The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	0	64629	4162569	capsid,tail,integrase,holin	Bacillus_phage(78.95%)	60	195:211	41769:41785
195:211	attL	AACGAAACATTTTAGAT	NA	NA	NA	NA
WP_094246737.1|370_1351_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	75.9	1.7e-79
WP_076982859.1|1613_2048_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014470068.1|2091_2862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246738.1|3370_5257_+	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	54.0	2.6e-108
WP_014470070.1|5269_5728_+	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	84.2	5.2e-71
WP_076982784.1|6032_6122_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_038458785.1|6323_6665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038458783.1|6683_6887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246740.1|7014_7773_+	sporulation protein YunB	NA	NA	NA	NA	NA
WP_064778347.1|7991_8324_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	73.6	6.9e-41
WP_094246741.1|8316_9567_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	91.6	4.7e-223
WP_094246742.1|9730_10891_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.5	2.9e-33
WP_094247867.1|11042_11330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246744.1|11685_11937_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	84.3	5.8e-32
WP_061573903.1|11957_12350_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	96.9	3.5e-60
WP_079005041.1|12465_13512_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	54.7	1.1e-87
WP_094247868.1|13685_16238_-	hypothetical protein	NA	D6R401	Bacillus_phage	36.2	3.0e-139
WP_038458769.1|16281_17097_-	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	61.0	1.1e-90
WP_094246745.1|20428_21190_-|tail	phage tail family protein	tail	A0A1P8CWP8	Bacillus_phage	78.4	6.1e-109
WP_094246746.1|21234_28125_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	60.1	0.0e+00
WP_046559819.1|28183_28864_-	hypothetical protein	NA	Q37974	Bacillus_phage	68.7	2.8e-76
WP_046559818.1|28931_29405_-	hypothetical protein	NA	O64047	Bacillus_phage	43.3	4.5e-25
WP_014472041.1|29787_30789_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	86.7	2.2e-170
WP_094246747.1|30802_31219_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	69.1	9.6e-48
WP_094246748.1|31218_31704_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	72.6	9.8e-60
WP_094246749.1|31786_31987_-	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	63.0	3.4e-11
WP_094246750.1|32320_33655_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	34.4	3.9e-26
WP_022553073.1|33654_34011_-	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
WP_064778362.1|34082_34550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022553074.1|34565_35369_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	56.6	1.3e-69
WP_047474197.1|35409_36120_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	65.5	3.2e-91
WP_047474199.1|36116_36623_-	hypothetical protein	NA	O64060	Bacillus_phage	68.5	5.2e-64
WP_094246751.1|36619_37285_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	50.0	1.2e-47
WP_064778365.1|37294_37681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246752.1|37694_38168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047474207.1|38222_39329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047474209.1|39353_39818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246753.1|39858_41016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246754.1|41033_42575_-	hypothetical protein	NA	NA	NA	NA	NA
41769:41785	attR	ATCTAAAATGTTTCGTT	NA	NA	NA	NA
WP_094246755.1|42593_44342_-	hypothetical protein	NA	A0A0K2FLD6	Brevibacillus_phage	30.6	1.5e-65
WP_094246756.1|44341_45349_-	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	24.2	1.3e-08
WP_094246757.1|45457_45958_-|capsid	capsid protein	capsid	A0A1P8CWS3	Bacillus_phage	30.9	1.5e-18
WP_094246758.1|46106_47306_-	metallophosphoesterase	NA	A0A0N9SK37	Staphylococcus_phage	37.7	2.9e-68
WP_069007089.1|47317_47518_-	YonK family protein	NA	NA	NA	NA	NA
WP_172424402.1|48757_48904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559801.1|49442_49718_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	79.1	3.2e-31
WP_094246759.1|49823_50636_-	hypothetical protein	NA	Q331U9	Clostridium_botulinum_C_phage	25.0	9.4e-07
WP_094246760.1|50635_53410_-	hypothetical protein	NA	H7BV05	unidentified_phage	28.7	3.6e-98
WP_094246761.1|53422_53659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417885.1|53732_53912_-	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	71.2	1.5e-18
WP_094246762.1|54031_54268_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046559798.1|54446_54731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246763.1|54730_55843_+	cell division protein FtsZ	NA	G3MBK4	Bacillus_virus	30.0	1.3e-30
WP_014472020.1|57309_57549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246764.1|57629_58862_+	hypothetical protein	NA	O64082	Bacillus_phage	64.5	4.6e-154
WP_172424403.1|59173_61030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246766.1|61083_62685_+	DUF4942 domain-containing protein	NA	A0A0U4JGM1	Vibrio_phage	36.0	2.8e-10
WP_094246767.1|62849_63455_+	MmcB family DNA repair protein	NA	NA	NA	NA	NA
WP_094247870.1|63624_63819_+	hypothetical protein	NA	A0A1B1P8C9	Bacillus_phage	39.3	7.2e-06
WP_094246768.1|63921_64629_+	hypothetical protein	NA	E5DV90	Deep-sea_thermophilic_phage	39.7	4.6e-34
>prophage 2
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	69094	69298	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_014470137.1|69094_69298_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	80.3	4.0e-23
>prophage 3
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	72314	73180	4162569		Bacillus_phage(100.0%)	4	NA	NA
WP_041482308.1|72314_72497_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.7	1.0e-25
WP_094246780.1|72567_72819_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	62.7	3.2e-22
WP_094246781.1|72821_73037_+	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	52.1	6.7e-13
WP_014417905.1|73048_73180_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	9.4e-18
>prophage 4
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	76620	97740	4162569	terminase,integrase	Bacillus_phage(93.33%)	40	76840:76856	86813:86829
WP_020954135.1|76620_76776_+	hypothetical protein	NA	A0A1P8CWW2	Bacillus_phage	60.8	8.5e-10
76840:76856	attL	GAATAAAAATAAAATAA	NA	NA	NA	NA
WP_014472000.1|76925_77138_+	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
WP_014471999.1|77152_77383_+	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
WP_021493556.1|77421_77586_+	hypothetical protein	NA	A0A1P8CWX2	Bacillus_phage	52.6	5.1e-05
WP_094246784.1|77595_78654_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	76.0	7.9e-155
WP_094246785.1|78730_80080_+	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	75.2	1.6e-189
WP_046559778.1|80100_81084_+	hypothetical protein	NA	A0A1P8CWX4	Bacillus_phage	77.7	7.4e-139
WP_021493552.1|81304_81526_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	79.5	2.2e-27
WP_020954129.1|81690_81990_+	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	50.0	1.0e-19
WP_020954128.1|82064_82310_+	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
WP_094246786.1|82418_82643_+	hypothetical protein	NA	A0A1P8CWW8	Bacillus_phage	51.9	1.5e-15
WP_094246787.1|82676_83099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246788.1|83095_83299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247873.1|83471_83879_+	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	91.1	9.0e-67
WP_094246789.1|83923_84736_+	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	52.7	2.1e-70
WP_032721704.1|84769_84976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160171066.1|84965_85103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246790.1|85142_85781_+	DUF3920 family protein	NA	NA	NA	NA	NA
WP_017697055.1|85805_86042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246791.1|86080_86407_+	hypothetical protein	NA	A0A127AWI5	Bacillus_phage	50.0	1.7e-15
WP_094246792.1|86384_86648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246793.1|86844_87060_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	87.3	6.7e-29
86813:86829	attR	GAATAAAAATAAAATAA	NA	NA	NA	NA
WP_094246794.1|87073_87448_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	63.4	1.2e-36
WP_172424405.1|87562_87727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045207873.1|87819_88323_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	54.5	2.4e-37
WP_094246795.1|88319_88472_-	hypothetical protein	NA	A0A1P8CWZ1	Bacillus_phage	61.2	2.2e-10
WP_094246796.1|88614_89454_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	58.2	5.6e-71
WP_094246797.1|89450_89987_+|terminase	terminase small subunit	terminase	M4ZS05	Bacillus_phage	44.0	3.6e-07
WP_017697063.1|90030_90438_+	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	89.5	1.0e-65
WP_094246798.1|90511_91324_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	87.0	7.9e-139
WP_014470187.1|91393_92068_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	96.5	1.4e-77
WP_061573814.1|92138_92384_+	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	85.5	7.2e-27
WP_172424406.1|92361_92661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246799.1|92676_93165_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	46.3	4.3e-15
WP_077722306.1|93198_93576_+	hypothetical protein	NA	A8ASN9	Listeria_phage	41.2	1.2e-17
WP_153041606.1|93672_94497_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	63.4	8.2e-91
WP_094246800.1|94493_96236_+	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	64.5	1.4e-220
WP_094246801.1|96274_96652_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	75.4	1.3e-51
WP_094246802.1|96843_97227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246803.1|97365_97740_+	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	77.4	2.6e-52
>prophage 5
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	100768	132176	4162569		Bacillus_phage(90.62%)	52	NA	NA
WP_094246806.1|100768_102250_+	DNA helicase	NA	V9VET6	Lactococcus_phage	26.9	6.7e-43
WP_029974386.1|102271_103288_+	hypothetical protein	NA	A0A1W6JK26	Lactococcus_phage	29.6	2.8e-16
WP_094246807.1|103303_104371_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_172424407.1|104377_106102_+	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	55.8	5.6e-174
WP_094247874.1|106164_106824_+	hypothetical protein	NA	A0A1P8CX16	Bacillus_phage	34.8	2.0e-23
WP_014471961.1|106835_107039_+	YorP family protein	NA	O64150	Bacillus_phage	74.6	2.5e-25
WP_014471960.1|107043_107202_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	62.7	4.2e-12
WP_094246809.1|107198_107726_+	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	80.6	3.5e-71
WP_094246810.1|107703_108222_+	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	90.7	6.3e-89
WP_094246811.1|108265_108631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246812.1|108755_109025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247875.1|109091_110528_+	DNA (cytosine-5-)-methyltransferase	NA	Q02778	Bacillus_phage	81.9	2.1e-203
WP_094246813.1|110578_110797_+	hypothetical protein	NA	O64155	Bacillus_phage	61.4	1.5e-15
WP_154019766.1|111567_111741_+	hypothetical protein	NA	A0A1P8CX41	Bacillus_phage	94.7	5.2e-24
