The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	0	147578	5406069	tail,transposase,head,bacteriocin,protease,terminase,integrase,portal,capsid,holin,lysis	Escherichia_phage(36.22%)	172	94125:94140	149343:149358
WP_077167767.1|212_920_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	64.0	1.1e-32
WP_077167981.1|1433_1985_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	72.7	9.4e-67
WP_000481379.1|2071_2263_-	hypothetical protein	NA	A0A088CD78	Shigella_phage	95.2	8.0e-26
WP_094364365.1|2386_10738_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	98.1	0.0e+00
WP_000012437.1|10807_12073_-	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
WP_000540391.1|12083_12335_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455645.1|12345_12792_-	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
WP_000509019.1|12794_13448_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
WP_000035555.1|13541_13943_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_001135718.1|13998_14139_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	97.8	2.0e-18
WP_000835365.1|14372_15107_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q08J76	Stx2-converting_phage	100.0	5.7e-136
WP_077168061.1|15197_15815_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	99.5	1.9e-121
WP_000455634.1|15820_16099_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|16113_17382_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|17378_19004_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|19298_19487_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|19627_19897_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|19898_21836_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207924.1|21832_22483_-	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000829200.1|22482_23046_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|23029_23491_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|23540_23930_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|23985_25200_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|25223_26231_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|26388_28533_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|28532_30239_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|30219_31026_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|31081_31285_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|31434_31728_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|31759_32224_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|32231_32381_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|32380_32950_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|33224_33758_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|33762_33978_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|34054_34327_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|34367_34547_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874499.1|34681_36619_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000738068.1|37105_37375_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|37386_38346_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204844.1|39129_39564_-	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_000144764.1|39556_39751_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107955.1|39747_40353_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_001004020.1|40352_41075_-	DNA-binding protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	7.8e-130
WP_000335902.1|41226_42276_-	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_000153270.1|42457_42985_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001310475.1|42981_43428_-	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	100.0	2.4e-81
WP_001281772.1|43384_43621_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|43631_43847_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000130.1|43979_44258_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001248388.1|44328_45705_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539349.1|45701_46523_-	replication protein	NA	B6DZ75	Enterobacteria_phage	100.0	1.5e-153
WP_000442612.1|46703_47000_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|47141_47357_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|47432_48128_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_085948178.1|48272_49486_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001130059.1|49943_50465_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|51033_51216_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|51193_51466_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|51524_51776_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065377.1|51958_52327_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198863.1|52399_52564_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000372941.1|52532_52676_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|52751_53048_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|53053_53839_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|53835_54513_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|54512_54695_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|54667_54859_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_077631611.1|54869_55151_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	98.9	5.5e-47
WP_000774248.1|55249_55471_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289936.1|55467_56241_+	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000797281.1|56392_56581_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951705.1|56582_56798_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_001142590.1|56799_57018_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|57019_57307_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001303965.1|58282_58582_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|58667_58952_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_085948178.1|59186_60399_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000607020.1|61624_62203_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|62223_62451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044286.1|62488_63730_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420639.1|65537_66458_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|66457_66763_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209883.1|66916_67516_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063176.1|67512_70059_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|70058_71231_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120119.1|71360_72053_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|72025_73054_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001054754.1|73136_75881_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	9.2e-38
WP_000818441.1|75952_77026_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|77074_77209_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|77236_77467_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|77441_77630_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|77640_77853_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|78138_78351_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|78792_79098_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001301846.1|79204_79849_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038071.1|79845_80592_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|80591_82688_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|82733_83873_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|83860_84307_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|84326_86507_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001301957.1|86626_87931_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|88010_88103_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460778.1|88115_89252_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263572.1|89263_90808_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004940.1|90941_91799_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|91795_92194_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003653.1|92190_92778_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|92774_93482_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|93500_95294_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
94125:94140	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|95290_96409_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|98682_98952_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|98953_100267_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230444.1|100331_100931_-	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515108.1|100998_104472_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_000649830.1|104605_105133_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_050546863.1|105323_105956_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|105901_106645_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|106655_107354_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|107353_107683_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_010904726.1|107679_108444_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.9	2.4e-129
WP_001455418.1|108395_110258_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_000533402.1|110238_110652_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|110678_111110_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|111123_111864_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|111845_112112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|112169_112517_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|112553_114059_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|114048_115641_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|115637_115844_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|115827_117756_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_001301919.1|117727_117970_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|118019_119558_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|119607_119955_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|119951_120332_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|120407_120683_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|121433_121640_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|121895_122168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|122327_122861_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|123081_123195_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|123416_123602_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|124129_124444_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|125800_127651_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|128418_129132_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|129226_129466_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|129752_130571_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|130722_131094_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|131083_131455_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|131467_132517_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|132518_132797_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|132964_133177_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|133221_133359_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|133724_134498_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|134849_135263_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|135278_136049_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|136070_136817_-	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|136823_137915_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|137993_138449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|138655_139081_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|139064_139337_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|139445_139847_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|139874_140066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|140065_140353_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|140630_140786_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|140927_141317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|141503_141689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|142262_142451_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|142447_142639_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|142732_145204_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|145271_145514_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|145491_146511_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|146918_147578_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
149343:149358	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 2
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	151811	153866	5406069		Bacillus_phage(100.0%)	1	NA	NA
WP_001301436.1|151811_153866_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 3
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	166465	168373	5406069		Tupanvirus(100.0%)	1	NA	NA
WP_000053083.1|166465_168373_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 4
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	184292	195091	5406069	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090506.1|184292_185060_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193803.1|185102_187715_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001301736.1|187980_189183_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117895.1|189351_190752_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.7	4.5e-81
WP_000977914.1|191354_192443_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.0	1.1e-98
WP_000462673.1|192627_193818_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109453.1|193868_194516_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|194542_195091_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 5
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	209796	214337	5406069		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|209796_211545_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705685.1|211581_213846_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|214052_214337_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 6
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	219423	220512	5406069		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057165.1|219423_220512_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
>prophage 7
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	224610	227825	5406069		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292812.1|224610_226893_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000111043.1|227084_227825_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 8
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	232664	256386	5406069	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
WP_000213047.1|232664_233282_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	6.6e-77
WP_000850325.1|233292_235737_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	3.9e-221
WP_000886683.1|235975_237268_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|237358_238702_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|238712_239324_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000076999.1|239478_243507_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|243641_244136_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|244680_245646_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043606.1|245768_247535_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202226.1|247535_249257_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	6.4e-21
WP_001241680.1|249298_250003_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|250287_250506_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|251192_253469_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|253499_253820_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|254142_254367_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188174.1|254439_256386_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 9
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	265646	267365	5406069		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815358.1|265646_267365_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 10
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	270952	271783	5406069		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255150.1|270952_271783_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 11
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	275483	276212	5406069		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|275483_276212_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 12
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	282882	292032	5406069		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149719.1|282882_284010_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.9	2.7e-28
WP_000389260.1|284050_284539_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061662.1|284598_285444_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105427.1|285440_286394_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|286403_287537_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126068.1|287631_288744_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|289094_289571_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|289658_290561_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189187.1|290621_291344_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201576.1|291327_291615_-	YbjC family protein	NA	NA	NA	NA	NA
WP_001195231.1|291774_292032_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 13
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	300598	301801	5406069		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|300598_301801_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 14
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	314089	315961	5406069		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301498.1|314089_315961_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.1	1.0e-16
>prophage 15
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	319279	319942	5406069		Synechococcus_phage(100.0%)	1	NA	NA
WP_000424894.1|319279_319942_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	4.3e-26
>prophage 16
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	325954	327547	5406069		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|325954_327547_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 17
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	332543	337767	5406069		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|332543_333059_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|333111_333177_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|333411_334299_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|334597_335101_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|335504_336251_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|336388_337048_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|337044_337767_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 18
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	341307	358203	5406069		Erwinia_phage(16.67%)	13	NA	NA
WP_000710619.1|341307_341568_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430049.1|341832_344115_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990173.1|344156_344843_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	7.7e-18
WP_000146359.1|344918_345185_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849297.1|345449_345710_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443495.1|345938_347024_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386538.1|347164_348127_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218659.1|348154_350305_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	4.8e-42
WP_000340624.1|350588_352601_-	type III secretion system effector EspX2	NA	NA	NA	NA	NA
WP_000007095.1|353208_354576_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|354804_355476_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|355478_356474_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996092.1|356466_358203_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 19
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	368802	369711	5406069		Streptococcus_phage(100.0%)	1	NA	NA
WP_001301716.1|368802_369711_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
>prophage 20
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	376191	416629	5406069	tail,terminase,integrase,portal,protease,holin,lysis	Enterobacteria_phage(51.16%)	51	378107:378121	416703:416717
WP_001303857.1|376191_377481_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.3e-18
WP_000767391.1|377539_378016_+	kinase inhibitor	NA	NA	NA	NA	NA
378107:378121	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|378522_379221_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|379451_380333_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|380502_380664_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|381160_382180_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|382213_383194_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|383370_383640_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|383641_384958_-|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|385017_385617_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|385687_389101_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|389161_389770_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|389706_390450_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|390455_391154_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|391163_391493_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|391492_394558_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|394529_394859_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|394867_395254_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|395314_396058_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|396068_396470_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|396466_397045_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|397056_397332_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|397324_397648_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|397734_399762_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|399706_400042_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|400163_401288_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|401215_401428_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|401424_403527_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|403526_404018_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|404692_404845_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|404832_405300_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|405296_405794_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|405793_406009_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000499454.1|406631_406790_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|406875_407619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|407802_408492_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|408506_408629_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|408966_409926_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|410137_410803_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108061.1|410799_411429_-	recombination protein NinG	NA	Q716C3	Shigella_phage	92.8	4.6e-94
WP_000567001.1|411421_411592_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|411588_411771_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|412468_413149_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|413145_413328_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|413300_413492_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|413502_413784_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|413882_414104_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|414314_414917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|415159_415327_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|415366_415585_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_024219169.1|415747_416629_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
416703:416717	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 21
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	426339	432914	5406069		Planktothrix_phage(33.33%)	7	NA	NA
WP_094364372.1|426339_427398_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	3.3e-20
WP_000604034.1|427400_428090_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101994.1|428089_428863_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|429029_429179_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_001147439.1|429307_430096_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096891.1|430163_431636_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265443.1|431897_432914_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 22
