The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022573	Klebsiella pneumoniae strain BIC-1 chromosome, complete genome	5394314	30299	41186	5394314		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|30299_33407_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|33461_34727_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|34757_35846_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|35932_36193_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|36490_37351_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|37371_38133_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|38393_39296_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|39307_40573_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|40565_41186_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
NZ_CP022573	Klebsiella pneumoniae strain BIC-1 chromosome, complete genome	5394314	268682	308454	5394314	terminase,transposase,integrase	uncultured_Caudovirales_phage(35.42%)	57	299567:299581	305576:305590
WP_004152576.1|268682_269549_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|269548_270322_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|270318_271515_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|271514_271868_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|271869_272523_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|272576_273143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|273185_273368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|273417_273759_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|273758_274781_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|274783_275086_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|275086_275686_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|275685_277689_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|277678_277831_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|277866_278292_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|278618_279810_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|279751_280042_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|280052_281198_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|281201_281642_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|281736_282123_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|282122_282629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|282625_283045_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|283013_283295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|283334_284276_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|284287_284782_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|284785_285988_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|286039_286588_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|286643_288095_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|288332_289733_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|289683_290436_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|290537_290858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|291092_291482_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|291478_292009_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|292011_292260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|292665_293448_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|293444_293921_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|293917_294880_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|294881_296540_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|297116_297338_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|297435_298104_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|298274_298589_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|298581_298770_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|298939_299305_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|299297_299552_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|299523_299742_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
299567:299581	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|299738_300164_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|300160_300355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|300351_301179_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|301283_301802_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|301807_302518_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|302507_302732_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|302728_302941_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|302937_303417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|303595_303838_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|303818_305000_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|305196_305745_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
305576:305590	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|305943_307476_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|307692_308454_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 3
NZ_CP022573	Klebsiella pneumoniae strain BIC-1 chromosome, complete genome	5394314	341387	401504	5394314	integrase,terminase,tail,transposase,holin	Enterobacteria_phage(20.0%)	69	341169:341184	398810:398825
341169:341184	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|341387_342059_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|342245_343073_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|343148_344414_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|344415_344835_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|344914_346399_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|347296_347719_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|348311_349016_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152703.1|349264_351208_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|351449_352049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|352273_353005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644627.1|353008_355963_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152652.1|356039_359108_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|359104_359485_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|359494_359977_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|360157_360622_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152648.1|360936_361272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|361462_362443_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004217331.1|362555_365453_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|365714_365906_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|366130_366487_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|366563_366770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|366907_367390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|367443_368616_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|368639_369032_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|369028_369580_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|369581_369965_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|369951_370185_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|370194_370449_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|370450_370846_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004190653.1|371167_372121_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|372131_372917_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_019405022.1|373447_374560_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|374543_375944_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|375943_377251_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|377228_378233_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|379095_379341_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|380299_380575_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|380571_380916_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|380912_381452_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|381448_381748_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|382226_383273_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|383498_384188_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|384187_384328_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|384324_384963_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|384955_385624_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|385620_385788_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|385768_386236_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|386756_387785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|387992_388238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|388293_388596_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|388592_389441_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|389437_390298_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|390383_390605_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|390645_390873_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|390984_391683_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|391705_391825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|391970_393047_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|393128_393332_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|393760_393955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|394043_394328_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|394343_395189_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|395185_395473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|395474_396155_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|396151_396580_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|396576_397239_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|397446_398634_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|398810_399701_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