WP_094246814.1|111839_112313_+	hypothetical protein	NA	O64162	Bacillus_phage	66.7	3.6e-59
WP_077722325.1|112451_112805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246815.1|112867_113290_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	62.4	3.0e-41
WP_094246816.1|113325_113619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246817.1|113761_114085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172424408.1|114116_114266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417955.1|114284_114641_+	hypothetical protein	NA	O64171	Bacillus_phage	45.9	4.2e-20
WP_145956743.1|114637_115033_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	84.7	2.2e-57
WP_094246818.1|114995_117095_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	60.4	0.0e+00
WP_038458545.1|118030_118552_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	91.9	7.5e-90
WP_094246819.1|119132_119372_+	thioredoxin family protein	NA	A0A1P8CX24	Bacillus_phage	76.2	2.4e-27
WP_077722340.1|119613_120228_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	42.2	2.1e-43
WP_172424409.1|120337_120502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038458527.1|120621_121020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038458524.1|121077_121344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038458521.1|121336_121636_+	hypothetical protein	NA	O64180	Bacillus_phage	52.2	1.5e-18
WP_038458515.1|122074_122701_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_038458512.1|122771_123611_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	89.6	1.6e-150
WP_094246820.1|123610_124117_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	40.4	3.1e-32
WP_046559722.1|124246_124612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559721.1|124671_125028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559720.1|125611_125905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559719.1|126265_126454_+	hypothetical protein	NA	A0A1P8CX75	Bacillus_phage	98.4	2.7e-26
WP_042976081.1|126535_126748_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	100.0	4.1e-31
WP_094246821.1|126906_127737_+	metallophosphoesterase	NA	O64184	Bacillus_phage	88.4	2.9e-152
WP_094246822.1|127770_127971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246823.1|128006_128153_+	hypothetical protein	NA	A0A1P8CX49	Bacillus_phage	89.6	1.3e-15
WP_094246824.1|128149_128701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246825.1|128675_129092_+	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	71.0	1.9e-35
WP_077722354.1|129088_129427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246826.1|129475_130024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417977.1|130024_130198_+	hypothetical protein	NA	O64190	Bacillus_phage	91.2	5.4e-21
WP_094246827.1|130194_130458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172424410.1|130454_130619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072692888.1|130649_130865_+	hypothetical protein	NA	U5PU52	Bacillus_phage	66.7	1.7e-19
WP_014470254.1|131108_131348_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_094246829.1|131445_132033_+	Holliday junction resolvase RecU	NA	A0A1P8CX67	Bacillus_phage	86.7	9.6e-94
WP_172424411.1|132029_132176_+	hypothetical protein	NA	A0A1P8CX58	Bacillus_phage	83.3	7.5e-16
>prophage 6
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	157792	162206	4162569		Phthorimaea_operculella_granulovirus(33.33%)	4	NA	NA
WP_024085478.1|157792_159004_+	glycosyl transferase family 1	NA	G4WEM5	Phthorimaea_operculella_granulovirus	30.1	1.6e-05
WP_014305202.1|159323_160565_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	42.1	2.6e-16
WP_057080768.1|160647_161238_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_003153758.1|161315_162206_+	MoxR family ATPase	NA	R4TG24	Halovirus	26.7	4.6e-07
>prophage 7
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	171854	172700	4162569		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_070081967.1|171854_172700_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.3	2.9e-35
>prophage 8
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	181042	183929	4162569		Moumouvirus(50.0%)	2	NA	NA
WP_070081962.1|181042_182821_+	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.8	2.6e-81
WP_003153795.1|183056_183929_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217EQJ4	Bacillus_phage	70.8	4.0e-27
>prophage 9
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	187775	188441	4162569		Streptococcus_phage(100.0%)	1	NA	NA
WP_003153802.1|187775_188441_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	32.6	3.3e-18
>prophage 10
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	193313	194060	4162569		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_070081958.1|193313_194060_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.8e-16
>prophage 11
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	198249	199266	4162569		Streptococcus_phage(100.0%)	1	NA	NA
WP_094247881.1|198249_199266_+	2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	31.1	2.0e-22
>prophage 12
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	203312	206850	4162569		Streptococcus_phage(50.0%)	4	NA	NA
WP_003153828.1|203312_204029_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	77.2	2.8e-47
WP_094246860.1|204313_204682_+	replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.0	7.0e-18
WP_014418088.1|204858_205707_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	30.2	8.9e-24
WP_014305177.1|205731_206850_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.2	1.1e-69
>prophage 13
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	216746	218675	4162569	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_094246865.1|216746_218675_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.4	5.1e-136
>prophage 14
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	222945	223491	4162569	integrase	Bacillus_phage(100.0%)	1	219975:219990	236000:236015
219975:219990	attL	GGAATGGCGCTTCATG	NA	NA	NA	NA
WP_003153850.1|222945_223491_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
WP_003153850.1|222945_223491_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
236000:236015	attR	GGAATGGCGCTTCATG	NA	NA	NA	NA
>prophage 15
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	228967	266637	4162569		Tupanvirus(100.0%)	5	NA	NA
WP_094246870.1|228967_236626_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.5	1.8e-78
WP_094246871.1|236651_244349_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.9	7.0e-160
WP_094246872.1|244364_252014_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.0	5.7e-77
WP_094246873.1|252039_262815_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.8	1.7e-159
WP_094246874.1|262833_266637_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.4	1.1e-84
>prophage 16
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	270080	271721	4162569		Hepacivirus(100.0%)	1	NA	NA
WP_094246876.1|270080_271721_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.7	1.0e-47
>prophage 17
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	277275	282126	4162569		Bacillus_phage(33.33%)	5	NA	NA
WP_094246880.1|277275_278169_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.3	2.0e-82
WP_094246881.1|278175_278583_-	GtrA family protein	NA	NA	NA	NA	NA
WP_094246882.1|278862_279633_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_094246883.1|279629_280976_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.7	1.0e-13
WP_094246884.1|280965_282126_+	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	26.0	4.6e-31
>prophage 18
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	290776	326804	4162569		Tupanvirus(100.0%)	3	NA	NA
WP_094246889.1|290776_302725_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.2	3.9e-117
WP_094246890.1|302769_318861_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.2	1.5e-92
WP_094246891.1|318944_326804_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.1	3.2e-91
>prophage 19
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	330994	331303	4162569		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_094246893.1|330994_331303_-	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	41.7	2.6e-10
>prophage 20
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	340452	341454	4162569		Enterobacteria_phage(100.0%)	1	NA	NA
WP_025650135.1|340452_341454_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	27.6	1.4e-23
>prophage 21
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	348665	353059	4162569		Bacillus_phage(50.0%)	2	NA	NA
WP_025650140.1|348665_351089_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	33.1	1.5e-100
WP_025650141.1|351091_353059_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	2.4e-125
>prophage 22
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	368218	378446	4162569		Bacillus_phage(66.67%)	12	NA	NA
WP_003154004.1|368218_368839_+	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
WP_070081879.1|369178_369607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154009.1|369748_370198_+	YndM family protein	NA	NA	NA	NA	NA
WP_003154011.1|370225_371056_-	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	72.7	3.8e-104
WP_003154013.1|371042_371192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246900.1|371300_372122_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	42.7	2.4e-50
WP_003154017.1|372398_372833_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	85.9	2.3e-68
WP_094246901.1|373210_375628_+	peptidase G2	NA	D6R401	Bacillus_phage	50.6	2.1e-219
WP_172424401.1|375796_375952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417867.1|376237_376774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154022.1|377562_377661_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154023.1|377825_378446_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	36.9	1.3e-19
>prophage 23
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	382805	389329	4162569		Bacillus_phage(33.33%)	6	NA	NA
WP_094247883.1|382805_383222_-	UPF0715 family protein	NA	O64087	Bacillus_phage	68.8	3.4e-21
WP_172424412.1|383380_383524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246906.1|383836_384853_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.4	3.6e-32
WP_003154035.1|385083_385269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154037.1|386080_386179_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_094246908.1|386731_389329_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.9	1.1e-45
>prophage 24
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	403746	409960	4162569		Bacillus_phage(50.0%)	6	NA	NA
WP_070081863.1|403746_404715_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	41.2	2.1e-53
WP_094246916.1|405021_405780_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	4.8e-53
WP_044053225.1|405829_406450_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	1.2e-46
WP_024085331.1|406498_407488_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.3	2.5e-155
WP_003154060.1|407505_409608_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
WP_003154061.1|409567_409960_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
>prophage 25
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	414353	483232	4162569		Paenibacillus_phage(62.5%)	12	NA	NA
