004147767.1|3579815_3579995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896394.1|3580640_3581156_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3581382_3582111_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3582131_3582863_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3582869_3583586_+	arginine transporter permease subunit ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3583585_3584254_+	arginine transporter permease subunit ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3584437_3585169_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3585211_3586684_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3586680_3587397_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3587475_3588603_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3588644_3589133_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
WP_002896372.1|3589190_3590036_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3590032_3590986_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
WP_002896370.1|3590996_3592130_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3592293_3593406_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3593754_3594234_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3594322_3595225_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3596046_3596334_-	membrane protein	NA	NA	NA	NA	NA
WP_002896352.1|3596536_3596800_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3596806_3597190_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3597456_3599142_+	transporter	NA	NA	NA	NA	NA
3599272:3599290	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3599361_3599580_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3599671_3600772_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3600768_3601254_-|tail	tail assembly protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3601250_3603878_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3603870_3603990_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3604004_3604304_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3604356_3604872_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3604881_3606054_-|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3606192_3607269_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3607298_3607502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3607498_3608230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3608233_3611185_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3611186_3611786_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3611778_3612687_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3612673_3613036_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3613032_3613605_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_032188295.1|3614044_3614131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3614169_3615150_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_094389604.1|3615148_3615592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3615588_3616035_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3616027_3616459_-|tail	tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3616554_3616983_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3616979_3617363_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3617367_3617877_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3617857_3618073_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3618076_3618280_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3618279_3618744_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3618839_3619490_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3619493_3620552_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3620568_3621402_-|capsid	phage capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3621544_3623311_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3623310_3624336_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3624397_3626140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700647.1|3626415_3627093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001316229.1|3627207_3627513_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3627451_3627640_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3627793_3630208_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3630204_3631062_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3631058_3631286_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3631285_3631519_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3631586_3631928_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3631891_3632092_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3632099_3632609_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3632641_3632863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3633008_3633887_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3633898_3634843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3634941_3636426_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3636425_3636677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151720.1|3636844_3637897_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3637972:3637990	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 9
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449899	4083007	4128282	5449899	tRNA,lysis,head,integrase	Escherichia_phage(26.42%)	63	4076220:4076266	4125354:4125400
4076220:4076266	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|4083007_4085485_-	hypothetical protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|4085471_4085867_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|4085863_4086334_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004165520.1|4086333_4086753_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004151253.1|4086852_4090299_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|4090391_4090895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|4091022_4091808_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|4091873_4092587_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|4092576_4092747_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|4092846_4093206_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|4093222_4093693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|4093986_4094241_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|4094243_4094999_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|4095174_4095852_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|4095904_4096657_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|4096725_4097118_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|4097114_4097540_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|4097542_4097905_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|4097904_4098078_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|4098077_4098458_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|4098460_4098700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|4098710_4099805_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|4099816_4100245_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|4100248_4101634_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|4101706_4102183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|4102224_4103229_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|4103203_4104625_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|4104637_4106110_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|4106109_4106712_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|4107082_4107412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|4107517_4107982_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|4107978_4108509_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|4108511_4108760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151283.1|4109669_4110359_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|4110355_4110886_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|4110878_4111016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151286.1|4111012_4111648_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|4111640_4111811_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4111810_4112266_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151290.1|4112518_4112767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151291.1|4112766_4113414_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|4113586_4114429_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|4114535_4115042_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|4115038_4115332_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151296.1|4115331_4116762_-	replicative DNA helicase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151297.1|4116751_4117651_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_001548453.1|4117875_4118097_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|4118137_4118371_-	transcriptional regulator	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|4118498_4119188_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4119538_4119754_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151303.1|4119853_4120048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4120136_4120421_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|4120436_4121282_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|4121278_4121959_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4121955_4122114_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4122110_4122767_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4122763_4123531_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4123527_4123746_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4123747_4123963_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151318.1|4124176_4125340_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|4125770_4126637_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4125354:4125400	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4126638_4126851_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004143010.1|4126896_4128282_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 10
NZ_CP022691	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 chromosome, complete genome	5449899	4337819	4349473	5449899	integrase	Enterobacteria_phage(70.0%)	13	4338269:4338283	4361326:4361340
WP_004144574.1|4337819_4338923_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4338269:4338283	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4338933_4340187_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4340539_4341730_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4341717_4342668_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4342667_4343093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4343661_4344228_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4344245_4344491_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4344487_4345225_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4345766_4346033_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4346029_4346587_+	CI repressor	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4346583_4346811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4346807_4347128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889890.1|4347139_4349473_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4361326:4361340	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 1