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	437275	440795	5406069		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|437275_438328_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784348.1|438643_439024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951276.1|439137_440079_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_000345402.1|440075_440795_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
>prophage 23
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	484452	485244	5406069		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114031.1|484452_485244_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.8	4.9e-08
>prophage 24
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	488622	491672	5406069		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032707.1|488622_490104_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	1.4e-45
WP_000207116.1|490253_491672_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.8	1.3e-59
>prophage 25
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	495616	508342	5406069		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_000015262.1|495616_499816_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.6	4.3e-26
WP_000424924.1|500057_500264_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001322326.1|500576_500666_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741164.1|500665_502339_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087992.1|502361_504410_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_001301506.1|504418_504991_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001301738.1|504983_507668_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186104.1|507664_508342_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.5	1.8e-27
>prophage 26
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	520044	523858	5406069	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287136.1|520044_521709_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.6	0.0e+00
WP_001023104.1|521911_523858_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 27
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	528484	530149	5406069		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337047.1|528484_530149_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	1.6e-85
>prophage 28
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	534246	535326	5406069		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|534246_535326_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 29
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	541209	544742	5406069		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|541209_541935_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207527.1|542052_542988_+	bifunctional siderophore receptor/adhesin Iha	NA	NA	NA	NA	NA
WP_000367870.1|543071_544742_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	3.0e-76
>prophage 30
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	551683	554266	5406069	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001301620.1|551683_554266_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 31
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	561276	563716	5406069		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231402.1|561276_562365_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|562504_563716_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 32
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	568531	569178	5406069		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|568531_568915_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|568968_569178_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 33
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	584603	586718	5406069		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|584603_585032_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|585152_586718_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 34
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	589786	591609	5406069		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029813.1|589786_591007_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
WP_000502952.1|590979_591609_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 35
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	605970	612013	5406069		Klosneuvirus(50.0%)	3	NA	NA
WP_000140631.1|605970_606786_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	3.3e-07
WP_000096698.1|606782_607916_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077784.1|608131_612013_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	2.9e-61
>prophage 36
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	623439	626577	5406069		Leptospira_phage(100.0%)	1	NA	NA
WP_000573920.1|623439_626577_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.3	2.6e-60
>prophage 37
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	629722	641626	5406069		uncultured_Caudovirales_phage(40.0%)	7	NA	NA
WP_000770953.1|629722_630406_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253799.1|630395_631844_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	1.7e-11
WP_000103382.1|632437_634339_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	1.2e-28
WP_001160813.1|634366_634828_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_001289110.1|634847_639698_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.8	4.5e-19
WP_000658316.1|639715_640123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127242.1|640291_641626_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.0	1.9e-20
>prophage 38
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	657632	660763	5406069	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729155.1|657632_658499_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|658500_658713_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143558.1|658820_659342_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912351.1|659377_660763_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 39
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	672284	673430	5406069		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706350.1|672284_673430_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.7	6.3e-49
>prophage 40
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	679535	681317	5406069		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|679535_681317_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 41
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	686572	694296	5406069		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000014801.1|686572_690769_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.8	7.5e-23
WP_000561902.1|691198_693613_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|693609_694296_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 42
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	697432	698110	5406069		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|697432_698110_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 43
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	703838	706001	5406069		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000739054.1|703838_706001_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.9	1.9e-17
>prophage 44
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	726857	729918	5406069		uncultured_virus(50.0%)	2	NA	NA
WP_000083954.1|726857_729362_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.3e-115
WP_000806442.1|729576_729918_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
>prophage 45
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	738161	746619	5406069		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801803.1|738161_739121_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	5.0e-15
WP_001250105.1|739117_740080_-	ferrochelatase	NA	NA	NA	NA	NA
WP_000261613.1|740211_740916_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|741036_742911_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|743020_743626_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|743625_743955_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122006.1|744007_745939_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_001301904.1|746067_746619_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	1.7e-31
>prophage 46
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	753457	756607	5406069		Leptospira_phage(100.0%)	1	NA	NA
WP_001132452.1|753457_756607_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	3.6e-54
>prophage 47
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	765445	768992	5406069		Bacillus_phage(100.0%)	2	NA	NA
WP_001256201.1|765445_767227_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
WP_001235611.1|767219_768992_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 48
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	772314	773010	5406069		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817243.1|772314_773010_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	4.2e-88
>prophage 49
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	776150	781197	5406069	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|776150_776423_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001302567.1|776631_778986_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.3	6.1e-224
WP_000130305.1|779173_780448_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|780573_781197_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 50
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	804553	806216	5406069		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001021161.1|804553_805024_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150441.1|805112_806216_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
>prophage 51
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	809821	814161	5406069	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_000046637.1|809821_810793_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|810803_812651_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|812678_813011_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|813033_814161_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 52
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	822761	832733	5406069		Bacillus_phage(60.0%)	7	NA	NA
WP_000893613.1|822761_824057_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.2	7.7e-27
WP_000113933.1|824114_824804_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|824993_826196_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698892.1|826192_829336_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001306939.1|829461_830646_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219315.1|830788_831697_-	fructokinase	NA	NA	NA	NA	NA
WP_001301975.1|831821_832733_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.3	2.3e-102
>prophage 53
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	839329	840445	5406069		Bacillus_phage(100.0%)	1	NA	NA
WP_000484042.1|839329_840445_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	8.7e-19
>prophage 54
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	847860	849018	5406069		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|847860_849018_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 55
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	855950	856718	5406069		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939394.1|855950_856718_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.9	3.8e-26
>prophage 56
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	864741	867367	5406069		Bacillus_virus(50.0%)	3	NA	NA
WP_000078833.1|864741_865788_+	Fe(3+) ions import ATP-binding protein FbpC	NA	G3M9Y6	Bacillus_virus	38.7	3.6e-35
WP_001141271.1|865947_866223_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842102.1|866257_867367_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 57
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	870445	872406	5406069		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_001013510.1|870445_871459_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
WP_000044300.1|871455_872406_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.7	3.0e-36
>prophage 58
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	879640	883920	5406069		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805884.1|879640_880723_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.4	2.4e-191
WP_000177948.1|880845_883920_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.3	0.0e+00
>prophage 59
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	888461	889361	5406069		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952470.1|888461_889361_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.0	1.2e-15
>prophage 60
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	892919	894806	5406069		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010271.1|892919_894806_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 61
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	903297	904347	5406069		Tupanvirus(100.0%)	1	NA	NA
WP_000692767.1|903297_904347_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.7	1.8e-71
>prophage 62
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	920209	930704	5406069	holin	Escherichia_phage(33.33%)	5	NA	NA
WP_094364441.1|920209_924193_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	39.0	3.4e-126
WP_000131044.1|924766_926800_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301903.1|926928_927516_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089099.1|927529_929002_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159114.1|929015_930704_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	9.6e-62
>prophage 63
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	941213	944518	5406069		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001046339.1|941213_942539_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.6e-112
WP_000474077.1|942647_942884_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000417405.1|942895_943489_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001301722.1|943648_944518_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.5e-53
>prophage 64
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	956167	958480	5406069	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000998048.1|956167_957706_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|957755_958103_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|958099_958480_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 65
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	970586	972785	5406069		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000667043.1|970586_972785_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
>prophage 66
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	982037	985740	5406069		Enterobacteria_phage(100.0%)	5	NA	NA
WP_000016225.1|982037_984371_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|984384_984708_-	endopeptidase ClpB	NA	NA	NA	NA	NA
WP_001071227.1|984707_984929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|984925_985483_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|985479_985740_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
>prophage 67
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	991941	1046356	5406069	plate,integrase,transposase	Enterobacteria_phage(22.22%)	49	986567:986581	996413:996427
986567:986581	attL	TCCGGGGCGGTTCAG	NA	NA	NA	NA
WP_001130487.1|991941_993123_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|994085_994829_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094364379.1|995652_996462_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	9.0e-50
996413:996427	attR	CTGAACCGCCCCGGA	NA	NA	NA	NA
WP_085948178.1|996467_997680_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000904979.1|997796_998351_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000788819.1|1000585_1000897_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|1001848_1002142_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|1002260_1002461_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|1002561_1003275_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|1003402_1003792_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|1004031_1004277_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_094364381.1|1005346_1006522_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.7	1.3e-94
WP_001285288.1|1006612_1007716_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|1008003_1009059_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|1009097_1009499_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|1009556_1010801_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|1010892_1011351_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|1011611_1013069_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|1013125_1013662_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|1013594_1013861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|1014167_1014620_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|1014629_1015028_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554757.1|1015030_1015324_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226188.1|1015375_1016431_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001301640.1|1016501_1017272_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|1017231_1018971_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|1019788_1020562_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|1020747_1021008_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|1021026_1021287_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|1021442_1022183_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|1022153_1022921_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1023025_1023604_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|1023843_1026288_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|1026330_1026804_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|1026957_1027728_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|1027845_1029018_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|1029098_1029284_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|1029198_1029462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|1029663_1031424_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|1031426_1032563_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001451053.1|1033308_1033872_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|1033940_1038155_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103125.1|1038230_1040372_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|1040581_1041100_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|1041796_1042297_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|1042331_1042556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|1042606_1043998_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|1044088_1044502_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|1044505_1046356_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 68
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1051336	1054114	5406069		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000614375.1|1051336_1054114_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.7	4.7e-82
>prophage 69
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1064890	1072743	5406069		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001301976.1|1064890_1065622_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|1065686_1066154_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301721.1|1066150_1066873_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|1066906_1067662_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|1067733_1069092_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211693.1|1069139_1069910_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|1069987_1070788_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|1071028_1071943_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|1071939_1072743_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
>prophage 70
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1079263	1080295	5406069		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|1079263_1080295_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 71
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1093287	1097403	5406069		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294772.1|1093287_1096770_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000569419.1|1096806_1097403_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
>prophage 72
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1106230	1106989	5406069		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|1106230_1106989_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 73
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1118731	1120156	5406069	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|1118731_1120156_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 74
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1124085	1124430	5406069		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1124085_1124430_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 75
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1130341	1131139	5406069		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|1130341_1131139_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 76
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1136382	1143188	5406069	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001301969.1|1136382_1138812_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	29.8	5.1e-40
WP_001283251.1|1138885_1139416_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|1139430_1140135_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|1140312_1140768_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000937419.1|1140804_1141731_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|1141769_1143188_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 77
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1153002	1153899	5406069	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339951.1|1153002_1153899_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.2	2.1e-60
>prophage 78
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1157161	1163784	5406069		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150612.1|1157161_1158088_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	2.0e-21
WP_000651595.1|1158196_1158859_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|1158899_1159436_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001297052.1|1159641_1162032_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_001189614.1|1162233_1163784_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	4.6e-18
>prophage 79
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1171531	1172956	5406069		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1171531_1172956_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 80
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1181466	1182018	5406069		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923722.1|1181466_1182018_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.1e-11
>prophage 81
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1186263	1187307	5406069		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217330.1|1186263_1187307_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.6	3.7e-104
>prophage 82
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1227493	1228192	5406069		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916267.1|1227493_1228192_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	4.7e-23
>prophage 83
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1234528	1239950	5406069		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035699.1|1234528_1236880_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	8.7e-37
WP_001117011.1|1237043_1239950_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 84
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1249042	1251003	5406069		Microcystis_phage(50.0%)	4	NA	NA
WP_000257187.1|1249042_1249891_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_001160975.1|1249887_1250202_-	CcdB family protein	NA	NA	NA	NA	NA
WP_000125566.1|1250204_1250438_-	antitoxin	NA	NA	NA	NA	NA
WP_000624372.1|1250523_1251003_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	5.2e-29
>prophage 85
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1258902	1264563	5406069		Vibrio_phage(50.0%)	4	NA	NA
WP_000787124.1|1258902_1260417_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	20.7	8.7e-06
WP_000347117.1|1260447_1261590_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349922.1|1261718_1262936_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001301863.1|1263009_1264563_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.3	1.2e-34
>prophage 86
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1270066	1271215	5406069		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|1270066_1271215_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 87
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1275621	1278438	5406069	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286832.1|1275621_1278438_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	1.6e-77
>prophage 88