WP_003154076.1|414353_415061_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	54.1	2.1e-50
WP_041481863.1|415316_415550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246917.1|415728_417057_+	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	34.2	3.8e-29
WP_007410383.1|417249_417612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246918.1|417645_418401_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_007611576.1|418461_418896_-	sporulation protein	NA	F8WPS9	Bacillus_phage	55.7	5.5e-38
WP_094247884.1|419184_420396_+	cytochrome P450	NA	NA	NA	NA	NA
WP_094246919.1|420530_427988_-	polyketide synthase dehydratase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	31.0	6.6e-38
WP_094246920.1|428001_444303_-	non-ribosomal peptide synthetase	NA	D0R7J2	Paenibacillus_phage	58.3	1.2e-121
WP_094246921.1|444292_454834_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.0	2.2e-39
WP_172424413.1|454851_468297_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.0	5.9e-37
WP_094246923.1|468280_483232_-	non-ribosomal peptide synthetase	NA	D0R7J2	Paenibacillus_phage	59.6	5.8e-126
>prophage 26
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	490965	497766	4162569		Streptococcus_phage(33.33%)	3	NA	NA
WP_003154103.1|490965_491643_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	26.3	1.4e-11
WP_038463888.1|493287_495165_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.4	2.0e-68
WP_094246926.1|495180_497766_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.2	5.1e-38
>prophage 27
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	500789	508844	4162569		Bacillus_phage(40.0%)	7	NA	NA
WP_029325912.1|500789_501968_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	32.8	2.7e-47
WP_043867101.1|501980_503027_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	62.0	1.1e-10
WP_003154135.1|503285_503546_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	42.5	1.2e-08
WP_003154137.1|503745_504540_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_003154140.1|504600_506160_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_003154142.1|506452_507634_-	serine hydrolase	NA	A0A076YK70	Mycobacterium_phage	27.7	3.2e-11
WP_003154145.1|507800_508844_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	72.9	6.0e-139
>prophage 28
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	513895	516459	4162569		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_070081837.1|513895_515182_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	26.3	1.1e-06
WP_094246928.1|515178_516459_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	27.8	2.8e-45
>prophage 29
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	522477	524838	4162569		Mycobacterium_phage(100.0%)	1	NA	NA
WP_145956744.1|522477_524838_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	50.0	7.1e-87
>prophage 30
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	533231	534467	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_003154178.1|533231_534467_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	31.6	2.3e-49
>prophage 31
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	538311	549875	4162569	tRNA	Indivirus(33.33%)	10	NA	NA
WP_007611467.1|538311_539253_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	29.8	6.9e-09
WP_069013689.1|539272_540202_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003154185.1|540285_540639_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003154188.1|540655_540934_-	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_015388229.1|540930_543078_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	1.3e-23
WP_003154192.1|543097_543400_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_003154193.1|543401_543677_-	glucose-induced regulator RulR	NA	NA	NA	NA	NA
WP_003154195.1|543690_544812_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_007409801.1|544851_545322_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_024085302.1|545561_549875_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	31.8	6.3e-25
>prophage 32
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	554995	555778	4162569		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003154211.1|554995_555778_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	40.7	4.3e-25
>prophage 33
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	559697	560462	4162569		Salisaeta_icosahedral_phage(100.0%)	1	NA	NA
WP_003154217.1|559697_560462_-	RNA polymerase sigma-28 factor SigD	NA	I1ZBD5	Salisaeta_icosahedral_phage	27.4	1.0e-07
>prophage 34
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	586705	593121	4162569	protease,tRNA	Erwinia_phage(33.33%)	5	NA	NA
WP_014305002.1|586705_588109_-	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	28.3	1.8e-42
WP_003154267.1|588125_588671_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_007409774.1|588686_589604_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.7	9.0e-30
WP_012117550.1|589673_590981_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_025649465.1|591045_593121_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.7	1.5e-104
>prophage 35
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	598528	599296	4162569		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_094246942.1|598528_599296_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.6	6.1e-24
>prophage 36
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	610535	612482	4162569		Moumouvirus(33.33%)	3	NA	NA
WP_003154303.1|610535_611285_-	ribonuclease III	NA	M1PMQ4	Moumouvirus	32.4	1.9e-25
WP_003154310.1|611423_611657_-	acyl carrier protein	NA	M4M9G2	Vibrio_phage	44.9	7.1e-08
WP_094246944.1|611741_612482_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	2.0e-19
>prophage 37
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	623892	625836	4162569		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_077722187.1|623892_625836_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	36.1	2.0e-23
>prophage 38
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	629021	639010	4162569	tRNA	Prochlorococcus_phage(20.0%)	9	NA	NA
WP_094246950.1|629021_629975_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.8	8.2e-10
WP_003154343.1|629979_630462_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	45.0	4.9e-19
WP_094246951.1|630486_632898_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_014470413.1|632894_634115_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.4	1.8e-41
WP_003154346.1|634205_634409_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_013352212.1|634412_635027_-	guanylate kinase	NA	S4W1R9	Pandoravirus	33.1	3.7e-11
WP_003154355.1|635034_635304_-	extracellular matrix/biofilm regulator RemA	NA	NA	NA	NA	NA
WP_014470416.1|635380_636256_-	YicC family protein	NA	NA	NA	NA	NA
WP_014470417.1|636337_639010_-	calcium-translocating P-type ATPase, SERCA-type	NA	A7IUR5	Paramecium_bursaria_Chlorella_virus	29.7	1.6e-90
>prophage 39
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	644732	646488	4162569		Tupanvirus(100.0%)	2	NA	NA
WP_013352204.1|644732_645326_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	42.0	1.7e-26
WP_094246952.1|645339_646488_-	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	29.5	8.3e-41
>prophage 40
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	654867	665252	4162569	tRNA	Halovirus(25.0%)	9	NA	NA
WP_013352195.1|654867_655962_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	38.5	9.0e-61
WP_013352194.1|655958_657245_-	dihydroorotase	NA	NA	NA	NA	NA
WP_014471818.1|657228_658143_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	36.4	1.1e-35
WP_013352192.1|658286_659597_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.5	1.3e-58
WP_003154392.1|659752_660298_-	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013352191.1|660486_661401_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003154398.1|661402_661864_-	signal peptidase II	NA	NA	NA	NA	NA
WP_003154399.1|661965_662337_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_094246953.1|662486_665252_-|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	26.5	3.0e-81
>prophage 41
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	671217	679285	4162569		Bacillus_phage(50.0%)	5	NA	NA
WP_015417427.1|671217_672015_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	2.5e-12
WP_003154420.1|672143_672926_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.1	2.2e-45
WP_007409714.1|673066_673786_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	41.4	8.1e-18
WP_094246956.1|673843_674773_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_094246957.1|674989_679285_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	33.6	4.5e-23
>prophage 42
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	700346	700922	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_003154450.1|700346_700922_-	sporulation-specific transcriptional regulator GerR	NA	A0A1D6X8E5	Bacillus_phage	29.5	2.8e-05
>prophage 43
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	704302	711096	4162569		Catovirus(25.0%)	11	NA	NA
WP_014304961.1|704302_705082_-	patatin family protein	NA	A0A1V0SCG0	Catovirus	26.9	9.7e-09
WP_003154466.1|705261_706488_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
WP_003154467.1|706506_706989_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.9	5.4e-26
WP_077722171.1|706993_707548_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_094246961.1|707547_707757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154470.1|707847_708120_-	YlbG family protein	NA	NA	NA	NA	NA
WP_003154472.1|708178_708628_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_003154475.1|708698_708938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070081781.1|708953_709364_-	YlbD family protein	NA	NA	NA	NA	NA
WP_003154477.1|709527_710568_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.0	3.4e-17
WP_003154478.1|710652_711096_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.7	1.8e-12
>prophage 44
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	725799	730474	4162569		Vibrio_phage(50.0%)	5	NA	NA
WP_003154497.1|725799_727128_-	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	33.6	7.6e-54
WP_003154498.1|727282_727906_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_003154499.1|728007_728217_+	YlaI family protein	NA	NA	NA	NA	NA
WP_014304952.1|728258_728579_-	YlaH-like family protein	NA	NA	NA	NA	NA
WP_003154502.1|728635_730474_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	38.8	3.8e-19
>prophage 45
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	742811	744224	4162569		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_033574600.1|742811_744224_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.6	7.5e-44
>prophage 46
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	748249	749341	4162569		Mycobacterium_phage(100.0%)	1	NA	NA
WP_094246968.1|748249_749341_-	serine hydrolase	NA	G1BNF7	Mycobacterium_phage	25.5	6.7e-08
>prophage 47
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	753272	760655	4162569		Paenibacillus_phage(100.0%)	1	NA	NA
WP_094246970.1|753272_760655_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	33.8	3.7e-41
>prophage 48
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	766389	782092	4162569		Paenibacillus_phage(100.0%)	2	NA	NA
WP_094246972.1|766389_773391_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.2	2.8e-38