NZ_CP022692	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU8079-1, complete sequence	207349	5011	66749	207349	transposase,integrase,holin,protease	uncultured_Caudovirales_phage(29.41%)	55	33088:33104	73653:73669
WP_004152067.1|5011_5935_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|6607_6865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|7466_8921_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_004152070.1|9903_11181_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004152071.1|11243_13247_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14280_15488_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16916_17348_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17598_19074_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19066_19747_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19936_21322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001246153.1|21350_21704_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152079.1|21817_23110_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004098958.1|23120_26267_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26353_26794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26920_29368_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29408_29606_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29639_30377_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30665_31115_-	copper resistance protein	NA	NA	NA	NA	NA
WP_004152083.1|31348_33166_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
33088:33104	attL	TGGCCGCTGGGCGTATC	NA	NA	NA	NA
WP_001242438.1|33165_34062_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_000025662.1|34101_34482_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34486_35416_+	copper resistance protein D	NA	NA	NA	NA	NA
WP_001188930.1|35470_36151_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36147_37548_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37764_38199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152086.1|38430_38610_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40352_40862_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40911_41409_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41740_42067_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|42066_42777_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42785_43331_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_004152095.1|43406_43769_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
WP_004152096.1|45665_46202_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46234_46660_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46672_47962_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|48009_49761_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_004152100.1|49778_50141_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50190_50541_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50898_51168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51155_51731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51761_52256_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52299_52668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52701_52905_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52953_53211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53286_53541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53716_53983_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53970_54453_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|54664_56011_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
WP_004152113.1|57853_58816_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
WP_009483782.1|58802_59552_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|59789_59987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|59986_62782_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|62896_63466_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_004152118.1|63500_63782_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_000019473.1|65768_66749_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
73653:73669	attR	GATACGCCCAGCGGCCA	NA	NA	NA	NA
>prophage 2
NZ_CP022692	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU8079-1, complete sequence	207349	73218	112721	207349	transposase,integrase	Escherichia_phage(33.33%)	41	86429:86442	114500:114513
WP_004217321.1|73218_73923_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044117068.1|75226_75895_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000018329.1|76084_76900_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|77050_77755_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|77876_78782_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|78778_80017_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|80016_80601_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336397.1|80546_80903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|81093_81858_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024143553.1|81886_82069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130000.1|82084_82390_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|82400_83606_-	chromate transporter	NA	NA	NA	NA	NA
WP_000376616.1|83761_83965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|83983_84163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|84092_84932_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|84925_85273_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_094389648.1|85436_86228_-	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
86429:86442	attL	TGAAAACCTGCGCA	NA	NA	NA	NA
WP_001083725.1|86635_87133_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|87277_88291_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004193519.1|88229_88844_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|88969_89530_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_040179220.1|89532_92499_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000656305.1|92565_92943_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|93143_93803_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001322943.1|93856_94048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016197752.1|94780_95011_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_004118216.1|95010_96399_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_000005560.1|96391_97504_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118217.1|97500_98136_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_004114613.1|98692_99070_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
WP_004152557.1|99066_99414_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_094389650.1|102656_102863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|102861_103842_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118832.1|104436_106170_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|106177_107125_-	acetamidase	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|107169_108774_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|108786_109707_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152279.1|109706_110555_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|110551_111145_-	response regulator	NA	NA	NA	NA	NA
WP_004118840.1|111141_112269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118231.1|112553_112721_-|integrase	integrase	integrase	NA	NA	NA	NA
114500:114513	attR	TGAAAACCTGCGCA	NA	NA	NA	NA
>prophage 1
NZ_CP022693	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU8079-2, complete sequence	113639	11308	45192	113639	transposase,integrase	Escherichia_phage(25.0%)	33	43053:43066	45515:45528
WP_004152342.1|11308_12577_+|transposase	ISL3 family transposase ISKpn25	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152341.1|12696_13170_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004164986.1|13334_13529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|14383_15166_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|15165_15498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|15504_15861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|15928_16258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|16285_16594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|16639_16846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004234208.1|17080_17515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|17498_17729_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|17725_18142_+	PIN domain nuclease	NA	NA	NA	NA	NA
WP_004152334.1|18215_18926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093211.1|19657_19783_+	mercury transporter	NA	NA	NA	NA	NA
WP_001340589.1|19818_20241_+	mercury transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|20292_21987_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|22004_22367_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000993386.1|22363_22600_+	mercury resistance protein	NA	NA	NA	NA	NA
WP_000204520.1|22596_23304_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|23342_24647_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_000027057.1|25214_26075_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|27818_28523_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152403.1|28595_31493_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_004152402.1|31581_32202_+	serine recombinase	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152400.1|33367_33727_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152398.1|34230_35415_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|35691_37011_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|37260_38142_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152395.1|38193_38433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152394.1|38429_39209_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|39205_40231_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|40337_43367_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
43053:43066	attL	GTAGCGTTCATGCT	NA	NA	NA	NA
WP_004152391.1|43476_45192_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004152391.1|43476_45192_+|integrase	integrase	integrase	NA	NA	NA	NA
45515:45528	attR	AGCATGAACGCTAC	NA	NA	NA	NA
>prophage 1
NZ_CP022694	Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU8079-3, complete sequence	43376	3157	13452	43376	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000516402.1|3157_3820_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001549893.1|4200_4863_+	hypothetical protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_001549892.1|4949_5189_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_004199403.1|5191_5548_+	hypothetical protein	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
WP_002904004.1|6420_7281_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|7301_8063_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023148136.1|8053_8287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199413.1|10434_13452_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