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1287917	1296986	5406069		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681368.1|1287917_1289084_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_000935263.1|1289612_1289822_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	3.0e-18
WP_001118464.1|1289925_1291056_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|1291144_1293061_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843566.1|1293437_1293842_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102370.1|1293867_1294581_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|1294729_1295296_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001295414.1|1295330_1295918_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|1296032_1296986_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 89
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1308772	1310886	5406069		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219596.1|1308772_1310197_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	2.1e-09
WP_001188676.1|1310196_1310886_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
>prophage 90
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1314222	1319578	5406069		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|1314222_1316160_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|1316370_1318038_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093817.1|1318345_1319578_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	4.7e-82
>prophage 91
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1326298	1327621	5406069		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|1326298_1327621_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 92
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1333356	1336232	5406069		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|1333356_1333518_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001301888.1|1333644_1334250_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|1334642_1336232_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 93
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1343816	1345096	5406069		Salmonella_phage(50.0%)	2	NA	NA
WP_000098821.1|1343816_1344356_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|1344358_1345096_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 94
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1348320	1353685	5406069		Tupanvirus(50.0%)	4	NA	NA
WP_000106036.1|1348320_1349343_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091572.1|1349481_1350396_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410140.1|1350610_1351972_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919571.1|1352020_1353685_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 95
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1360117	1364086	5406069		Synechococcus_phage(50.0%)	2	NA	NA
WP_000819018.1|1360117_1362550_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
WP_001302468.1|1362616_1364086_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	1.3e-33
>prophage 96
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1394485	1395946	5406069		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|1394485_1395946_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 97
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1406127	1407804	5406069		Escherichia_phage(100.0%)	2	NA	NA
WP_000044700.1|1406127_1406724_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	5.1e-50
WP_000790583.1|1407201_1407804_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 98
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1411166	1436426	5406069		uncultured_Mediterranean_phage(66.67%)	6	NA	NA
WP_000991449.1|1411166_1412147_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.9	1.9e-102
WP_000218177.1|1413640_1415755_-	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	24.1	5.9e-08
WP_000937974.1|1415751_1422093_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.5	1.4e-57
WP_001229642.1|1422092_1427027_-	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	21.0	2.4e-28
WP_001041505.1|1427029_1429888_-	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	24.9	2.9e-42
WP_000383109.1|1430111_1436426_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.7	1.2e-35
>prophage 99
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1445321	1446149	5406069	integrase	Enterobacteria_phage(100.0%)	1	1441697:1441710	1449517:1449530
1441697:1441710	attL	AGATAATGAACATT	NA	NA	NA	NA
WP_001301682.1|1445321_1446149_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_001301682.1|1445321_1446149_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
1449517:1449530	attR	AATGTTCATTATCT	NA	NA	NA	NA
>prophage 100
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1449885	1467290	5406069	integrase,tRNA,transposase	Aeromonas_phage(14.29%)	13	NA	NA
WP_000964079.1|1449885_1450455_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	41.6	8.6e-23
WP_000588536.1|1450647_1451115_+	DUF1643 domain-containing protein	NA	A0A0F6WE62	Mycobacterium_phage	43.0	7.3e-28
WP_001261097.1|1452118_1452451_+	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_001046858.1|1452572_1452950_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|1453132_1454346_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000083142.1|1454545_1456495_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001301967.1|1456865_1457885_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	2.4e-44
WP_001294533.1|1458014_1459517_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	3.9e-83
WP_001295681.1|1459677_1460760_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|1460759_1461860_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|1462126_1463638_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|1463991_1464435_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|1464434_1467290_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 101
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1475735	1481832	5406069		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|1475735_1476671_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|1476683_1477145_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|1477217_1477604_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471889.1|1477809_1480506_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|1480646_1480700_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181321.1|1480884_1481832_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.5	6.7e-12
>prophage 102
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1485470	1488263	5406069		Vibrio_phage(50.0%)	2	NA	NA
WP_000187775.1|1485470_1487609_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	2.0e-266
WP_001106233.1|1487798_1488263_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
>prophage 103
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1492579	1499067	5406069		Klosneuvirus(33.33%)	6	NA	NA
WP_000853749.1|1492579_1493578_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|1493610_1494606_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|1494592_1495615_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205806.1|1495628_1497131_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|1497270_1498227_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|1498536_1499067_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 104
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1520250	1521898	5406069	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000826430.1|1520250_1521459_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	2.7e-207
WP_000604943.1|1521466_1521898_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
>prophage 105
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1535750	1536914	5406069		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943960.1|1535750_1536914_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
>prophage 106
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1540847	1553879	5406069	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076303.1|1540847_1543289_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|1543327_1543753_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1543957_1545256_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1545359_1545557_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1545638_1546643_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|1546645_1547905_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|1547990_1549271_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|1549347_1549656_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280341.1|1549741_1550692_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122477.1|1550684_1552532_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	7.5e-60
WP_000990297.1|1552541_1553879_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 107
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1557794	1558340	5406069		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001302216.1|1557794_1558340_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 108
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1565768	1566746	5406069		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|1565768_1566746_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 109
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1571665	1572199	5406069		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|1571665_1572199_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 110
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1576546	1578530	5406069		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|1576546_1578193_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|1578236_1578530_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 111
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1592807	1596019	5406069	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856824.1|1592807_1594265_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.2e-47
WP_001295074.1|1594501_1596019_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 112
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1617215	1618718	5406069		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|1617215_1618718_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 113
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1623656	1624445	5406069		Cedratvirus(100.0%)	1	NA	NA
WP_001193352.1|1623656_1624445_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.5	3.2e-12
>prophage 114
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1630049	1631599	5406069		Bacillus_virus(50.0%)	2	NA	NA
WP_001075518.1|1630049_1630808_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
WP_000611407.1|1630918_1631599_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	4.6e-07
>prophage 115
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1637329	1638850	5406069		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001089388.1|1637329_1638850_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	7.7e-18
>prophage 116
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1644386	1646372	5406069		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001066022.1|1644386_1646372_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	9.3e-149
>prophage 117
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1651617	1653765	5406069		Escherichia_phage(100.0%)	1	NA	NA
WP_010904990.1|1651617_1653765_+	formate dehydrogenase N subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 118
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1663145	1665104	5406069		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078217.1|1663145_1665104_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.0	8.2e-89
>prophage 119
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1670691	1672041	5406069		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|1670691_1672041_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 120
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1675857	1679471	5406069		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|1675857_1676394_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357763.1|1676648_1679471_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 121
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1683650	1686198	5406069		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147332.1|1683650_1684730_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	4.0e-29
WP_000918366.1|1684782_1686198_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
>prophage 122
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1692759	1693368	5406069		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|1692759_1693368_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 123
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1702491	1703607	5406069		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|1702491_1703607_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 124
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1728993	1732677	5406069		Dickeya_phage(100.0%)	1	NA	NA
WP_000096047.1|1728993_1732677_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 125
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1748569	1750159	5406069		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187564.1|1748569_1750159_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 126
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1755527	1757291	5406069		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|1755527_1755800_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940104.1|1755986_1756577_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|1756619_1757291_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 127
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1766436	1774765	5406069		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|1766436_1770660_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|1770736_1774765_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 128
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1778760	1781813	5406069		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|1778760_1779945_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|1780862_1781813_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 129
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1790157	1795940	5406069	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
WP_000591342.1|1790157_1792002_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	3.2e-10
WP_000187008.1|1792370_1793471_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|1793510_1793870_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|1793869_1794520_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000125471.1|1794623_1795940_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.7	1.2e-59
>prophage 130
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1815802	1818978	5406069		Hokovirus(50.0%)	2	NA	NA
WP_001174066.1|1815802_1818304_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424823.1|1818315_1818978_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 131
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1831844	1836029	5406069		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000014969.1|1831844_1836029_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
>prophage 132
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1841666	1842998	5406069		Erwinia_phage(100.0%)	1	NA	NA
WP_001293341.1|1841666_1842998_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 133
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1846761	1847607	5406069		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000084268.1|1846761_1847607_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 134
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1859275	1864136	5406069		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|1859275_1859974_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|1859970_1861344_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270249.1|1861449_1862124_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166037.1|1862272_1863256_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|1863515_1864136_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 135
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1880447	1883498	5406069		Escherichia_phage(100.0%)	1	NA	NA
WP_010917870.1|1880447_1883498_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 136
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1892880	1895660	5406069		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|1892880_1893666_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621641.1|1893699_1894596_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_094364388.1|1894763_1895660_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	89.9	2.8e-60
>prophage 137
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1912655	1915126	5406069		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|1912655_1913705_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|1913716_1915126_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 138
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1919201	1921988	5406069		uncultured_virus(100.0%)	1	NA	NA
WP_000250007.1|1919201_1921988_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	2.2e-71
>prophage 139
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1935679	1936294	5406069		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|1935679_1936294_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 140
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1945084	1948371	5406069		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|1945084_1945861_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|1945863_1946379_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|1946382_1946652_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|1946730_1948371_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 141
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1960902	1962732	5406069		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|1960902_1962732_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 142
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1971102	1974961	5406069		Bacillus_phage(100.0%)	3	NA	NA
WP_094364391.1|1971102_1973265_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	3.5e-117
WP_001213567.1|1973348_1974065_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130682.1|1974064_1974961_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	30.0	2.2e-25
>prophage 143
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1985264	1986920	5406069		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395849.1|1985264_1986920_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 144
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	1995230	2001374	5406069		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612040.1|1995230_1996361_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145177.1|1996365_1997040_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676061.1|1997017_1997899_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	9.6e-106
WP_001226597.1|1997917_1998985_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	6.6e-101
WP_000006621.1|1998984_2000247_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866672.1|2000243_2001374_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 145
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2005416	2010830	5406069		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2005416_2005746_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047491.1|2005876_2007142_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	4.1e-41
WP_001295254.1|2007277_2008762_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|2008808_2010830_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 146
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2019262	2020909	5406069		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012623.1|2019262_2020909_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.0	2.5e-67
>prophage 147
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2034301	2040154	5406069		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|2034301_2035192_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|2035216_2036182_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387782.1|2036186_2037692_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_001301979.1|2037699_2038119_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102329.1|2038285_2040154_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.4	1.9e-63
>prophage 148
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2043322	2044315	5406069		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|2043322_2044315_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 149
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2056268	2059630	5406069		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|2056268_2057639_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334100.1|2057800_2059630_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
>prophage 150
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2066680	2070613	5406069		Cyanophage(50.0%)	4	NA	NA
WP_000867143.1|2066680_2067721_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|2067807_2068767_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|2068766_2069657_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|2069839_2070613_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 151
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2079595	2080933	5406069		Moraxella_phage(100.0%)	1	NA	NA
WP_001301685.1|2079595_2080933_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	3.4e-62
>prophage 152
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2093607	2100976	5406069		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001303730.1|2093607_2093865_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239733.1|2093828_2094188_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|2094204_2094345_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|2094574_2094655_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059116.1|2094951_2096355_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|2096359_2097460_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|2097459_2098533_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|2098561_2100976_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 153
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2106507	2107461	5406069		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|2106507_2106921_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|2107032_2107461_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 154
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2114322	2123344	5406069		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087120.1|2114322_2116038_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.4	5.6e-41
WP_000828465.1|2116034_2117528_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	6.6e-30
WP_000511301.1|2117574_2118024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703959.1|2118132_2118480_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|2118469_2118832_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148051.1|2118828_2119326_+	radical SAM protein	NA	NA	NA	NA	NA
WP_001302348.1|2119333_2120518_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000060506.1|2120797_2120887_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_010904951.1|2121451_2121550_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168421.1|2121655_2123344_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	1.8e-55
>prophage 155
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2152000	2153539	5406069		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723942.1|2152000_2153539_-	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	29.3	1.0e-09
>prophage 156
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2176522	2178835	5406069	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000998051.1|2176522_2178061_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|2178110_2178458_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2178454_2178835_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 157
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2182674	2183856	5406069	integrase	Enterobacteria_phage(100.0%)	1	2181849:2181862	2195461:2195474
2181849:2181862	attL	ATCTCCGCACCATA	NA	NA	NA	NA
WP_001219063.1|2182674_2183856_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
WP_001219063.1|2182674_2183856_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
2195461:2195474	attR	ATCTCCGCACCATA	NA	NA	NA	NA
>prophage 158
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2190031	2191423	5406069		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2190031_2191423_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 159
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2196544	2203295	5406069		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|2196544_2198653_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|2198671_2198947_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001301691.1|2199001_2199625_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	33.9	3.5e-17