WP_094246973.1|773383_782092_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	28.8	6.1e-35
>prophage 49
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	786905	799163	4162569		Paenibacillus_phage(100.0%)	1	NA	NA
WP_094246975.1|786905_799163_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.9	9.5e-34
>prophage 50
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	803111	803666	4162569		Synechococcus_phage(100.0%)	1	NA	NA
WP_071391889.1|803111_803666_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.7	6.0e-13
>prophage 51
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	811636	811921	4162569		Paenibacillus_phage(100.0%)	1	NA	NA
WP_024085249.1|811636_811921_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	50.0	1.5e-12
>prophage 52
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	815788	817408	4162569		Tupanvirus(100.0%)	1	NA	NA
WP_003154562.1|815788_817408_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.5	4.9e-47
>prophage 53
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	823643	824336	4162569		Planktothrix_phage(100.0%)	1	NA	NA
WP_070081750.1|823643_824336_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.0e-33
>prophage 54
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	832869	833328	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_094246981.1|832869_833328_-	redoxin domain-containing protein	NA	A0A127AW88	Bacillus_phage	49.3	7.9e-35
>prophage 55
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	836747	838586	4162569		Bacillus_phage(100.0%)	3	NA	NA
WP_094246983.1|836747_837203_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	31.9	3.1e-15
WP_094246984.1|837229_838123_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_070081741.1|838112_838586_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	35.7	2.3e-13
>prophage 56
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	843988	844753	4162569		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003154618.1|843988_844753_-	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	39.4	6.7e-39
>prophage 57
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	848326	860476	4162569		Bacillus_thuringiensis_phage(25.0%)	10	NA	NA
WP_014304917.1|848326_849238_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.8	1.0e-46
WP_007409608.1|849426_849588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007611083.1|849788_850958_+	aminotransferase A	NA	NA	NA	NA	NA
WP_003154628.1|850983_852804_-	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.6	1.3e-08
WP_021493760.1|852981_855114_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_057079978.1|855454_856231_+	hypothetical protein	NA	U5Q0C0	Bacillus_phage	62.6	6.2e-40
WP_096034932.1|856231_856402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088462211.1|856616_857006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094246986.1|857561_858428_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044053153.1|858508_860476_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.6	3.1e-11
>prophage 58
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	864123	866220	4162569		Vibrio_phage(100.0%)	1	NA	NA
WP_070081734.1|864123_866220_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	45.8	3.4e-08
>prophage 59
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	869826	874619	4162569		Streptococcus_phage(50.0%)	4	NA	NA
WP_044053151.1|869826_871740_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.0	7.4e-111
WP_094246989.1|871982_872477_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_057079972.1|872539_873880_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003154665.1|873995_874619_-	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	54.5	1.7e-27
>prophage 60
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	881502	888843	4162569	protease	Pneumococcus_phage(50.0%)	7	NA	NA
WP_003154673.1|881502_881997_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	73.2	1.1e-55
WP_003154676.1|882014_882746_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.6	2.6e-56
WP_003154678.1|882738_883179_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003154679.1|883179_883839_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.4	6.6e-67
WP_094246991.1|884088_885210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246992.1|885307_886345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070081723.1|886746_888843_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	42.6	3.9e-129
>prophage 61
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	898095	902223	4162569		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_094246996.1|898095_898875_+	carbon-nitrogen family hydrolase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	26.9	4.6e-11
WP_094246997.1|899231_900416_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_003154704.1|900422_901484_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_094246998.1|901725_902223_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	47.5	1.5e-18
>prophage 62
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	908233	916911	4162569	protease,transposase	Bacillus_phage(50.0%)	9	NA	NA
WP_094246999.1|908233_909384_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
WP_003154715.1|909501_910395_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_003154716.1|910543_911245_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003154717.1|911379_911574_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	65.5	3.6e-13
WP_003154718.1|911580_912759_-	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_003154719.1|912755_913511_-	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_025851720.1|913787_914570_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	43.1	1.2e-30
WP_094247000.1|914816_915386_-	DedA family protein	NA	NA	NA	NA	NA
WP_070081710.1|916029_916911_+	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	37.5	8.0e-44
>prophage 63
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	925467	929899	4162569		Planktothrix_phage(50.0%)	4	NA	NA
WP_094247002.1|925467_927105_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	4.5e-16
WP_094032381.1|927079_927841_+	thiamine permease	NA	NA	NA	NA	NA
WP_094032380.1|927886_928720_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_025851741.1|928939_929899_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	50.9	1.5e-72
>prophage 64
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	939606	943235	4162569		Streptococcus_phage(66.67%)	3	NA	NA
WP_094247009.1|939606_940854_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.4	6.1e-98
WP_044053138.1|940850_941963_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.2	3.2e-74
WP_017417625.1|942332_943235_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	36.2	1.2e-15
>prophage 65
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	947507	949382	4162569		Bacillus_virus(50.0%)	2	NA	NA
WP_071391950.1|947507_948479_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.0	8.9e-20
WP_094247012.1|948482_949382_-	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	44.0	2.7e-18
>prophage 66
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	953121	954150	4162569		Planktothrix_phage(100.0%)	1	NA	NA
WP_025851774.1|953121_954150_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	5.7e-17
>prophage 67
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	958876	961561	4162569		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_152036128.1|958876_960226_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	33.3	1.6e-22
WP_172424414.1|960326_960503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154790.1|960589_961561_-	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.6	5.0e-63
>prophage 68
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	969610	1001496	4162569	portal,tail,terminase,capsid,holin,plate	Bacillus_phage(32.26%)	43	NA	NA
WP_024085195.1|969610_970489_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	4.8e-81
WP_003154813.1|970502_970766_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_003154815.1|970779_971043_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_094247020.1|971094_971856_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_071391956.1|971912_972110_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	62.5	3.3e-14
WP_070081681.1|972114_972486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247021.1|972498_974121_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	3.1e-41
WP_003154822.1|974123_974396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154823.1|974392_974971_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	2.4e-12
WP_003154824.1|974954_976001_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	7.7e-70
WP_003154825.1|975993_976419_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_094247022.1|976522_976789_-	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	1.5e-06
WP_039251762.1|976788_977766_-	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	2.9e-34
WP_094247023.1|977779_978439_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	44.2	3.1e-08
WP_094247024.1|978431_983555_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	2.0e-41
WP_015239684.1|983542_983695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154836.1|983736_984183_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_003154837.1|984257_984701_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_044053125.1|984702_986100_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_003154839.1|986099_986309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473357.1|986305_986752_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_069473356.1|986748_987252_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.0	3.2e-37
WP_007610806.1|987248_987605_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_094247025.1|987601_987985_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007407274.1|988001_988937_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_015417286.1|988963_989809_-	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	57.6	4.3e-55
WP_088005490.1|989828_991220_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.6	3.0e-138
WP_025851817.1|991268_992567_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	4.2e-150
WP_025851819.1|992563_993361_-|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.8	7.2e-60
WP_017417605.1|993473_993986_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	2.9e-22
WP_003154859.1|994099_994303_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_025851823.1|994292_994634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247026.1|994731_994899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032861409.1|994898_995699_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.9	1.0e-58
WP_094247027.1|995598_996426_-|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	1.3e-19
WP_033574556.1|996415_996595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154871.1|996786_997125_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_003154873.1|997273_997864_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_094247028.1|998017_998623_-	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.8	2.0e-41