398810:398825	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|399700_400693_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|400694_401504_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 4
NZ_CP022573	Klebsiella pneumoniae strain BIC-1 chromosome, complete genome	5394314	777798	870749	5394314	integrase,tRNA,head,capsid,terminase,tail,protease,plate,portal,lysis	Salmonella_phage(56.9%)	93	833324:833342	870824:870842
WP_002898139.1|777798_779091_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|779181_780525_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|780533_781145_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|781267_785521_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|785656_786151_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|786656_787652_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|787766_789533_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|789533_791255_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|791299_792001_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|792354_792573_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|792693_794973_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|795003_795321_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|795646_795868_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|795944_797885_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|797881_798997_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|799143_800802_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|801221_801917_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|802032_802932_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|803075_804728_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|804738_805707_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|805918_806353_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|806504_808223_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|808261_809263_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|809273_810716_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|810803_811817_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|811813_812644_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|812675_813815_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|814692_815208_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|815434_816163_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|816183_816915_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|816921_817638_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|817637_818306_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|818489_819221_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|819263_820736_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|820732_821449_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|821527_822655_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|822696_823185_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|823242_824088_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|824084_825038_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|825048_826182_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|826345_827458_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|827806_828286_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|828374_829277_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|830098_830386_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|830588_830852_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|830858_831242_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|831508_833194_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
833324:833342	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|833413_833632_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|833723_834824_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|834820_835306_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|835302_837930_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|837922_838042_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|838056_838356_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|838408_838924_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|838933_840106_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|840244_841321_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|841350_841554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|841550_842282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|842285_845237_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|845238_845838_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|845830_846739_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|846725_847088_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|847084_847657_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|847751_848444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|848440_848887_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|848879_849311_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|849406_849835_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|849831_850215_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|850219_850729_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|850709_850925_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|850928_851132_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|851131_851596_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|851691_852342_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|852345_853404_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|853420_854254_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|854396_856163_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|856162_857188_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|857249_858992_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|859267_859945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|860059_860293_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|860303_860492_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|860645_863060_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|863056_863914_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|863910_864138_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|864137_864371_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|864438_864780_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|864743_864944_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|864951_865461_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|865493_865715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|865860_866739_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|866750_867695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|867793_869278_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|869696_870749_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
870824:870842	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 5
NZ_CP022573	Klebsiella pneumoniae strain BIC-1 chromosome, complete genome	5394314	1317059	1362334	5394314	tRNA,head,lysis,integrase	Escherichia_phage(26.42%)	63	1310272:1310318	1359406:1359452