WP_001303719.1|2199882_2201565_+	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.8	3.3e-22
WP_000924289.1|2201561_2202179_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001002036.1|2202470_2203295_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.1	4.5e-89
>prophage 160
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2206669	2211232	5406069		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|2206669_2207125_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050139.1|2207105_2208326_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001297375.1|2208497_2209166_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|2209382_2209619_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|2209639_2209807_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|2209904_2210714_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|2210752_2211232_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 161
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2223163	2233894	5406069		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|2223163_2224096_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_000842823.1|2224400_2225258_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|2225532_2226729_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646013.1|2226738_2227764_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.8e-18
WP_001303717.1|2228002_2229019_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.7e-09
WP_000483856.1|2229024_2229984_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|2229987_2231271_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116565.1|2231280_2232825_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|2233069_2233501_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|2233642_2233894_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 162
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2255803	2266965	5406069	tRNA	uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_070479907.1|2255803_2260033_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	1.1e-24
WP_000779800.1|2260261_2260870_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|2260967_2262359_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582452.1|2262355_2264200_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
WP_000168711.1|2264388_2265540_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000985752.1|2265669_2266965_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
>prophage 163
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2285004	2286546	5406069		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146509.1|2285004_2286546_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 164
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2291864	2292860	5406069		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182646.1|2291864_2292860_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	3.1e-12
>prophage 165
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2297081	2297294	5406069		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2297081_2297294_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 166
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2300948	2303282	5406069		Escherichia_phage(100.0%)	1	NA	NA
WP_000185340.1|2300948_2303282_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	8.3e-72
>prophage 167
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2318923	2320908	5406069		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|2318923_2319907_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107027.1|2319903_2320908_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 168
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2366880	2368350	5406069		Bacillus_virus(50.0%)	2	NA	NA
WP_001296814.1|2366880_2367528_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
WP_000622314.1|2367579_2368350_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	1.3e-18
>prophage 169
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2379939	2382074	5406069		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065773.1|2379939_2380365_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	1.6e-50
WP_000922639.1|2380377_2381667_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008967.1|2381720_2382074_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	3.7e-24
>prophage 170
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2385423	2387466	5406069		Indivirus(100.0%)	1	NA	NA
WP_001301787.1|2385423_2387466_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	8.9e-46
>prophage 171
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2400902	2405110	5406069		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000149107.1|2400902_2403638_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_001301659.1|2403637_2404762_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001259386.1|2404834_2405110_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	1.9e-15
>prophage 172
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2411730	2412537	5406069		Bacillus_virus(100.0%)	1	NA	NA
WP_000173697.1|2411730_2412537_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.7	1.3e-16
>prophage 173
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2435785	2439917	5406069		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|2435785_2436451_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|2436671_2436917_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106562.1|2437018_2439217_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	1.5e-118
WP_000964718.1|2439290_2439917_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 174
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2442923	2445742	5406069		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|2442923_2443592_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042018.1|2443584_2444643_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|2444887_2445742_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 175
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2452223	2453706	5406069		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|2452223_2452991_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|2452992_2453706_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 176
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2458075	2459886	5406069		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907770.1|2458075_2459146_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.3e-19
WP_000073575.1|2459142_2459886_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.5	6.4e-10
>prophage 177
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2470079	2471074	5406069		Catovirus(50.0%)	2	NA	NA
WP_000410808.1|2470079_2470688_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	34.0	2.2e-16
WP_000502498.1|2470672_2471074_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	42.9	8.2e-12
>prophage 178
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2482533	2484981	5406069		Dickeya_phage(100.0%)	1	NA	NA
WP_000993447.1|2482533_2484981_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 179
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2493887	2495114	5406069		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105473.1|2493887_2495114_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.8	3.4e-133
>prophage 180
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2500333	2502727	5406069		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081903.1|2500333_2502727_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 181
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2508694	2509573	5406069		Sodalis_phage(100.0%)	1	NA	NA
WP_000039084.1|2508694_2509573_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	4.2e-69
>prophage 182
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2516136	2519903	5406069		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|2516136_2516856_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253697.1|2516852_2518205_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_001301499.1|2518280_2519903_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	2.6e-141
>prophage 183
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2536805	2537642	5406069		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|2536805_2537642_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 184
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2554179	2563720	5406069		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601867.1|2554179_2554743_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	9.3e-62
WP_000963819.1|2554828_2556049_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|2556115_2558206_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|2558256_2558889_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|2559190_2559595_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274677.1|2559649_2560519_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|2560572_2560791_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057377.1|2560784_2561807_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|2561806_2563720_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 185
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2569290	2574864	5406069		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_001209704.1|2569290_2569677_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	2.1e-17
WP_000820735.1|2569676_2570036_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.2	3.1e-10
WP_000903376.1|2570043_2570331_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|2570456_2570831_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|2570927_2571398_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|2571494_2573609_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|2573679_2574864_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 186
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2594741	2596213	5406069	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004459.1|2594741_2595689_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|2595703_2596213_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 187
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2606715	2610869	5406069		Bacillus_virus(50.0%)	4	NA	NA
WP_000078338.1|2606715_2607474_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001302908.1|2607481_2608585_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019652.1|2608594_2609776_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|2609843_2610869_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 188
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2617418	2618303	5406069		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258927.1|2617418_2618303_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	1.1e-24
>prophage 189
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2628867	2629911	5406069		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2628867_2629911_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 190
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2646412	2648937	5406069	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|2646412_2647480_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001301636.1|2647569_2648937_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	5.1e-21
>prophage 191
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2652903	2653401	5406069	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|2652903_2653401_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 192
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2657094	2661764	5406069		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108469.1|2657094_2658585_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	3.7e-09
WP_001301938.1|2658632_2659322_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209030.1|2659318_2660194_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979870.1|2660190_2660655_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445155.1|2660714_2661764_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	9.8e-73
>prophage 193
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2668512	2683307	5406069		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001299745.1|2668512_2669442_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809770.1|2669537_2671874_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001302019.1|2672103_2672757_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047079.1|2672753_2673482_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620409.1|2673478_2674111_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|2674324_2674597_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|2674593_2675448_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_001301839.1|2675493_2675985_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|2676102_2676390_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|2676412_2677846_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|2677893_2678619_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|2678625_2679183_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|2679151_2679727_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030005.1|2679723_2680290_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001302021.1|2680310_2681297_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	2.5e-38
WP_000922872.1|2681310_2682288_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|2682497_2683307_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 194
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2687375	2688854	5406069		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|2687375_2687654_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047341.1|2687882_2688854_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 195
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2695482	2698355	5406069	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107466.1|2695482_2697417_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|2697506_2698355_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 196
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2702437	2709076	5406069		Dickeya_phage(50.0%)	4	NA	NA
WP_000207678.1|2702437_2703781_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|2704411_2704864_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|2704891_2706379_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|2706403_2709076_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 197
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2714558	2716448	5406069		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001301504.1|2714558_2716448_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 198
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2722149	2731656	5406069	transposase	Diadromus_pulchellus_ascovirus(20.0%)	12	NA	NA
WP_000189317.1|2722149_2722452_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449463.1|2722502_2722946_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|2722925_2723444_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000084526.1|2723571_2724207_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147622.1|2724279_2725320_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|2725433_2726009_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|2726018_2726609_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246856.1|2726628_2727024_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249209.1|2726981_2729018_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809262.1|2729082_2729943_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000638266.1|2729985_2730459_-	fimbrial protein	NA	NA	NA	NA	NA
WP_085948178.1|2730442_2731656_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 199
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2753910	2755056	5406069		Streptococcus_phage(100.0%)	1	NA	NA
WP_001301934.1|2753910_2755056_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 200
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2762868	2765163	5406069		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861740.1|2762868_2765163_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.3e-157
>prophage 201
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2785738	2790186	5406069	transposase	Escherichia_phage(100.0%)	5	NA	NA
WP_001098809.1|2785738_2786704_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	6.7e-36
WP_000617675.1|2786987_2787974_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000942543.1|2788052_2788745_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_127822606.1|2788821_2789007_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.1e-06
WP_085948178.1|2788972_2790186_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 202
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2800972	2817168	5406069	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082875.1|2800972_2804065_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	8.5e-157
WP_000212464.1|2804248_2805232_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450588.1|2805450_2805783_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000633381.1|2805824_2807315_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000094674.1|2807621_2809142_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	52.2	1.8e-35
WP_000018008.1|2809295_2809919_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065895.1|2810206_2810971_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228926.1|2811224_2811731_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|2811809_2813651_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|2813845_2815591_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|2815701_2815917_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264362.1|2816154_2817168_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	3.7e-109
>prophage 203
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2823571	2824810	5406069	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708496.1|2823571_2824810_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	2.2e-92
>prophage 204
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2829947	2831381	5406069		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869160.1|2829947_2831381_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	1.1e-39
>prophage 205
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2835668	2850999	5406069		Staphylococcus_phage(14.29%)	15	NA	NA
WP_001076997.1|2835668_2836322_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469270.1|2836583_2836754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|2836811_2837585_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188393.1|2837700_2838516_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|2838553_2839714_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|2839719_2840391_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735274.1|2840538_2842020_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|2842224_2842854_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|2842854_2843277_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|2843301_2844129_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|2844128_2844710_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195286.1|2844738_2846631_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	2.6e-92
WP_001051708.1|2846694_2848836_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000940880.1|2849209_2850019_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
WP_000986441.1|2850015_2850999_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	8.5e-10
>prophage 206
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2857124	2869250	5406069		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|2857124_2857517_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183479.1|2857569_2858052_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001301989.1|2858160_2859768_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001281881.1|2859905_2862164_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|2862397_2863135_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|2863209_2864622_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095178.1|2864732_2866952_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848536.1|2866994_2867252_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000013136.1|2868422_2869250_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	9.5e-63
>prophage 207
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2875326	2876211	5406069		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|2875326_2876211_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 208
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2892942	2895451	5406069	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_000624681.1|2892942_2893293_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
WP_000998048.1|2893515_2895054_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2895103_2895451_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
>prophage 209
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2900309	2901299	5406069		Salmonella_phage(100.0%)	1	NA	NA
WP_000953022.1|2900309_2901299_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	2.9e-98
>prophage 210
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2906535	2912680	5406069	integrase	Stx2-converting_phage(50.0%)	4	2886942:2886957	2921896:2921911
2886942:2886957	attL	CGCCCAGCGCGAGCAG	NA	NA	NA	NA
WP_000605048.1|2906535_2907084_+	Ail/Lom family protein	NA	Q9LA63	Enterobacterial_phage	32.4	9.8e-16
WP_000631719.1|2909405_2909753_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_001301939.1|2909749_2910424_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	31.6	4.7e-12
WP_001218882.1|2911414_2912680_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	3.0e-76
2921896:2921911	attR	CGCCCAGCGCGAGCAG	NA	NA	NA	NA
>prophage 211
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2935566	2936721	5406069		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2935566_2936721_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 212
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2950297	2950975	5406069		Bacillus_virus(100.0%)	1	NA	NA
WP_000956885.1|2950297_2950975_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	2.9e-09
>prophage 213
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2968980	2970213	5406069		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2968980_2970213_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 214
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2978742	2983215	5406069		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000195009.1|2978742_2981616_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
WP_001310226.1|2981781_2983215_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.8	2.0e-31
>prophage 215
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	2987020	3002412	5406069	tRNA	Brevibacillus_phage(14.29%)	13	NA	NA
WP_000806640.1|2987020_2987917_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.9e-30
WP_000715214.1|2987941_2988652_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813185.1|2988657_2990391_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_001701073.1|2990481_2991579_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003075.1|2991589_2993107_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	7.7e-87
WP_001192814.1|2993149_2993698_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|2993752_2993824_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|2993820_2993946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303646.1|2993947_2995396_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	4.3e-26
WP_001322328.1|2995831_2997751_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000012163.1|2998274_2999642_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000012247.1|2999677_3000994_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|3001011_3002412_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 216
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3026691	3027447	5406069		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|3026691_3027447_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 217
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3059253	3061748	5406069		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603526.1|3059253_3060015_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
WP_000256438.1|3060329_3061748_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 218
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3071379	3078152	5406069		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|3071379_3072093_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|3072161_3072851_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|3073535_3074066_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|3074078_3076325_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|3076475_3077351_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|3077357_3078152_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 219