WP_007610770.1|998731_999109_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_003154880.1|999140_1000094_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154881.1|1000235_1000370_-	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_087920760.1|1000359_1001496_-	S9 family peptidase	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
>prophage 69
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1013851	1017780	4162569		Bacillus_phage(66.67%)	5	NA	NA
WP_077722089.1|1013851_1014589_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.9	3.1e-17
WP_094247033.1|1014590_1015352_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_094247034.1|1015377_1016196_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003154919.1|1016371_1016557_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	75.9	2.6e-21
WP_094247035.1|1016595_1017780_-	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	30.2	7.3e-08
>prophage 70
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1024443	1025079	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_007407316.1|1024443_1025079_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	50.4	6.2e-22
>prophage 71
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1032453	1033446	4162569		Tupanvirus(100.0%)	1	NA	NA
WP_094247041.1|1032453_1033446_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.3	5.1e-47
>prophage 72
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1038917	1075603	4162569	tail,coat,integrase	Bacillus_phage(36.36%)	49	1043490:1043537	1060688:1060735
WP_094247045.1|1038917_1039838_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	48.2	1.1e-59
WP_094247046.1|1040139_1040502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247047.1|1041021_1042905_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	1.5e-127
WP_025851902.1|1042921_1043212_+	hypothetical protein	NA	NA	NA	NA	NA
1043490:1043537	attL	TATGATTCCGACTGGGCTCGAACCAGCGACCTCTACCCTGTCAAGGTA	NA	NA	NA	NA
WP_094247048.1|1043724_1044027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247049.1|1044105_1046361_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	38.1	6.4e-61
WP_094247050.1|1046609_1047218_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	41.1	1.7e-29
WP_094247051.1|1047214_1047436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039063548.1|1047511_1048219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039063549.1|1048255_1048909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247052.1|1048919_1049402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247053.1|1049398_1049767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247054.1|1049745_1049946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247055.1|1050076_1050295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247056.1|1050367_1051300_-	hypothetical protein	NA	A0A0A8WF99	Clostridium_phage	27.9	1.6e-21
WP_094247057.1|1051280_1051514_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094247058.1|1052539_1052725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247059.1|1052717_1053059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247060.1|1053055_1053382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247061.1|1053419_1053962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247062.1|1053958_1054303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247063.1|1054299_1054500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085142.1|1054783_1055020_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094247064.1|1055227_1055977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351554.1|1056115_1056889_+	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	57.8	1.5e-73
WP_094247065.1|1057859_1058396_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	48.0	9.2e-35
WP_094247066.1|1058604_1059321_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	31.9	1.3e-20
WP_094247067.1|1059479_1060529_-|integrase	tyrosine-type recombinase/integrase	integrase	Q938N9	Temperate_phage	28.1	1.0e-08
WP_094247068.1|1060899_1062075_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
1060688:1060735	attR	TATGATTCCGACTGGGCTCGAACCAGCGACCTCTACCCTGTCAAGGTA	NA	NA	NA	NA
WP_052585709.1|1062067_1063189_-	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_094247069.1|1063558_1064281_+	esterase family protein	NA	NA	NA	NA	NA
WP_003154969.1|1064306_1064822_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_077722072.1|1064826_1065258_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003154973.1|1065418_1065652_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077722071.1|1065652_1066390_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.2	6.7e-28
WP_077722070.1|1066382_1067105_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_094247070.1|1067146_1067896_-	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_070081642.1|1067964_1068219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247071.1|1068339_1070625_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.2	5.4e-84
WP_003154986.1|1070693_1070948_-	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_070081640.1|1071114_1071273_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_077722067.1|1071364_1071562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388440.1|1071849_1072206_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003154992.1|1072376_1072763_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154993.1|1072800_1073115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044802820.1|1073207_1073708_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_094247072.1|1073858_1074341_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154997.1|1074486_1074930_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_162988631.1|1074988_1075603_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 73
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1084126	1089054	4162569		Klosneuvirus(33.33%)	7	NA	NA
WP_094247075.1|1084126_1084876_+	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.8	9.0e-12
WP_070081631.1|1084908_1085802_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.0e-06
WP_003155018.1|1085816_1086617_-	NAD kinase	NA	NA	NA	NA	NA
WP_003155019.1|1086634_1087270_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155020.1|1087297_1087663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155021.1|1087787_1088363_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_017417458.1|1088367_1089054_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.8e-38
>prophage 74
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1095370	1100635	4162569		Pseudomonas_phage(33.33%)	6	NA	NA
WP_003155033.1|1095370_1096027_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	40.4	3.8e-30
WP_003155034.1|1096084_1096480_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003155035.1|1096658_1097237_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_094247077.1|1097354_1098542_-	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_070081625.1|1098648_1099566_-	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_094247078.1|1099558_1100635_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	2.3e-16
>prophage 75
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1106013	1106766	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_014304784.1|1106013_1106766_-	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	1.9e-49
>prophage 76
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1110570	1112543	4162569		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_003155053.1|1110570_1111560_-	dipeptide ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	24.6	5.7e-06
WP_031378493.1|1111556_1112543_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.3	2.7e-24
>prophage 77
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1119568	1120540	4162569		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_094247080.1|1119568_1120540_-	ornithine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	27.7	2.6e-19
>prophage 78
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1123615	1125902	4162569		Halovirus(50.0%)	2	NA	NA
WP_007409132.1|1123615_1124674_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.6	5.3e-58
WP_025649577.1|1124744_1125902_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.9	7.3e-29
>prophage 79
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1129672	1131873	4162569		Tupanvirus(50.0%)	2	NA	NA
WP_017417437.1|1129672_1131109_-	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	30.0	1.0e-48
WP_172424427.1|1131429_1131873_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	66.7	1.2e-40
>prophage 80
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1134999	1139673	4162569		Streptococcus_phage(25.0%)	5	NA	NA
WP_003155101.1|1134999_1135842_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	26.7	2.2e-27
WP_014304769.1|1135966_1136818_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.9	2.1e-12
WP_003155105.1|1136866_1136989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181691.1|1137049_1138699_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.3	3.3e-14
WP_025649574.1|1138695_1139673_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	29.6	2.7e-32
>prophage 81
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1148893	1149919	4162569		Enterobacteria_phage(100.0%)	1	NA	NA
WP_025649569.1|1148893_1149919_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.2	2.7e-35
>prophage 82
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1153169	1155011	4162569		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_070081604.1|1153169_1155011_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	28.0	1.6e-33
>prophage 83
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1160255	1168586	4162569		Bacillus_virus(100.0%)	3	NA	NA
WP_094247087.1|1160255_1163648_-	SMC family ATPase	NA	G3MAB6	Bacillus_virus	23.8	1.1e-05
WP_094247088.1|1163644_1164817_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_094247891.1|1164881_1168586_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	26.3	1.3e-15
>prophage 84
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1186373	1192430	4162569		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
WP_007610477.1|1186373_1187231_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.2	1.4e-53
WP_094247093.1|1187355_1188879_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024085090.1|1189001_1190294_+	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.2	1.5e-09
WP_094247094.1|1190424_1190982_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_094247095.1|1190993_1192430_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.3	1.0e-24
>prophage 85
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1195515	1200098	4162569		Bacillus_phage(50.0%)	4	NA	NA
WP_077722018.1|1195515_1196664_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	46.0	1.5e-50
WP_003155197.1|1196708_1197959_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_063174170.1|1198113_1198509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247097.1|1198556_1200098_-	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.7	3.1e-43
>prophage 86
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1221395	1224284	4162569		Staphylococcus_phage(33.33%)	3	NA	NA
WP_003155231.1|1221395_1222139_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	5.4e-25
WP_065180668.1|1222630_1223068_+	HIT family protein	NA	X4YER2	Lactococcus_phage	33.0	6.2e-05