1310272:1310318	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|1317059_1319537_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|1319523_1319919_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|1319915_1320386_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004165520.1|1320385_1320805_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004151253.1|1320904_1324351_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|1324443_1324947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|1325074_1325860_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|1325925_1326639_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|1326628_1326799_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|1326898_1327258_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|1327274_1327745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|1328038_1328293_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|1328295_1329051_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|1329226_1329904_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|1329956_1330709_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|1330777_1331170_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|1331166_1331592_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|1331594_1331957_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|1331956_1332130_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|1332129_1332510_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|1332512_1332752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|1332762_1333857_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|1333868_1334297_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|1334300_1335686_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|1335758_1336235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|1336276_1337281_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|1337255_1338677_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|1338689_1340162_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|1340161_1340764_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|1341134_1341464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|1341569_1342034_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|1342030_1342561_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|1342563_1342812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151283.1|1343721_1344411_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|1344407_1344938_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|1344930_1345068_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|1345064_1345700_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|1345692_1345863_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|1345862_1346318_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|1346818_1347466_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|1347638_1348481_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|1348587_1349094_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|1349090_1349384_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151296.1|1349383_1350814_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151297.1|1350803_1351703_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_001548453.1|1351927_1352149_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|1352189_1352423_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|1352550_1353240_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|1353590_1353806_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151303.1|1353905_1354100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|1354188_1354473_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|1354488_1355334_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|1355330_1356011_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|1356007_1356166_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|1356162_1356819_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|1356815_1357583_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|1357579_1357798_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|1357799_1358015_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|1358016_1358352_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151318.1|1358228_1359392_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|1359822_1360689_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1359406:1359452	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|1360690_1360903_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|1360948_1362334_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 6
NZ_CP022573	Klebsiella pneumoniae strain BIC-1 chromosome, complete genome	5394314	1571871	1583525	5394314	integrase	Enterobacteria_phage(70.0%)	13	1572321:1572335	1595378:1595392
WP_004144574.1|1571871_1572975_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1572321:1572335	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|1572985_1574239_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|1574591_1575782_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|1575769_1576720_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|1576719_1577145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|1577713_1578280_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|1578297_1578543_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|1578539_1579277_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|1579818_1580085_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|1580081_1580639_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|1580635_1580863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|1580859_1581180_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|1581191_1583525_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
1595378:1595392	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 7
NZ_CP022573	Klebsiella pneumoniae strain BIC-1 chromosome, complete genome	5394314	3129087	3162344	5394314	integrase,tRNA,head,capsid,terminase,tail,protease,portal	uncultured_Caudovirales_phage(73.33%)	33	3146694:3146711	3162689:3162706
WP_002919147.1|3129087_3130035_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|3130049_3130559_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|3130687_3131812_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|3131783_3132257_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|3132282_3132825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|3132829_3133402_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|3133405_3134224_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|3134220_3134478_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|3134453_3135008_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|3140802_3141024_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|3141317_3144428_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|3144440_3145580_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|3145958_3146609_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
3146694:3146711	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|3146884_3148111_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|3148203_3149145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|3149326_3149611_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|3149621_3150401_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|3150852_3151122_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|3151114_3151303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|3151295_3151610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|3151606_3151975_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|3151971_3152337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|3152336_3154472_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|3154814_3155150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|3155198_3155711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|3155974_3157141_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|3157192_3157753_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|3157754_3158996_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|3158992_3159328_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|3159324_3159624_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|3159623_3160067_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|3160342_3160699_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|3160682_3162344_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
3162689:3162706	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 8
NZ_CP022573	Klebsiella pneumoniae strain BIC-1 chromosome, complete genome	5394314	4025672	4079137	5394314	integrase,tRNA,capsid,terminase,tail,holin	Salmonella_phage(38.78%)	63	4009790:4009806	4065835:4065851
4009790:4009806	attL	GCCGGTCCTGCTGGCGC	NA	NA	NA	NA
WP_004149335.1|4025672_4026947_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913890.1|4026981_4027602_+	YfgM family protein	NA	NA	NA	NA	NA
WP_002913889.1|4027612_4028791_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_002913888.1|4028904_4030383_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_004151982.1|4030500_4031580_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004144303.1|4031629_4031848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151981.1|4031831_4033223_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004151980.1|4033381_4034848_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|4034915_4036493_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004243821.1|4036684_4037935_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	1.8e-206
WP_004243823.1|4037951_4038143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243826.1|4038139_4038733_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	2.1e-109
WP_004243831.1|4038729_4039479_-	hypothetical protein	NA	R9VWB9	Serratia_phage	56.1	3.1e-73
WP_004243833.1|4039475_4039634_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.4	2.5e-17