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3083628	3099176	5406069	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001138211.1|3083628_3086517_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	3.4e-67
WP_001301864.1|3086509_3090052_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.8	4.4e-08
WP_000775988.1|3090051_3091878_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	1.6e-25
WP_000237947.1|3091939_3093271_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|3093502_3094756_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|3095334_3096432_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117733.1|3096670_3097477_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	7.2e-15
WP_000184261.1|3097527_3097971_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001301742.1|3097970_3099176_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.3e-73
>prophage 220
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3110702	3111458	5406069		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3110702_3111458_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 221
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3116316	3117165	5406069		Vibrio_phage(100.0%)	1	NA	NA
WP_000100435.1|3116316_3117165_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.1e-41
>prophage 222
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3124700	3128815	5406069		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|3124700_3127457_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046824.1|3127513_3128815_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	1.1e-38
>prophage 223
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3132847	3135871	5406069		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_000210878.1|3132847_3134485_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|3134572_3135871_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
>prophage 224
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3139686	3140358	5406069		Vibrio_phage(100.0%)	1	NA	NA
WP_001199973.1|3139686_3140358_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 225
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3144522	3145308	5406069		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021347.1|3144522_3145308_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 226
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3168970	3171003	5406069		Hokovirus(50.0%)	2	NA	NA
WP_001090366.1|3168970_3170398_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|3170397_3171003_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 227
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3174115	3184136	5406069		uncultured_Mediterranean_phage(33.33%)	10	NA	NA
WP_001295182.1|3174115_3174877_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3174870_3175497_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272567.1|3175636_3176776_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3176838_3177831_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000175365.1|3177950_3178358_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000767724.1|3178504_3179098_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000863205.1|3179097_3180525_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000562982.1|3180535_3180772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001141350.1|3180812_3181469_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	7.3e-50
WP_001272898.1|3181574_3184136_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 228
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3201926	3202940	5406069		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001302219.1|3201926_3202940_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	3.0e-26
>prophage 229
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3210211	3211177	5406069		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|3210211_3211177_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 230
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3216644	3222029	5406069	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_001301974.1|3216644_3217142_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	7.5e-31
WP_000963143.1|3217221_3218283_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|3218350_3218851_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047198.1|3218978_3221609_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|3221843_3222029_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 231
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3234748	3240045	5406069		Bacillus_virus(20.0%)	5	NA	NA
WP_000985501.1|3234748_3235951_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.9e-27
WP_000777971.1|3236306_3237266_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.9e-132
WP_000246553.1|3237275_3239420_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.9e-196
WP_000080947.1|3239392_3239803_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|3239799_3240045_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 232
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3245944	3249996	5406069		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|3245944_3246394_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|3246394_3247057_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001301367.1|3247077_3248478_-	GABA permease	NA	NA	NA	NA	NA
WP_000097647.1|3248715_3249996_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
>prophage 233
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3259459	3259669	5406069		Salmonella_phage(100.0%)	1	NA	NA
WP_072145424.1|3259459_3259669_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.2	1.7e-08
>prophage 234
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3265971	3290043	5406069	tail,holin,integrase,transposase	Stx2-converting_phage(33.33%)	30	3258146:3258160	3290914:3290928
3258146:3258160	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_001071599.1|3265971_3266178_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000540864.1|3266500_3267706_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|3267707_3269021_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|3269017_3270649_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|3270649_3271048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|3271145_3271559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024180593.1|3271954_3273211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|3273286_3273589_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|3273624_3274380_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|3274751_3275318_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|3275292_3275904_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|3275900_3276566_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|3276562_3277186_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|3277438_3278182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|3278267_3278435_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000143065.1|3278842_3280696_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|3280845_3281061_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|3281065_3281410_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|3281766_3282147_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3282143_3282491_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|3282540_3283185_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|3282991_3283882_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|3283878_3284205_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|3284422_3284692_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|3284852_3285275_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|3285404_3286463_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|3286541_3287192_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|3287374_3287965_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|3288466_3288715_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|3289560_3290043_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3290914:3290928	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 235
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3303678	3304749	5406069		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168032.1|3303678_3304749_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
>prophage 236
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3310655	3313229	5406069		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|3310655_3313229_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 237
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3319002	3320301	5406069		Burkholderia_virus(100.0%)	1	NA	NA
WP_000852126.1|3319002_3320301_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
>prophage 238
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3325594	3331677	5406069	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|3325594_3326014_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|3326220_3327258_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262720.1|3327305_3327995_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000627807.1|3328299_3328683_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189215.1|3328738_3329326_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001383425.1|3329428_3330310_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|3330342_3331677_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 239
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3337436	3341179	5406069		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|3337436_3339236_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|3339251_3340226_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|3340498_3341179_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 240
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3344639	3344900	5406069		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|3344639_3344900_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 241
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3349018	3360326	5406069		Bacillus_phage(50.0%)	7	NA	NA
WP_000970087.1|3349018_3352906_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
WP_001301750.1|3353481_3354909_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	1.8e-16
WP_001215861.1|3355073_3355787_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001295369.1|3355776_3357111_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|3357171_3357510_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883120.1|3357554_3358745_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919165.1|3359072_3360326_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 242
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3366083	3367595	5406069		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493513.1|3366083_3367595_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	8.7e-14
>prophage 243
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3382759	3389216	5406069		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|3382759_3383974_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|3384001_3384388_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|3384404_3384728_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|3384823_3385339_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|3385355_3387206_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|3387207_3387543_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|3387554_3387755_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133587.1|3387932_3389216_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 244
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3399124	3404372	5406069		Escherichia_phage(66.67%)	5	NA	NA
WP_000380694.1|3399124_3401506_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	38.8	1.3e-144
WP_000077290.1|3401502_3402132_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.9	3.3e-60
WP_000544905.1|3402124_3402946_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000948584.1|3402945_3403800_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000963837.1|3403940_3404372_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 245
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3413201	3419496	5406069		Escherichia_phage(60.0%)	6	NA	NA
WP_000937887.1|3413201_3414572_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
WP_001299507.1|3414733_3416200_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|3416268_3417846_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755178.1|3417938_3418478_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000669402.1|3418493_3419009_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_001344399.1|3419322_3419496_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 246
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3425930	3429932	5406069		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028610.1|3425930_3426569_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	5.3e-29
WP_001301832.1|3426568_3427606_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|3427930_3428557_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|3428642_3429932_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 247
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3451232	3451946	5406069		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3451232_3451946_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 248
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3469205	3470156	5406069		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|3469205_3470156_-	transaldolase A	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 249
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3488622	3493560	5406069		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|3488622_3489492_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|3489705_3490131_+	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_000842944.1|3490117_3490567_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838957.1|3490627_3491203_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001301804.1|3491298_3492198_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001302015.1|3492255_3493560_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	24.7	5.6e-09
>prophage 250
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3497038	3512407	5406069		Streptococcus_phage(33.33%)	14	NA	NA
WP_000517430.1|3497038_3497830_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	2.0e-17
WP_000290223.1|3497987_3499004_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000458420.1|3499003_3499837_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852688.1|3499836_3500712_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021035.1|3500701_3501799_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001301606.1|3501932_3502844_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	5.9e-58
WP_000096648.1|3503318_3504170_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522250.1|3504212_3504722_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|3504762_3506490_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|3506534_3506792_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|3507175_3508147_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|3508331_3509093_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001299866.1|3509322_3510321_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443697.1|3510391_3512407_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.3	1.5e-149
>prophage 251
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3517161	3518920	5406069	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_000604897.1|3517161_3517704_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	57.7	5.1e-41
WP_000826440.1|3517711_3518920_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	6.0e-207
>prophage 252
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3535696	3536431	5406069		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|3535696_3536431_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 253
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3540249	3541170	5406069		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|3540249_3541170_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 254
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3544864	3552437	5406069		Ostreococcus_lucimarinus_virus(50.0%)	3	NA	NA
WP_001283490.1|3544864_3546559_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_000955028.1|3546628_3547573_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001301578.1|3548843_3552437_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	7.8e-37
>prophage 255
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3559090	3560524	5406069		Bacillus_phage(100.0%)	1	NA	NA
WP_000194527.1|3559090_3560524_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	1.2e-28
>prophage 256
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3563570	3564197	5406069		Clostridium_phage(100.0%)	1	NA	NA
WP_001102876.1|3563570_3564197_-	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	28.7	5.9e-09
>prophage 257
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3567661	3573048	5406069	integrase	Enterobacteria_phage(50.0%)	6	3556610:3556626	3575244:3575260
3556610:3556626	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001005794.1|3567661_3568192_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|3568191_3568659_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|3568645_3569326_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|3569335_3570472_+	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|3570646_3571804_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|3572115_3573048_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3575244:3575260	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 258
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3591111	3592197	5406069		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|3591111_3592197_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 259
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3600743	3601880	5406069		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699109.1|3600743_3601880_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
>prophage 260
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3608538	3610056	5406069		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|3608538_3610056_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 261
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3614267	3616128	5406069	transposase	Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|3614267_3615041_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156155.1|3615237_3616128_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.7	2.6e-66
>prophage 262
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3626687	3629915	5406069		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203399.1|3626687_3627338_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
WP_001012899.1|3627424_3629257_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|3629315_3629915_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 263
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3664412	3669416	5406069		Tupanvirus(50.0%)	4	NA	NA
WP_000860282.1|3664412_3666395_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	2.4e-19
WP_000461646.1|3666394_3667363_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A0A075B8F6	Enterobacteria_phage	32.6	1.2e-35
WP_001303599.1|3667366_3668506_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	1.1e-29
WP_001302794.1|3668813_3669416_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 264
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3673019	3677358	5406069	transposase	Oenococcus_phage(50.0%)	4	NA	NA
WP_000174589.1|3673019_3674225_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	4.2e-27
WP_001302964.1|3674281_3675571_+	MFS transporter	NA	NA	NA	NA	NA
WP_027868265.1|3675596_3676391_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000140578.1|3676431_3677358_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.0e-69
>prophage 265
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3683250	3684327	5406069		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779084.1|3683250_3684327_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 266
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3689095	3692992	5406069		Pseudomonas_phage(66.67%)	3	NA	NA
WP_000135039.1|3689095_3689350_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	1.5e-24
WP_000332037.1|3689349_3690480_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_001075170.1|3690706_3692992_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
>prophage 267
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3698449	3701077	5406069		Bacillus_virus(100.0%)	1	NA	NA
WP_001281251.1|3698449_3701077_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 268
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3710776	3713626	5406069		Hokovirus(100.0%)	1	NA	NA
WP_000876002.1|3710776_3713626_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	4.1e-41
>prophage 269
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3717903	3723681	5406069		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865552.1|3717903_3719007_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.7	9.5e-119
WP_000406064.1|3719118_3720174_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786353.1|3720247_3721312_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000884972.1|3721311_3721962_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422218.1|3722037_3723681_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
>prophage 270
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3732448	3733066	5406069		Bacillus_virus(100.0%)	1	NA	NA
WP_001301955.1|3732448_3733066_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.5e-12
>prophage 271
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3744763	3752411	5406069		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|3744763_3745771_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494181.1|3745909_3746194_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578056.1|3746318_3748079_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	8.4e-101
WP_001234850.1|3748227_3748923_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213385.1|3748950_3750141_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_000202795.1|3750473_3750818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194871.1|3750821_3752411_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	4.2e-19
>prophage 272
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3758165	3762476	5406069		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|3758165_3758732_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|3759144_3759858_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198815.1|3759896_3760883_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000188434.1|3761000_3762476_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.0e-43
>prophage 273
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3776964	3777822	5406069		Catovirus(100.0%)	1	NA	NA
WP_000873894.1|3776964_3777822_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 274
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3781890	3785664	5406069		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489254.1|3781890_3783870_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
WP_000425434.1|3783901_3784738_-	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
WP_001139613.1|3784995_3785664_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 275
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3789357	3790878	5406069		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255020.1|3789357_3790878_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 276
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3817361	3828121	5406069	transposase	Enterobacteria_phage(71.43%)	10	NA	NA
WP_000569336.1|3817361_3818288_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|3818292_3819024_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3819004_3819112_-	protein YohO	NA	NA	NA	NA	NA
WP_001240409.1|3819171_3819903_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	1.5e-112
WP_071782030.1|3820194_3821811_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.1e-293
WP_000598641.1|3821807_3822527_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3822573_3823044_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|3823085_3823547_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_085953806.1|3823730_3824943_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	8.4e-169
WP_001302810.1|3826984_3828121_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
>prophage 277
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3843698	3845732	5406069	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001301615.1|3843698_3845732_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 278
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3858601	3862158	5406069		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001301907.1|3858601_3859420_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|3859471_3860218_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|3860191_3861157_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|3861153_3862158_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