WP_065180669.1|1223204_1224284_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.7	5.9e-81
>prophage 87
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1236022	1236919	4162569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003155257.1|1236022_1236919_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	2.0e-26
>prophage 88
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1250516	1255415	4162569		Bacillus_phage(100.0%)	4	NA	NA
WP_003155280.1|1250516_1250723_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	80.6	4.6e-19
WP_003155285.1|1250978_1251599_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_070081573.1|1251639_1253661_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	6.3e-44
WP_094247103.1|1253657_1255415_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.3	2.2e-48
>prophage 89
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1259651	1263112	4162569		Staphylococcus_phage(66.67%)	5	NA	NA
WP_070081571.1|1259651_1260395_-	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	30.5	3.6e-21
WP_003155296.1|1260446_1261562_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003155299.1|1261724_1261829_-	YhdX family protein	NA	NA	NA	NA	NA
WP_077722000.1|1261998_1262715_+	hypothetical protein	NA	A0A220BY94	Staphylococcus_phage	34.7	2.2e-31
WP_070081569.1|1262716_1263112_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	39.7	5.8e-10
>prophage 90
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1275524	1279453	4162569		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_094247109.1|1275524_1276394_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.2	4.3e-50
WP_024085068.1|1276472_1277576_-	citrate synthase/methylcitrate synthase	NA	NA	NA	NA	NA
WP_094247110.1|1277685_1278564_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014417294.1|1278628_1279453_-	C40 family peptidase	NA	U5PW24	Bacillus_virus	44.9	7.8e-17
>prophage 91
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1285166	1286612	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_077721993.1|1285166_1286612_+	peptidoglycan endopeptidase	NA	M1HNA7	Bacillus_virus	34.0	1.7e-11
>prophage 92
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1289875	1291618	4162569		Streptococcus_phage(100.0%)	1	NA	NA
WP_071392057.1|1289875_1291618_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	50.9	3.4e-163
>prophage 93
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1295070	1295898	4162569		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_077721989.1|1295070_1295898_-	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	34.4	9.5e-31
>prophage 94
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1299790	1302574	4162569		Synechococcus_phage(33.33%)	4	NA	NA
WP_003155347.1|1299790_1300480_-	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	5.2e-06
WP_007408449.1|1300607_1301030_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.2	2.3e-12
WP_007408448.1|1301160_1301556_-	DUF5365 family protein	NA	NA	NA	NA	NA
WP_094247113.1|1301665_1302574_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.7	7.3e-08
>prophage 95
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1309957	1315133	4162569		Staphylococcus_phage(50.0%)	6	NA	NA
WP_094247117.1|1309957_1311037_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.7e-16
WP_094247118.1|1311053_1311884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155376.1|1312266_1312467_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	62.1	3.2e-17
WP_094247119.1|1312558_1313506_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_071392066.1|1313498_1314416_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.6	1.4e-38
WP_094247120.1|1314416_1315133_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	4.7e-18
>prophage 96
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1320314	1323585	4162569		Bacillus_phage(50.0%)	2	NA	NA
WP_094247122.1|1320314_1321499_-	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	44.0	3.0e-25
WP_069473222.1|1321689_1323585_-	serine/threonine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.1	8.1e-102
>prophage 97
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1333995	1339634	4162569		Bacillus_virus(33.33%)	5	NA	NA
WP_003155413.1|1333995_1334763_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	3.6e-32
WP_058906660.1|1334986_1335916_-	amidohydrolase	NA	NA	NA	NA	NA
WP_070081535.1|1336172_1337618_+	catalase	NA	A0A2K9L0T1	Tupanvirus	41.5	3.1e-109
WP_094247130.1|1337689_1338655_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_094247131.1|1338647_1339634_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.8	8.8e-15
>prophage 98
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1343736	1345092	4162569		Pandoravirus(100.0%)	1	NA	NA
WP_069473670.1|1343736_1345092_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	40.2	9.5e-44
>prophage 99
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1360874	1362617	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_145956745.1|1360874_1362617_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	3.1e-47
>prophage 100
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1370015	1372067	4162569		Salmonella_phage(50.0%)	2	NA	NA
WP_003155484.1|1370015_1370996_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.3	1.5e-59
WP_070081525.1|1371206_1372067_-	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	26.4	2.2e-06
>prophage 101
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1384010	1386105	4162569		Mycobacterium_phage(50.0%)	2	NA	NA
WP_094247142.1|1384010_1385603_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.1	2.3e-20
WP_094247143.1|1385562_1386105_-	bacillithiol transferase BstA	NA	D0R7I3	Paenibacillus_phage	44.0	3.6e-18
>prophage 102
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1394379	1397911	4162569		Bacillus_phage(100.0%)	2	NA	NA
WP_094247147.1|1394379_1396197_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	7.2e-55
WP_070081512.1|1396177_1397911_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	1.5e-46
>prophage 103
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1412597	1413998	4162569		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_094247153.1|1412597_1413998_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.9	1.8e-85
>prophage 104
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1430878	1431394	4162569		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_003155578.1|1430878_1431394_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.9	1.3e-09
>prophage 105
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1444630	1446568	4162569		Streptococcus_phage(100.0%)	1	NA	NA
WP_017419102.1|1444630_1446568_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.1	2.7e-137
>prophage 106
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1450260	1450395	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_003155609.1|1450260_1450395_+	YflJ family protein	NA	G3MBD1	Bacillus_virus	61.0	1.9e-05
>prophage 107
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1458420	1461618	4162569		Cedratvirus(100.0%)	1	NA	NA
WP_094247163.1|1458420_1461618_-	hypothetical protein	NA	A0A1M7XUW2	Cedratvirus	63.1	5.5e-42
>prophage 108
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1475913	1485724	4162569		Tupanvirus(40.0%)	8	NA	NA
WP_017419086.1|1475913_1477044_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	32.5	9.3e-45
WP_012117051.1|1477215_1478772_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	8.9e-54
WP_094247169.1|1478815_1480000_-	MFS transporter	NA	NA	NA	NA	NA
WP_003155658.1|1480063_1480486_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094247170.1|1480676_1482566_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	4.1e-53
WP_014304590.1|1482724_1483792_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014304589.1|1483838_1484738_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	50.0	8.1e-68
WP_003155664.1|1484869_1485724_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.6	3.6e-09
>prophage 109
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1493281	1500776	4162569		Tupanvirus(33.33%)	4	NA	NA
WP_032865771.1|1493281_1494250_-	GDP-mannose 4,6-dehydratase	NA	A0A2K9L0I7	Tupanvirus	29.2	3.6e-29
WP_094247174.1|1494256_1495021_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003155677.1|1495236_1497165_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.5	1.1e-130
WP_094247175.1|1497590_1500776_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	36.8	5.6e-79
>prophage 110
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1505228	1506299	4162569		Planktothrix_phage(100.0%)	1	NA	NA
WP_094247179.1|1505228_1506299_-	TOBE-like domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.5	3.6e-30
>prophage 111
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1511272	1572679	4162569	coat,transposase,tRNA	Synechococcus_phage(18.18%)	55	NA	NA
WP_094246999.1|1511272_1512422_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
WP_024084984.1|1512481_1513171_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_017419062.1|1513284_1513563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060674483.1|1513593_1514127_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155700.1|1514215_1514785_-|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_003155702.1|1514799_1515063_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_003155704.1|1515046_1515295_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_094247181.1|1515427_1516297_-	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	59.0	7.5e-95
WP_094247182.1|1516488_1516791_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_071181621.1|1516970_1517690_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_094247893.1|1517988_1519992_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	51.9	4.0e-131
WP_071391416.1|1519996_1520467_+	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_071391415.1|1520888_1521764_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_071391414.1|1521764_1522718_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.1e-17
WP_071391413.1|1523137_1525090_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_094247183.1|1525270_1526647_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	45.5	9.1e-111
WP_025649900.1|1526794_1527706_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.3	5.8e-21
WP_025649899.1|1527858_1531002_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	1.9e-63
WP_017419038.1|1531130_1531979_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003155730.1|1532041_1533472_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017419037.1|1533485_1534943_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003155732.1|1534957_1535248_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_007408914.1|1535669_1537148_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_014417117.1|1537268_1537961_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.9	2.0e-18
WP_017419036.1|1537998_1538994_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
WP_094247184.1|1539230_1540427_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_029326170.1|1540442_1542449_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	39.8	7.7e-127
WP_071391407.1|1542473_1544693_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.3	1.3e-135