WP_004243834.1|4039626_4039920_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	1.2e-31
WP_004144294.1|4040029_4040278_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_004243835.1|4040326_4041208_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.3	1.7e-131
WP_004243836.1|4041204_4042026_-	exonuclease VIII/RecE-like protein	NA	A0A193GYK2	Enterobacter_phage	80.2	8.1e-131
WP_004243838.1|4042022_4042322_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	53.5	1.8e-19
WP_042651015.1|4042329_4043232_-	hypothetical protein	NA	A0A059VK18	Pseudomonas_phage	51.6	2.8e-36
WP_004152539.1|4043644_4044226_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|4044379_4044613_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|4044759_4044969_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|4044968_4045736_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152535.1|4045732_4046518_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|4046637_4046985_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|4047177_4047588_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|4047571_4047763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|4047759_4048185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|4048181_4048925_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004141386.1|4049095_4049308_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|4049304_4049973_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|4049965_4050205_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|4050204_4050543_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|4050617_4050875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|4050952_4051537_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_020314691.1|4051533_4053009_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.7	3.2e-279
WP_004152473.1|4053052_4053574_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004152472.1|4054279_4054483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|4054486_4056166_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|4056162_4056468_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|4056749_4057148_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004152467.1|4057160_4058168_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_004152466.1|4058177_4058570_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|4058562_4058841_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_032422382.1|4058889_4059501_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_032422381.1|4059500_4061978_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.4	2.3e-266
WP_039100450.1|4061979_4062450_+	hypothetical protein	NA	Q858G2	Salmonella_phage	54.6	3.3e-44
WP_032422379.1|4062442_4062940_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	43.6	3.0e-24
WP_032422377.1|4062952_4065451_+	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	61.2	6.4e-288
WP_032422376.1|4065447_4067253_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	72.4	2.2e-234
4065835:4065851	attR	GCCGGTCCTGCTGGCGC	NA	NA	NA	NA
WP_032422375.1|4067256_4069731_+	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	87.0	0.0e+00
WP_032422374.1|4069929_4070226_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	92.7	4.4e-47
WP_004152457.1|4070502_4070901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152456.1|4070905_4071088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039100451.1|4071278_4071968_-	anti-repressor protein	NA	G9L6E2	Escherichia_phage	65.2	2.7e-79
WP_009485391.1|4072282_4072579_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	8.1e-25
WP_020326882.1|4072730_4074992_+|tail	phage T7 tail fiber protein	tail	A0A0A8J9V7	Klebsiella_phage	35.8	3.7e-69
WP_004146394.1|4075254_4075659_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_002913854.1|4075645_4075951_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	1.6e-39
WP_002913853.1|4075940_4076570_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_002913851.1|4076566_4077049_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	2.8e-59
WP_004152009.1|4077268_4079137_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 9
NZ_CP022573	Klebsiella pneumoniae strain BIC-1 chromosome, complete genome	5394314	4407861	4414768	5394314	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|4407861_4408725_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|4408735_4409509_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_002912636.1|4409751_4410645_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|4410890_4412252_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|4412570_4413293_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|4413289_4414768_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 10
NZ_CP022573	Klebsiella pneumoniae strain BIC-1 chromosome, complete genome	5394314	4703274	4759915	5394314	plate,transposase,protease	Staphylococcus_phage(15.38%)	51	NA	NA
WP_002910830.1|4703274_4704021_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_004199384.1|4704432_4705446_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|4705438_4706239_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|4706225_4706399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|4707016_4707958_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|4708051_4709041_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|4709066_4710398_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|4710425_4711634_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|4711662_4713957_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004219578.1|4714387_4715503_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|4715612_4716527_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|4716536_4717814_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|4717810_4718686_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|4718682_4719402_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|4719407_4720301_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|4720584_4722228_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|4722277_4722754_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|4722852_4723779_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|4724082_4725378_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004152314.1|4725392_4726199_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152315.1|4726173_4727073_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|4727182_4727665_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|4727855_4728554_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|4728579_4729164_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|4729233_4729563_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910647.1|4729649_4729895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910645.1|4730131_4731472_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|4731468_4732122_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|4732125_4733823_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|4736786_4738142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|4738142_4738652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|4738648_4739155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|4739391_4739901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153456.1|4741551_4742475_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
WP_004199326.1|4742616_4742799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|4742795_4743125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|4743121_4743628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910549.1|4743673_4743904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152634.1|4744009_4745449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|4745470_4746364_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004152633.1|4746547_4747441_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_002910539.1|4747616_4748510_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|4748685_4749576_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|4749912_4750893_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_000019473.1|4751112_4752093_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_029779706.1|4752216_4752453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227463.1|4752641_4752899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|4753196_4753463_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|4753466_4754624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|4754607_4758018_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|4758151_4759915_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 1
NZ_CP022574	Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence	170415	0	17350	170415	integrase,transposase	Salmonella_phage(28.57%)	10	15211:15224	17673:17686