>prophage 279
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3871369	3877476	5406069	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000807362.1|3871369_3872269_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|3872674_3872992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|3873321_3874683_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001301848.1|3874830_3875163_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|3875353_3876076_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|3876072_3877476_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 280
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3890918	3892271	5406069		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469694.1|3890918_3892271_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	3.5e-06
>prophage 281
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3896989	3907852	5406069		Catovirus(16.67%)	10	NA	NA
WP_001295424.1|3896989_3897631_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234777.1|3897722_3898304_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001252349.1|3898325_3900179_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000687872.1|3900231_3900522_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_001227701.1|3900511_3900850_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_094364407.1|3900924_3902508_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|3903166_3904306_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000482901.1|3904311_3904755_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137171.1|3904757_3906920_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654503.1|3907012_3907852_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 282
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3913223	3918893	5406069		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_000089911.1|3913223_3914189_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.2e-87
WP_000479838.1|3914191_3914671_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699727.1|3914667_3915891_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079259.1|3915893_3917330_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.0	3.7e-46
WP_001302013.1|3917522_3918893_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.9	9.9e-33
>prophage 283
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3924509	3928193	5406069		Klebsiella_phage(33.33%)	3	NA	NA
WP_001116005.1|3924509_3925904_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.5	3.1e-18
WP_000999466.1|3926061_3927057_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183060.1|3927299_3928193_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
>prophage 284
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3932571	3945277	5406069		Tupanvirus(14.29%)	10	NA	NA
WP_000875215.1|3932571_3933666_+	GDP-perosamine synthase RfbE/PerA	NA	A0A2K9L470	Tupanvirus	34.7	5.3e-53
WP_000684824.1|3933690_3934905_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000169624.1|3934924_3936043_+	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	64.1	5.4e-130
WP_001301811.1|3936045_3937011_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	52.7	2.1e-90
WP_000478513.1|3937013_3937523_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001278239.1|3937504_3938953_+	Mannose-1-phosphate guanylyltransferase 2	NA	A0A1V0SH58	Hokovirus	33.3	5.2e-56
WP_000839208.1|3938956_3940327_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.1	5.8e-33
WP_001055391.1|3941589_3942255_+	GDP-perosamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000043478.1|3942455_3943862_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	6.2e-38
WP_000704871.1|3944110_3945277_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.4	2.7e-111
>prophage 285
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3952630	3953530	5406069		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131775.1|3952630_3953530_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 286
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3960732	3961899	5406069		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001303036.1|3960732_3961899_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
>prophage 287
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3966241	3968399	5406069		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692323.1|3966241_3966463_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|3966525_3967002_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|3967016_3967496_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|3967577_3968399_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
>prophage 288
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	3972698	4045098	5406069	tail,head,terminase,portal,integrase,transposase,holin	Enterobacteria_phage(31.91%)	69	3972205:3972220	4029286:4029301
3972205:3972220	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_085952406.1|3972698_3973912_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	1.8e-163
WP_000966626.1|3974283_3976431_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|3977878_3979417_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3979466_3979814_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3979810_3980191_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|3980552_3981098_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|3981094_3981838_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|3981849_3982929_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|3982990_3983926_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|3984382_3985300_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|3985401_3986352_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|3988738_3989455_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|3989797_3991252_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|3991353_3992670_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|3992983_3994036_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001302302.1|4002770_4003568_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|4003803_4004826_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|4004825_4005029_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|4005087_4007559_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|4007654_4007843_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|4007839_4008028_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|4008508_4008661_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|4008935_4009580_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|4009677_4009905_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|4009901_4010327_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|4010395_4011433_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|4011464_4011887_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|4011921_4012620_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|4012641_4012866_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001414276.1|4013252_4013405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|4013401_4013713_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|4013839_4014403_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|4014512_4014617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|4014803_4015016_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|4015183_4015462_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|4015463_4016513_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|4016525_4016885_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|4016881_4017571_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|4018204_4018633_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|4019110_4020961_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|4021042_4022256_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|4022575_4022782_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|4022786_4023131_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|4023181_4023715_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|4023870_4024053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|4024065_4024197_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|4024424_4024610_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|4025136_4025451_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|4025532_4025757_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|4026151_4026661_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|4026632_4028561_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|4028544_4028751_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|4028747_4030340_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
4029286:4029301	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|4030329_4031835_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|4031871_4032219_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|4032276_4032543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|4032524_4033265_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|4033278_4033710_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|4033736_4034150_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082450.1|4034130_4036710_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000847298.1|4036706_4037036_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|4037035_4037734_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|4037744_4038488_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_127446151.1|4038433_4039063_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_077890814.1|4039303_4040479_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	99.7	1.5e-234
WP_115801853.1|4040430_4042782_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|4042849_4043449_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268861.1|4043513_4044827_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|4044828_4045098_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 289
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4048351	4048882	5406069		Escherichia_phage(100.0%)	1	NA	NA
WP_001079078.1|4048351_4048882_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
>prophage 290
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4052425	4054455	5406069		Bacillus_phage(50.0%)	2	NA	NA
WP_001339045.1|4052425_4053097_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826732.1|4053096_4054455_+	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	8.7e-05
>prophage 291
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4058162	4064919	5406069		Burkholderia_phage(50.0%)	7	NA	NA
WP_000365585.1|4058162_4058858_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
WP_001157239.1|4058924_4060343_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786000.1|4060323_4060794_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001212226.1|4060782_4061703_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922685.1|4061875_4062793_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|4062871_4063054_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001302088.1|4063224_4064919_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 292
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4082777	4083446	5406069		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334610.1|4082777_4083446_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	3.3e-82
>prophage 293
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4095703	4096456	5406069		Bacillus_virus(100.0%)	1	NA	NA
WP_001273005.1|4095703_4096456_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 294
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4102643	4123974	5406069	tail,integrase,transposase	Enterobacteria_phage(76.0%)	30	4117110:4117123	4127116:4127129
WP_085952771.1|4102643_4103857_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	99.7	1.1e-168
WP_157677777.1|4103855_4104050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032161728.1|4103991_4105125_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
WP_000132765.1|4105075_4105399_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|4105556_4106741_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|4106740_4107253_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|4107307_4107673_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|4107708_4107837_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000979955.1|4110639_4111128_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|4111284_4111857_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000257965.1|4111900_4112317_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000211280.1|4113522_4113837_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686531.1|4113841_4114801_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000123463.1|4114877_4117700_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
4117110:4117123	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|4117706_4118072_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000775057.1|4118144_4118375_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000104305.1|4118697_4118997_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|4118993_4119260_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|4119256_4119460_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|4119483_4119900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|4119992_4120106_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|4120102_4120345_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|4120356_4120635_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|4120645_4120996_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|4121017_4121221_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|4121292_4121430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|4121519_4121924_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|4121939_4122590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|4122619_4122967_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|4122972_4123974_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
4127116:4127129	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 295
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4130880	4132395	5406069		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|4130880_4132395_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 296
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4142480	4148124	5406069		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001302081.1|4142480_4144142_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000483251.1|4144187_4145789_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_000204340.1|4145807_4146668_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036370.1|4146670_4147720_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|4147734_4148124_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 297
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4153376	4155110	5406069	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025318.1|4153376_4155110_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
>prophage 298
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4161726	4163777	5406069		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|4161726_4162470_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|4162510_4162906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639267.1|4162958_4163777_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.9e-71
>prophage 299
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4167795	4174958	5406069		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|4167795_4168317_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024949.1|4168318_4168921_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_010723105.1|4168991_4169057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|4169195_4169807_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|4169815_4170826_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571476.1|4171071_4171857_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|4171853_4172609_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001303192.1|4172687_4173620_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|4173635_4174958_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 300
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4178956	4180432	5406069		Cyanophage(100.0%)	1	NA	NA
WP_000301737.1|4178956_4180432_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 301
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4189932	4192958	5406069		Pectobacterium_phage(50.0%)	5	NA	NA
WP_000916763.1|4189932_4190163_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168751.1|4190301_4190676_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879314.1|4190679_4191552_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976483.1|4191564_4191906_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812736.1|4192301_4192958_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
>prophage 302
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4200455	4202504	5406069		Moraxella_phage(100.0%)	1	NA	NA
WP_001055778.1|4200455_4202504_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
>prophage 303
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4207836	4208046	5406069		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4207836_4208046_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 304
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4213687	4215244	5406069		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|4213687_4215244_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 305
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4219106	4227212	5406069	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854987.1|4219106_4220468_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
WP_000457334.1|4220541_4220721_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|4220840_4221200_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|4221561_4221906_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|4222037_4223948_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220997.1|4224005_4224701_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290570.1|4224740_4225322_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001302040.1|4225526_4227212_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	2.6e-35
>prophage 306
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4241965	4246542	5406069		Bacillus_phage(100.0%)	3	NA	NA
WP_000766134.1|4241965_4243456_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
WP_024165563.1|4243636_4245112_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|4245258_4246542_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 307
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4249860	4250715	5406069		Indivirus(100.0%)	1	NA	NA
WP_001186359.1|4249860_4250715_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.3	4.3e-10
>prophage 308
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4262957	4263599	5406069		Tupanvirus(100.0%)	1	NA	NA
WP_001135075.1|4262957_4263599_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 309
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4269316	4271278	5406069		Streptococcus_phage(100.0%)	1	NA	NA
WP_094364412.1|4269316_4271278_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	7.0e-40
>prophage 310
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4276876	4277530	5406069		Planktothrix_phage(100.0%)	1	NA	NA
WP_001302822.1|4276876_4277530_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.7	8.4e-14
>prophage 311
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4284294	4285515	5406069		Klosneuvirus(100.0%)	1	NA	NA
WP_000082019.1|4284294_4285515_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	5.5e-27
>prophage 312
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4292991	4293819	5406069		Bacillus_virus(100.0%)	1	NA	NA
WP_000175032.1|4292991_4293819_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 313
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4299948	4302210	5406069		Tupanvirus(100.0%)	1	NA	NA
WP_000082743.1|4299948_4302210_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 314
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4313506	4333099	5406069	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144201.1|4313506_4315435_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	9.4e-130
WP_001700733.1|4315438_4315981_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|4316077_4316275_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|4316327_4316684_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|4316806_4316851_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000018588.1|4317133_4318117_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672328.1|4318131_4320519_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|4320523_4320823_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956513.1|4320923_4321904_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154193.1|4321966_4322518_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029456.1|4322517_4323267_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.1e-08
WP_001209780.1|4323344_4323809_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001302301.1|4324055_4324769_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175641.1|4324831_4326268_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|4326271_4326463_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082219.1|4326594_4327641_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	2.5e-84
WP_000368046.1|4327797_4328631_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069325.1|4328963_4331342_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.8	1.9e-172
WP_000553648.1|4331398_4333099_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	4.7e-32
>prophage 315
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4351692	4356776	5406069		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367171.1|4351692_4352061_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
WP_001302084.1|4352069_4353557_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948872.1|4353566_4354313_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_000907999.1|4354287_4355559_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144581.1|4355555_4356776_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	1.7e-92
>prophage 316
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4365065	4367332	5406069		Escherichia_phage(50.0%)	3	NA	NA
WP_001412436.1|4365065_4365734_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.5	1.3e-22
WP_001069991.1|4365730_4366516_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587574.1|4366519_4367332_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	6.5e-08
>prophage 317
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4372836	4381628	5406069		Orpheovirus(20.0%)	9	NA	NA
WP_000493949.1|4372836_4373478_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098902.1|4373517_4374666_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	7.2e-85
WP_001182346.1|4374956_4376168_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|4376280_4377213_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|4377209_4378235_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|4378533_4378623_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701046.1|4378788_4379958_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|4380103_4380685_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101203.1|4380812_4381628_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 318
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4390432	4391931	5406069		Indivirus(50.0%)	2	NA	NA
WP_000250655.1|4390432_4391221_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.1e-07
WP_001296937.1|4391409_4391931_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 319
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4398841	4400116	5406069	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|4398841_4400116_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 320
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4431806	4433108	5406069		Bacillus_phage(100.0%)	1	NA	NA
WP_000732491.1|4431806_4433108_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	3.2e-17
>prophage 321
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4443208	4585580	5406069	tail,transposase,head,terminase,integrase,portal,protease,holin,capsid,tRNA,lysis	Enterobacteria_phage(32.43%)	171	4451459:4451474	4547217:4547232
WP_001260835.1|4443208_4444030_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4444129_4444213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|4444305_4444641_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|4445037_4446291_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|4446397_4447291_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|4447425_4448646_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|4448770_4449466_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|4449418_4450711_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|4450868_4451483_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