WP_094247185.1|1544750_1545440_-	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_073981994.1|1545635_1547210_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_003155745.1|1547244_1547556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247186.1|1547558_1548554_-	DUF3048 domain-containing protein	NA	NA	NA	NA	NA
WP_094247187.1|1548578_1550321_-	adenine deaminase	NA	NA	NA	NA	NA
WP_003155749.1|1550441_1550672_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_017419029.1|1550838_1552107_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_025649895.1|1552122_1553661_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	8.7e-78
WP_025649894.1|1553657_1554245_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.7	4.2e-25
WP_025649893.1|1554241_1555282_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	2.4e-63
WP_007408900.1|1555373_1556804_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_025649892.1|1556779_1559008_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	5.5e-158
WP_007609853.1|1558991_1559675_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003155758.1|1559671_1559926_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_007609852.1|1559925_1560645_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	44.7	1.3e-47
WP_025649890.1|1560720_1562013_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_050586600.1|1562012_1563194_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003155768.1|1563147_1563636_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.6	7.4e-23
WP_007609843.1|1563948_1564146_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_014469850.1|1564142_1564697_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_076983297.1|1564815_1564989_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_014304542.1|1565127_1565910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007408891.1|1566107_1567430_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.0	4.1e-36
WP_094247188.1|1567786_1569229_-	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_025649887.1|1569210_1569744_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_094246999.1|1569918_1571068_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
WP_094247895.1|1571137_1572679_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.0	1.2e-21
>prophage 112
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1603929	1611218	4162569	tRNA	uncultured_virus(50.0%)	5	NA	NA
WP_017418990.1|1603929_1605381_+|tRNA	class I tRNA ligase family protein	tRNA	A0A2H4PQS0	Staphylococcus_phage	27.1	4.9e-06
WP_017418989.1|1605892_1606813_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017418988.1|1606809_1608039_-	5-aminolevulinate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	30.1	1.2e-40
WP_003155941.1|1609257_1610892_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
WP_003155970.1|1610933_1611218_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
>prophage 113
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1614668	1617860	4162569	tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_017418987.1|1614668_1616597_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.1	3.3e-58
WP_025649875.1|1616819_1617860_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	1.2e-62
>prophage 114
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1628142	1629293	4162569	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_094246999.1|1628142_1629293_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
>prophage 115
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1640506	1644009	4162569		Mycobacterium_phage(50.0%)	4	NA	NA
WP_063636949.1|1640506_1641865_-	serine hydrolase	NA	A0A0A0RQ62	Mycobacterium_phage	24.7	6.9e-10
WP_007409303.1|1642002_1642272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417054.1|1642503_1642758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012116955.1|1642815_1644009_-	UDP-glucosyltransferase	NA	O89808	Epiphyas_postvittana_nucleopolyhedrovirus	27.1	5.1e-09
>prophage 116
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1657933	1662609	4162569	coat	Streptococcus_phage(50.0%)	6	NA	NA
WP_094247200.1|1657933_1659562_+	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	27.8	4.8e-50
WP_022552672.1|1659699_1660422_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_155641731.1|1660455_1660650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032866792.1|1660822_1661068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039062697.1|1661085_1661454_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_039062696.1|1661472_1662609_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.3	5.9e-15
>prophage 117
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1666269	1668026	4162569		Bacillus_phage(100.0%)	2	NA	NA
WP_039062691.1|1666269_1667343_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.8	1.9e-23
WP_039062690.1|1667339_1668026_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.5	9.6e-45
>prophage 118
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1673449	1684066	4162569		Tupanvirus(20.0%)	12	NA	NA
WP_007609682.1|1673449_1674499_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	41.2	1.6e-67
WP_039062684.1|1674557_1675520_-	arsenic resistance protein	NA	NA	NA	NA	NA
WP_039062683.1|1675707_1676946_-	HAD-IIA family hydrolase	NA	A0A192YCC8	Morganella_phage	42.9	9.3e-06
WP_039062682.1|1676954_1677773_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_039062681.1|1677787_1678546_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020955392.1|1678542_1679553_-	thymidylate synthase	NA	A0A0K0N6Z8	Gordonia_phage	37.6	1.4e-12
WP_032866832.1|1679549_1680014_-	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_031378624.1|1680282_1680663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247897.1|1680721_1681162_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_094247896.1|1681392_1681890_+	DinB family protein	NA	NA	NA	NA	NA
WP_070081417.1|1682146_1682680_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	68.4	4.7e-55
WP_094247205.1|1683028_1684066_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	26.2	2.2e-16
>prophage 119
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1693917	1694121	4162569		Lactococcus_phage(100.0%)	1	NA	NA
WP_003156143.1|1693917_1694121_-	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	75.4	2.2e-21
>prophage 120
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1697743	1700655	4162569		Moumouvirus(50.0%)	2	NA	NA
WP_094247215.1|1697743_1698691_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	40.8	2.6e-64
WP_029974209.1|1699251_1700655_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.3	5.9e-57
>prophage 121
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1704953	1705403	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_015416877.1|1704953_1705403_-	SprT family protein	NA	U5J9G1	Bacillus_phage	25.7	4.0e-07
>prophage 122
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1708459	1709248	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_003156171.1|1708459_1709248_-	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	35.1	2.6e-25
>prophage 123
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1712817	1714744	4162569		Lactobacillus_phage(50.0%)	3	NA	NA
WP_003156187.1|1712817_1713168_-	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	5.8e-14
WP_003156188.1|1713173_1713455_-	type II toxin-antitoxin system antitoxin EndoAI	NA	NA	NA	NA	NA
WP_077721837.1|1713574_1714744_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	34.7	7.6e-34
>prophage 124
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1719137	1720622	4162569		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_025853729.1|1719137_1720622_-	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.8	1.4e-61
>prophage 125
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1723638	1723956	4162569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003156200.1|1723638_1723956_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	32.0	1.8e-06
>prophage 126
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1727848	1728775	4162569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_094247222.1|1727848_1728775_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.0	2.6e-37
>prophage 127
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1747332	1751073	4162569		Bacillus_phage(50.0%)	6	NA	NA
WP_094247899.1|1747332_1747518_-	peptidoglycan-binding protein	NA	F8WPX5	Bacillus_phage	60.0	1.2e-13
WP_094247225.1|1747537_1747699_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JIA8	Bacillus_phage	68.4	1.7e-05
WP_128969825.1|1747760_1748150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247226.1|1748284_1748722_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_039252713.1|1748847_1750569_-	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	26.1	4.1e-36
WP_017419242.1|1750626_1751073_-	NUDIX hydrolase	NA	Q56BL2	Escherichia_virus	42.9	2.8e-05
>prophage 128
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1760615	1762802	4162569		Streptococcus_phage(100.0%)	1	NA	NA
WP_029326219.1|1760615_1762802_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.3	4.6e-40
>prophage 129
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1766766	1772807	4162569		Diadromus_pulchellus_ascovirus(33.33%)	4	NA	NA
WP_094247229.1|1766766_1767627_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	37.7	2.0e-47
WP_063174392.1|1767784_1769299_-	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	26.3	3.9e-38
WP_094247230.1|1769520_1771605_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_017419253.1|1771904_1772807_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	26.1	2.7e-10
>prophage 130
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1790193	1790979	4162569		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_070081367.1|1790193_1790979_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.1e-23
>prophage 131
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1794926	1796336	4162569		Streptococcus_phage(100.0%)	1	NA	NA
WP_017419268.1|1794926_1796336_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.6	5.2e-21
>prophage 132
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1801355	1809624	4162569		Bacillus_phage(60.0%)	9	NA	NA
WP_022552588.1|1801355_1802114_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	29.8	4.5e-19
WP_014416905.1|1802107_1803055_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_003156332.1|1803044_1803998_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	52.7	1.0e-92
WP_070081361.1|1804412_1805777_+	aspartate kinase	NA	NA	NA	NA	NA
WP_012116800.1|1805871_1805967_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003156334.1|1806116_1806236_-	PhrC/PhrF family phosphatase-inhibitory pheromone	NA	NA	NA	NA	NA
WP_003156336.1|1806219_1807368_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	44.6	2.7e-84
WP_161941456.1|1807520_1808954_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.6	1.7e-38
WP_094247243.1|1808940_1809624_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.2	1.9e-45
>prophage 133
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1814586	1815336	4162569		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_025853765.1|1814586_1815336_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	3.3e-14
>prophage 134