WP_004152403.1|753_3651_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_004152402.1|3739_4360_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152400.1|5525_5885_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152398.1|6388_7573_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|7849_9169_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|9418_10300_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|10587_11367_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|11363_12389_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|12495_15525_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
15211:15224	attL	GTAGCGTTCATGCT	NA	NA	NA	NA
WP_004152391.1|15634_17350_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152391.1|15634_17350_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
17673:17686	attR	AGCATGAACGCTAC	NA	NA	NA	NA
>prophage 2
NZ_CP022574	Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence	170415	23160	27674	170415		Wolbachia_phage(33.33%)	7	NA	NA
WP_004152384.1|23160_23712_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	4.0e-17
WP_004152383.1|23815_24124_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_004152382.1|24120_24771_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004153014.1|24826_25471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199370.1|25520_26117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152380.1|26283_26877_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_004152379.1|26948_27674_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	7.1e-06
>prophage 3
NZ_CP022574	Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence	170415	62503	66106	170415		Cronobacter_phage(25.0%)	7	NA	NA
WP_004178064.1|62503_63325_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
WP_004152722.1|64158_64572_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152721.1|64572_64851_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152720.1|64840_65161_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152719.1|65241_65466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152718.1|65476_65689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152717.1|65749_66106_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
>prophage 4
NZ_CP022574	Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence	170415	71526	75811	170415		Emiliania_huxleyi_virus(33.33%)	4	NA	NA
WP_032422417.1|71526_73563_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	1.5e-21
WP_004152643.1|73632_73881_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004152644.1|73929_74472_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_004152645.1|75247_75811_-	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
>prophage 5
NZ_CP022574	Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence	170415	78947	170202	170415	protease,integrase,transposase	uncultured_Caudovirales_phage(15.62%)	78	75335:75351	106395:106411
75335:75351	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_004152754.1|78947_79202_-	hypothetical protein	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118478.1|79438_79864_-	antirestriction protein	NA	NA	NA	NA	NA
WP_004152753.1|80384_80615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|80848_82333_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004178083.1|82738_83164_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004152715.1|83163_84435_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004152062.1|87386_88358_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_000523813.1|88357_89524_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152063.1|90275_91286_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_001515717.1|92002_92743_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|93886_94834_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|94860_95172_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|95236_96160_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|96832_97090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|97691_99146_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|100128_101406_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|101468_103466_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|104505_105713_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|107132_107564_-	silver-binding protein SilE	NA	NA	NA	NA	NA
106395:106411	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
WP_003032875.1|107814_109290_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|109282_109963_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|110152_111538_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|111566_111920_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|112033_113326_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|113336_116483_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|116569_117010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|117136_119584_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|119624_119822_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|119855_120593_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|120881_121331_-	copper resistance protein	NA	NA	NA	NA	NA
WP_004152083.1|121564_123382_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|123381_124278_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|124317_124698_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|124702_125632_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|125686_126367_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|126363_127764_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|127980_128415_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|128646_128826_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|130568_131078_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|131127_131625_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|131956_132283_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|132282_132993_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|133001_133547_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|133622_133985_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|135881_136418_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|136450_136876_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|136888_138178_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|138225_139977_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|139994_140357_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|140406_140757_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|141114_141384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|141371_141947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|141977_142472_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|142515_142884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|142917_143121_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|143169_143427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|143502_143757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|143932_144199_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|144186_144669_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|144880_146227_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|148069_149032_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|149018_149768_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|150005_150203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|150202_152998_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|153112_153682_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|153716_153998_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|154241_154505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|154519_154783_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|155984_156965_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|158173_159043_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|159036_160047_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|160055_160883_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|160891_161755_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|161751_162579_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|163434_164139_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044117068.1|165442_166111_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000027057.1|167854_168715_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000018329.1|169386_170202_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
>prophage 1
NZ_CP022575	Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1b, complete sequence	43380	25389	35687	43380	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_004199413.1|25389_28407_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_002903955.1|29615_30518_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|30779_31541_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|31561_32422_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|32558_33263_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549892.1|33655_33895_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001549893.1|33981_34644_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|35024_35687_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