4451459:4451474	attL	TATCTTGCTGTGAAAA	NA	NA	NA	NA
WP_000526515.1|4451525_4452380_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|4452381_4452999_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|4453009_4455433_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|4455493_4457920_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|4458118_4458424_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|4458531_4459242_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|4459244_4459805_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|4459839_4460181_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|4460315_4460642_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000546375.1|4460814_4460940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|4461630_4461867_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048458.1|4461954_4464426_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|4464518_4464710_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4464706_4464895_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|4465295_4465460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|4465463_4465682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|4465753_4466053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|4466405_4466684_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|4466685_4466877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|4466897_4467269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|4467366_4467669_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|4467665_4468091_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|4468113_4469076_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|4469082_4469823_+	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|4470633_4471029_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|4471085_4471670_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|4471785_4471890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|4472078_4472291_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|4472458_4472737_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|4472738_4473788_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_094364418.1|4473800_4474166_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	3.0e-37
WP_000216629.1|4475608_4475776_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_094364420.1|4476090_4478028_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.6	1.6e-291
WP_001213059.1|4478175_4478358_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|4478395_4478665_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|4478740_4478956_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|4478960_4479305_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|4479355_4479889_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|4480159_4480729_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|4480728_4480875_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|4481102_4481309_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|4481373_4481598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|4481954_4482095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|4482224_4482410_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|4482451_4482817_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|4483106_4483670_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|4483666_4485328_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|4485391_4487329_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|4487373_4487595_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|4487540_4490042_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|4490121_4490448_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|4490457_4490808_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|4490804_4491251_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4491247_4491592_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275506.1|4491650_4492367_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_001030063.1|4492372_4492747_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|4492842_4493052_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_094364422.1|4493104_4496347_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_000807950.1|4496339_4496681_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001179478.1|4496680_4497379_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000170104.1|4497395_4497650_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|4497759_4497870_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|4498172_4499051_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|4499104_4499842_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|4499787_4500024_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|4500036_4500126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|4500145_4502494_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|4503084_4506486_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|4508589_4508715_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|4508794_4509070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|4509130_4510492_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|4510855_4511719_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4511702_4512839_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|4513088_4514315_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|4514363_4515485_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085257.1|4515733_4516963_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_000953272.1|4517327_4517516_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_001304194.1|4517573_4518317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|4518342_4518540_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|4518532_4518718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|4518717_4518909_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000794515.1|4518898_4519141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770148.1|4519146_4519446_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761781.1|4519442_4521575_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000198852.1|4521945_4522197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126692.1|4522193_4522604_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233299.1|4522614_4522887_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|4523011_4523236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137345.1|4523528_4524686_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504050.1|4524725_4525298_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_000171117.1|4525335_4526511_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	2.4e-184
WP_001020660.1|4526507_4526846_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000134113.1|4526842_4527139_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145903.1|4527138_4527579_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000113645.1|4527868_4528225_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127893.1|4528208_4529870_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000133425.1|4529883_4530165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|4531021_4532482_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|4532481_4533153_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|4533321_4534692_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|4534695_4535337_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|4535372_4536479_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4536532_4536994_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|4537003_4537657_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|4537828_4539079_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|4539192_4540335_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|4540324_4540561_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|4540664_4541489_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|4541485_4542187_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|4542183_4542486_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|4542553_4542886_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|4542950_4543073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|4543130_4544657_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|4545158_4545614_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|4545613_4545784_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|4545776_4546067_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|4546063_4546426_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|4546422_4546563_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|4546559_4547249_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
4547217:4547232	attR	TTTTCACAGCAAGATA	NA	NA	NA	NA
WP_000544528.1|4547570_4547876_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|4547862_4548339_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|4548555_4548738_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|4548828_4549122_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|4549413_4549824_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|4550109_4550316_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|4550480_4550675_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|4551063_4551609_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|4551583_4553509_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|4553505_4553712_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|4553708_4555310_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|4555290_4556610_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|4556619_4556952_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|4557007_4558033_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|4558074_4558473_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|4558484_4558838_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|4558849_4559428_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|4559424_4559820_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|4559827_4560568_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|4560583_4561006_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|4560987_4561422_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|4561414_4563964_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|4563960_4564290_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|4564289_4564988_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|4564993_4565737_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|4565673_4566306_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|4566366_4569765_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230340.1|4569831_4570431_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000268883.1|4570495_4573411_+	membrane protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_000885629.1|4573410_4573992_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000488340.1|4574111_4575002_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|4575020_4575527_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|4575563_4576064_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|4576142_4576325_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|4576822_4577491_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|4577547_4577796_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|4577871_4578252_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4578248_4578596_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998081.1|4578645_4580184_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001226373.1|4580486_4581971_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|4582157_4583111_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|4583609_4584194_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|4584367_4585580_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 322
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4593233	4593653	5406069		Morganella_phage(100.0%)	1	NA	NA
WP_000897378.1|4593233_4593653_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 323
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4611205	4611964	5406069		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173324.1|4611205_4611964_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
>prophage 324
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4624669	4627421	5406069		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|4624669_4626349_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|4626473_4627421_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 325
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4630557	4637355	5406069		Pseudomonas_phage(33.33%)	9	NA	NA
WP_000804726.1|4630557_4631640_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456466.1|4631639_4632473_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200379.1|4632469_4632862_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|4632865_4633675_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811067.1|4633710_4634565_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.3	1.1e-45
WP_000170954.1|4634712_4634820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170963.1|4635248_4635356_-	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
WP_094364424.1|4635754_4636855_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|4637124_4637355_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 326
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4648490	4658852	5406069		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|4648490_4650029_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571681.1|4650025_4650736_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|4650735_4651413_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555853.1|4652490_4653333_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	3.7e-14
WP_001362540.1|4653382_4653841_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|4653953_4654859_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|4654950_4655964_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|4656165_4657074_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|4657217_4657631_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|4658234_4658852_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 327
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4667261	4669276	5406069		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110954.1|4667261_4668275_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|4668271_4669276_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 328
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4677212	4756443	5406069	tail,transposase,head,protease,terminase,integrase,portal,capsid,holin	Stx2-converting_phage(38.6%)	87	4677049:4677076	4737651:4737678
4677049:4677076	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|4677212_4678343_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|4678320_4678569_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|4678633_4681105_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|4681197_4681389_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4681385_4681574_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122994727.1|4681910_4682054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|4682047_4682281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|4682258_4682666_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|4682688_4682907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|4682979_4683279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|4683542_4683950_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|4684026_4684254_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|4684237_4684789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|4684760_4685801_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|4685832_4686255_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|4686441_4687023_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|4687019_4687184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|4687882_4688641_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|4688919_4689132_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|4689352_4689610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|4689679_4689958_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|4689959_4691006_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|4691018_4691378_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|4691386_4691917_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|4692158_4692356_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|4692506_4693565_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|4694361_4696215_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|4696364_4696580_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|4696584_4696929_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|4696979_4697513_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|4697783_4698353_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|4698352_4698499_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|4698726_4698912_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|4699336_4699564_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|4699605_4699971_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|4700260_4700824_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|4700820_4702482_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|4702545_4704483_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|4704527_4704749_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_001304108.1|4704694_4707274_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_000125988.1|4707276_4707603_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|4707612_4707963_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|4707959_4708406_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|4708402_4708747_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|4708812_4709529_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|4709543_4709918_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|4710013_4710223_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_094364426.1|4710270_4713513_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	98.4	0.0e+00
WP_000807964.1|4713505_4713847_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152159.1|4713846_4714545_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000194763.1|4714555_4715299_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_064732755.1|4715244_4715877_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000649829.1|4716067_4716595_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_094364428.1|4716728_4720202_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.4	0.0e+00
WP_001228304.1|4720269_4720869_+	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|4721020_4722334_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|4722335_4722605_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|4723631_4724957_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|4726554_4726677_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|4726783_4727695_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|4727760_4728330_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|4729295_4730834_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4730883_4731231_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4731227_4731608_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|4731947_4732226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|4732653_4732800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|4732936_4733584_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|4733767_4734358_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|4737108_4737327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|4737828_4738335_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
4737651:4737678	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|4738380_4738881_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|4738966_4739146_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|4739526_4740333_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|4740332_4741526_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001302292.1|4741537_4742896_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000763520.1|4742899_4744495_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|4744494_4746057_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|4746148_4746193_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|4746330_4747212_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|4747208_4747829_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|4747856_4749440_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|4749652_4750525_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|4750564_4751155_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|4751151_4751910_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|4752129_4753179_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|4753214_4753466_-	YciN family protein	NA	NA	NA	NA	NA
WP_001295576.1|4753845_4756443_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 329
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4761367	4761958	5406069		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|4761367_4761958_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 330
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4769773	4771708	5406069		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485019.1|4769773_4771708_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	2.4e-32
>prophage 331
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4780636	4782658	5406069		Salmonella_phage(50.0%)	2	NA	NA
WP_000135022.1|4780636_4781800_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	6.2e-28
WP_000573412.1|4781851_4782658_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 332
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4795448	4796714	5406069		Klosneuvirus(100.0%)	1	NA	NA
WP_000069223.1|4795448_4796714_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	7.8e-24
>prophage 333
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4810725	4811808	5406069		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057976.1|4810725_4811808_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 334
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4829970	4830486	5406069		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945010.1|4829970_4830486_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.1	2.4e-24
>prophage 335
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4836812	4894531	5406069	tail,head,terminase,integrase,capsid,holin,tRNA	Escherichia_phage(42.19%)	70	4829329:4829344	4880509:4880524
4829329:4829344	attL	CACCGCTCATCAGACG	NA	NA	NA	NA
WP_000628061.1|4836812_4838045_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|4838299_4839283_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|4839557_4839728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|4839760_4841134_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|4841262_4842198_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|4842249_4843485_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|4843486_4843702_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|4843801_4843990_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|4844027_4844177_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|4844232_4845042_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|4845034_4847635_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|4847736_4848012_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|4848086_4848257_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|4848256_4848478_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|4848919_4849408_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|4849404_4849560_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|4849570_4849705_-	phage protein	NA	NA	NA	NA	NA
WP_000233319.1|4849992_4850412_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|4850491_4850746_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|4850742_4851165_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|4851242_4852031_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|4852037_4852784_+	replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|4852806_4853568_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|4853583_4854006_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|4854111_4854324_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|4854409_4854574_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|4854575_4854839_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|4854849_4855011_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|4855089_4855335_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|4855766_4856918_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|4856885_4857875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|4857874_4859266_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|4859765_4860365_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|4860364_4860655_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|4860651_4861206_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|4861767_4862199_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143079.1|4862773_4864627_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000284522.1|4864776_4864992_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|4864996_4865341_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992086.1|4865391_4865925_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000661712.1|4866198_4866894_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280923.1|4866988_4867120_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|4867342_4867528_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000828070.1|4867928_4868255_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|4868386_4868587_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|4868628_4868994_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_001411753.1|4869843_4871505_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173011.1|4871568_4873506_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063025.1|4873550_4873772_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|4876298_4876625_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007911.1|4876634_4876985_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|4876981_4877428_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|4877424_4877769_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275479.1|4877837_4878554_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_001030060.1|4878559_4878934_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|4879029_4879239_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212768.1|4879290_4882371_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
4880509:4880524	attR	CGTCTGATGAGCGGTG	NA	NA	NA	NA
WP_000807964.1|4882363_4882705_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152159.1|4882704_4883403_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000194763.1|4883413_4884157_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_064732755.1|4884102_4884735_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000649829.1|4884925_4885453_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515042.1|4885586_4889084_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_001230550.1|4889154_4889754_+	outer membrane protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000268955.1|4889818_4891132_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001023992.1|4891133_4891403_+|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_001131659.1|4891515_4892091_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|4892163_4892793_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|4892874_4893516_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|4894096_4894531_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 336
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4900744	4901734	5406069		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|4900744_4901734_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 337
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4920279	4924182	5406069		Klosneuvirus(100.0%)	1	NA	NA
WP_000139561.1|4920279_4924182_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 338
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4929799	4930748	5406069		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|4929799_4930330_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731827.1|4930574_4930748_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	5.8e-07
>prophage 339
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4943932	4950982	5406069		Phage_TP(25.0%)	7	NA	NA
WP_001303492.1|4943932_4945894_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000494244.1|4945985_4946216_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|4946437_4946614_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|4946659_4947076_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760654.1|4947154_4948561_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047432.1|4948805_4949951_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220402.1|4949968_4950982_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	1.3e-26
>prophage 340
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4958114	4960217	5406069		Salmonella_phage(100.0%)	1	NA	NA
WP_000706257.1|4958114_4960217_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	6.2e-135
>prophage 341
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4965126	4971504	5406069		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103276.1|4965126_4967235_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	1.4e-25
WP_000014822.1|4967301_4971504_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	2.2e-22
>prophage 342
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4977941	4979486	5406069		Escherichia_phage(100.0%)	1	NA	NA
WP_000702550.1|4977941_4979486_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 343
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4987747	4988848	5406069		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768382.1|4987747_4988848_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.4	5.3e-138
>prophage 344
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4995037	4996478	5406069		Escherichia_phage(50.0%)	2	NA	NA
WP_001302113.1|4995037_4995322_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	50.0	7.5e-20
WP_000642407.1|4995467_4996478_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 345
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	4999751	5001657	5406069		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285523.1|4999751_5000678_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	9.1e-14
WP_000193529.1|5000670_5001657_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-19
>prophage 346
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5008386	5009769	5406069		Bacillus_virus(100.0%)	1	NA	NA
WP_000426292.1|5008386_5009769_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 347
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5015047	5021983	5406069		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001449056.1|5015047_5017843_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.7e-18
WP_000832417.1|5017887_5020260_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000628537.1|5020297_5021983_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	1.3e-10
>prophage 348
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5037976	5039377	5406069		Escherichia_phage(100.0%)	1	NA	NA
WP_001083593.1|5037976_5039377_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.5	1.8e-106
>prophage 349
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5046807	5048343	5406069		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194917.1|5046807_5048343_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
>prophage 350
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5056214	5057633	5406069		Bacillus_phage(100.0%)	1	NA	NA
WP_000558061.1|5056214_5057633_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 351
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5065380	5065764	5406069		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|5065380_5065764_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 352
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5070249	5071140	5406069		Bacillus_phage(100.0%)	1	NA	NA
WP_000592852.1|5070249_5071140_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.4e-19
>prophage 353
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5076505	5177248	5406069	tail,transposase,head,terminase,integrase,portal,capsid,holin	Enterobacteria_phage(29.82%)	129	5139331:5139346	5181090:5181105
WP_000214712.1|5076505_5076709_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|5076744_5078205_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|5078293_5079577_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|5079636_5079951_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143808.1|5080112_5080754_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001356599.1|5080835_5081465_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|5081537_5082113_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023362.1|5082226_5082496_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|5082497_5083721_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|5083785_5084385_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_115801853.1|5084452_5086804_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_077890814.1|5086755_5087931_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	99.7	1.5e-234
WP_127446151.1|5088171_5088801_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_000194798.1|5088746_5089490_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001151105.1|5089500_5090199_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|5090198_5090528_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_094364433.1|5090524_5093137_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	92.8	0.0e+00
WP_000533440.1|5093117_5093531_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|5093557_5093980_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|5093993_5094746_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|5094753_5095149_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|5095145_5095679_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|5095693_5096047_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|5096058_5096457_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|5096498_5097524_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|5097579_5097912_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|5097921_5099241_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|5099221_5100823_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|5100819_5101026_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|5101022_5102948_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867493.1|5102922_5103468_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001303940.1|5103854_5104079_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|5104160_5104475_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|5105000_5105186_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|5105408_5105555_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|5105554_5106124_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|5106395_5106929_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|5106979_5107324_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|5107328_5107535_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|5107982_5109833_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|5110310_5110742_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|5111192_5111906_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|5112041_5112239_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|5112463_5113018_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|5113080_5113386_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|5113398_5114448_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|5114449_5114722_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|5114843_5115188_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|5115307_5115520_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|5115753_5116311_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|5116312_5116531_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|5116658_5116970_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|5116962_5117190_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|5117186_5117468_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|5117500_5118217_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|5118250_5118673_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001262402.1|5118704_5119748_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|5119816_5120242_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001416688.1|5120858_5121197_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|5121489_5121642_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|5121653_5122292_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|5122292_5122502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|5123066_5123255_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|5123251_5123440_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016241229.1|5125416_5125731_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|5126693_5127074_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|5127070_5127418_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|5127467_5129006_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|5129588_5130239_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001023362.1|5131638_5131908_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|5131909_5133133_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|5133197_5133797_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|5133864_5134080_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_038425866.1|5134082_5137343_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001152128.1|5137530_5137968_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|5137967_5138309_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_094364435.1|5138301_5141382_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.3	0.0e+00
5139331:5139346	attL	CAGTTCACCCAGCGCT	NA	NA	NA	NA
WP_001453698.1|5141434_5141644_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|5141739_5142114_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275506.1|5142119_5142836_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	5.0e-129
WP_000133388.1|5142894_5143239_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|5143235_5143682_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|5143678_5144029_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|5144038_5144365_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|5144444_5146946_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|5146891_5147113_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|5147157_5149095_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|5149158_5150820_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_024257547.1|5150816_5151380_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	98.4	2.0e-88
WP_000279786.1|5151669_5152035_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|5152076_5152304_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|5152728_5152914_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|5153141_5153288_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|5153287_5153857_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|5154127_5154661_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|5154711_5155056_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|5155060_5155267_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023202.1|5155715_5157566_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|5158044_5158473_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|5159110_5159800_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|5159796_5160156_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|5160168_5161218_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001341388.1|5161219_5161498_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|5161665_5161878_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|5162066_5162171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|5162286_5162874_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|5162876_5163068_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|5163069_5163507_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|5163493_5163811_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|5163764_5164082_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|5164071_5164374_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_000017339.1|5164370_5164688_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_000451012.1|5164684_5165401_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_001301518.1|5165434_5165857_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_001262323.1|5165888_5166926_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|5166994_5167420_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|5167403_5167727_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|5167851_5168328_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|5168643_5168796_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|5168910_5169426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|5169558_5169948_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|5170009_5170279_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|5170247_5171366_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|5171532_5172327_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|5172323_5173370_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|5173525_5174347_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291263.1|5174362_5175274_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251367.1|5175302_5176547_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033699.1|5176546_5177248_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
5181090:5181105	attR	AGCGCTGGGTGAACTG	NA	NA	NA	NA
>prophage 354
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5184537	5184795	5406069		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|5184537_5184795_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 355
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5197142	5198785	5406069		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267941.1|5197142_5198147_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001256997.1|5198143_5198785_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.6	3.4e-28
>prophage 356
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5202057	5203239	5406069		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|5202057_5202294_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008537.1|5202504_5203239_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.7e-15
>prophage 357
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5215584	5216526	5406069		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001301817.1|5215584_5216526_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 358
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5232372	5232618	5406069		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|5232372_5232618_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 359
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5237280	5238201	5406069		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|5237280_5238201_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 360
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5247508	5248042	5406069		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|5247508_5248042_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 361
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5252179	5253013	5406069		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|5252179_5253013_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 362
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5259030	5261201	5406069		Klebsiella_phage(33.33%)	4	NA	NA
WP_001220314.1|5259030_5259252_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_001186738.1|5259314_5259791_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214398.1|5259806_5260292_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
WP_001234682.1|5260382_5261201_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.0e-45
>prophage 363
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5270908	5275202	5406069		Enterobacteria_phage(33.33%)	5	NA	NA
WP_000422760.1|5270908_5271334_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
WP_001333354.1|5272333_5272978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226520.1|5272998_5273268_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000502842.1|5273346_5273985_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_001285506.1|5273969_5275202_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	5.0e-60
>prophage 364
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5279850	5281063	5406069	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085952771.1|5279850_5281063_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	99.7	1.1e-168
>prophage 365
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5292543	5304886	5406069	protease	Acinetobacter_phage(42.86%)	11	NA	NA
WP_001223350.1|5292543_5294634_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000301248.1|5295955_5296531_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|5296599_5297178_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|5297226_5298267_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|5298289_5298745_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|5298767_5299925_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|5299924_5300506_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|5300828_5301887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|5301896_5303039_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|5303031_5303805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|5303806_5304886_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
>prophage 366
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5309406	5311823	5406069	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_000088522.1|5309406_5311020_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|5311050_5311401_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|5311397_5311823_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
>prophage 367
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5315703	5315844	5406069		Escherichia_phage(100.0%)	1	NA	NA
WP_001135715.1|5315703_5315844_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
>prophage 368
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5328762	5331075	5406069	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001171540.1|5328762_5329143_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|5329139_5329487_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998081.1|5329536_5331075_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
>prophage 369
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5341171	5342374	5406069	integrase	Pseudomonas_phage(100.0%)	1	5330289:5330304	5348190:5348205
5330289:5330304	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
WP_000279869.1|5341171_5342374_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000279869.1|5341171_5342374_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
5348190:5348205	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
>prophage 370
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5348811	5349519	5406069		Planktothrix_phage(100.0%)	1	NA	NA
WP_001192027.1|5348811_5349519_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.9e-35
>prophage 371
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5359257	5363070	5406069		Moraxella_phage(100.0%)	1	NA	NA
WP_001240839.1|5359257_5363070_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.7	8.1e-24
>prophage 372
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5371230	5372013	5406069		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000010422.1|5371230_5372013_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.4	8.5e-13
>prophage 373
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5375818	5377177	5406069		Bacillus_phage(100.0%)	1	NA	NA
WP_000409847.1|5375818_5377177_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	5.6e-20
>prophage 374
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5383996	5385061	5406069		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|5383996_5385061_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 375
NZ_CP022689	Escherichia coli strain CDC#03-98 chromosome, complete genome	5406069	5401829	5406016	5406069		Enterobacteria_phage(60.0%)	5	NA	NA
WP_001028088.1|5401829_5402324_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|5402344_5403673_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|5403755_5403863_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_094364438.1|5404852_5405137_+	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	89.4	2.6e-44
WP_000211519.1|5405386_5406016_+	phage antirepressor Ant	NA	A0A0P0ZCA2	Stx2-converting_phage	86.6	4.5e-97
>prophage 1
NZ_CP022688	Escherichia coli strain CDC#03-98 plasmid p0157, complete sequence	92032	36156	44232	92032	integrase	Macacine_betaherpesvirus(66.67%)	6	32291:32304	46422:46435
32291:32304	attL	GCAAGGGAAGCCGC	NA	NA	NA	NA
WP_000138832.1|36156_37881_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
WP_000817031.1|39180_40152_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|40151_41318_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_094364363.1|41905_42160_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	98.8	3.4e-40
WP_077631973.1|42667_42748_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_000016989.1|43425_44232_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
46422:46435	attR	GCAAGGGAAGCCGC	NA	NA	NA	NA