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1823297	1826800	4162569		Bacillus_phage(50.0%)	2	NA	NA
WP_094247245.1|1823297_1825043_-	right-handed parallel beta-helix repeat-containing protein	NA	U5PSS0	Bacillus_phage	42.8	5.5e-113
WP_003156366.1|1825321_1826800_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	39.4	5.6e-82
>prophage 135
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1832180	1832924	4162569		Planktothrix_phage(100.0%)	1	NA	NA
WP_077721779.1|1832180_1832924_+	cystine ABC transporter ATP-binding protein TcyC	NA	G9BWD6	Planktothrix_phage	38.1	1.8e-33
>prophage 136
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1836644	1865222	4162569		Tupanvirus(75.0%)	7	NA	NA
WP_094247246.1|1836644_1840481_-	surfactin non-ribosomal peptide synthetase SrfAC	NA	A0A2K9KZV5	Tupanvirus	27.0	2.3e-87
WP_094247247.1|1840515_1851276_-	surfactin non-ribosomal peptide synthetase SrfAB	NA	A0A2K9KZV5	Tupanvirus	27.6	9.8e-168
WP_094247248.1|1851297_1862052_-	surfactin non-ribosomal peptide synthetase SrfAA	NA	A0A2K9KZV5	Tupanvirus	27.5	3.3e-163
WP_014304320.1|1862640_1863003_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014304319.1|1863234_1863870_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_014304318.1|1863866_1864424_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_003156588.1|1864784_1865222_+	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	62.6	1.2e-37
>prophage 137
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1874071	1875082	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_094247252.1|1874071_1875082_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	27.0	1.1e-17
>prophage 138
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1879783	1881668	4162569		Staphylococcus_phage(50.0%)	2	NA	NA
WP_088037528.1|1879783_1880695_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	40.6	1.8e-62
WP_025650333.1|1880882_1881668_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	42.7	1.9e-41
>prophage 139
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1886981	1887800	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_007409061.1|1886981_1887800_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.7	2.9e-96
>prophage 140
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1903107	1904364	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_094247260.1|1903107_1904364_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.3	1.1e-33
>prophage 141
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1910321	1921341	4162569		Bacillus_phage(37.5%)	12	NA	NA
WP_003156644.1|1910321_1911095_-	TerC family protein	NA	S5MAL1	Bacillus_phage	63.9	9.4e-81
WP_003156645.1|1911133_1911712_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.1	1.1e-28
WP_003156648.1|1911745_1912327_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.4	4.3e-30
WP_003156649.1|1912350_1912947_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	32.4	1.5e-25
WP_094247265.1|1913222_1914218_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003156653.1|1914264_1915104_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003156655.1|1915061_1915757_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.2e-15
WP_094247903.1|1915811_1916762_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_094247266.1|1916948_1918628_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_094247267.1|1918711_1919491_-	glucose 1-dehydrogenase	NA	A0A0G2Y8L6	Acanthamoeba_polyphaga_mimivirus	31.2	1.5e-06
WP_003156660.1|1919606_1920728_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	36.9	1.4e-64
WP_077721755.1|1920837_1921341_+	M15 family metallopeptidase	NA	A0A127AWA8	Bacillus_phage	58.6	6.6e-35
>prophage 142
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1930469	1934517	4162569		Mycobacterium_phage(50.0%)	4	NA	NA
WP_007609218.1|1930469_1931909_+	lincomycin efflux MFS transporter Lmr(B)	NA	A0A0M3UL24	Mycobacterium_phage	23.9	6.3e-14
WP_094247269.1|1931945_1933073_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_094247270.1|1933144_1933792_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_094247271.1|1933788_1934517_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	27.0	3.9e-20
>prophage 143
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1968646	1973791	4162569		Staphylococcus_phage(50.0%)	4	NA	NA
WP_017419318.1|1968646_1969534_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	40.5	1.7e-41
WP_014720665.1|1969715_1969964_-	DUF2651 family protein	NA	NA	NA	NA	NA
WP_025650166.1|1970037_1971240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025650165.1|1971901_1973791_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	30.3	1.2e-07
>prophage 144
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1980549	1981485	4162569		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_094247282.1|1980549_1981485_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.1	9.5e-27
>prophage 145
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	1993491	1996798	4162569		Staphylococcus_phage(50.0%)	2	NA	NA
WP_094247287.1|1993491_1994364_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	6.5e-22
WP_003156758.1|1994995_1996798_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	40.4	8.3e-104
>prophage 146
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2006525	2007809	4162569		Mycobacterium_phage(100.0%)	1	NA	NA
WP_094247289.1|2006525_2007809_+	penicillin binding protein PBP4B	NA	A0A088FA76	Mycobacterium_phage	24.8	2.8e-05
>prophage 147
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2017674	2022576	4162569		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_094247295.1|2017674_2019108_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.9	5.9e-137
WP_003156784.1|2019339_2020386_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	27.0	8.7e-13
WP_094247296.1|2020360_2021311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039252950.1|2021307_2022576_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	30.0	5.6e-22
>prophage 148
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2043652	2045343	4162569		Staphylococcus_phage(50.0%)	2	NA	NA
WP_014416754.1|2043652_2044522_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	3.6e-12
WP_007615256.1|2044497_2045343_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	1.0e-19
>prophage 149
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2063065	2073902	4162569		Streptococcus_phage(33.33%)	6	NA	NA
WP_007410399.1|2063065_2065144_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	2.4e-62
WP_003156447.1|2065196_2065667_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003156445.1|2065709_2066126_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003156443.1|2066241_2066490_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_007410398.1|2066658_2070258_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.1	8.9e-65
WP_003156440.1|2070320_2073902_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.4	4.0e-49
>prophage 150
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2077397	2077931	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_003156423.1|2077397_2077931_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.8	5.4e-11
>prophage 151
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2080949	2082350	4162569	tRNA	Catovirus(100.0%)	1	NA	NA
WP_003156411.1|2080949_2082350_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.4	4.4e-60
>prophage 152
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2089806	2092239	4162569	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_007410388.1|2089806_2092239_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	35.4	4.4e-132
>prophage 153
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2105623	2107123	4162569	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_014304211.1|2105623_2107123_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.2	1.2e-95
>prophage 154
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2110971	2119460	4162569	protease	Acinetobacter_phage(20.0%)	8	NA	NA
WP_003150674.1|2110971_2111559_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	57.0	8.8e-63
WP_094247905.1|2111565_2112987_-	aminodeoxychorismate synthase, component I	NA	A0A0B5J984	Pandoravirus	30.7	1.9e-34
WP_032872203.1|2113154_2114081_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.5	2.6e-109
WP_025650394.1|2114156_2115047_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_004264606.1|2115092_2115968_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_025650393.1|2115978_2116755_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_004264608.1|2116903_2118823_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.0	8.5e-115
WP_004264611.1|2118920_2119460_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	24.3	1.0e-04
>prophage 155
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2131115	2131652	4162569		Paenibacillus_phage(100.0%)	1	NA	NA
WP_015416660.1|2131115_2131652_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 156
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2137027	2139373	4162569		Hokovirus(50.0%)	2	NA	NA
WP_004264656.1|2137027_2137981_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.1	1.7e-44
WP_094247305.1|2138002_2139373_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	34.8	7.1e-31
>prophage 157
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2145795	2159182	4162569	tRNA	Streptococcus_phage(37.5%)	15	NA	NA
WP_094247906.1|2145795_2147121_-	DUF348 domain-containing protein	NA	A0A0E3D983	Bacillus_phage	73.0	5.3e-23
WP_032868379.1|2147255_2148023_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_025854082.1|2148098_2150090_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.6	1.2e-100
WP_169510469.1|2150572_2150863_+	transition state genes transcriptional regulator AbrB	NA	A0A2I7SC16	Paenibacillus_phage	71.4	1.0e-16
WP_094247307.1|2150913_2151795_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.8	2.3e-67
WP_007409921.1|2151769_2152069_-	GIY-YIG nuclease family protein	NA	A0A068LKN9	Peridroma_alphabaculovirus	40.3	9.4e-05
WP_004264717.1|2152055_2152799_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004264720.1|2152859_2153219_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_004264723.1|2153233_2154061_-	competence/sporulation regulator complex protein RicT	NA	NA	NA	NA	NA
WP_094247308.1|2154063_2155053_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.1	5.5e-33
WP_004264730.1|2155064_2155505_-	DUF327 family protein	NA	NA	NA	NA	NA
WP_004264734.1|2155517_2155847_-	cyclic di-AMP receptor DarA	NA	NA	NA	NA	NA
WP_004264737.1|2155917_2156556_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	56.4	1.4e-58
WP_094247309.1|2156552_2157986_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_094247310.1|2158063_2159182_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	29.0	8.6e-35
>prophage 158
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2167099	2168791	4162569		Clostridium_phage(100.0%)	1	NA	NA
WP_003150701.1|2167099_2168791_-	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	35.1	9.6e-54
>prophage 159
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2171840	2180953	4162569	tRNA	Lactobacillus_virus(16.67%)	8	NA	NA
WP_094247312.1|2171840_2172464_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	33.5	3.1e-18
WP_015388792.1|2172460_2173114_+	deoxynucleoside kinase	NA	A0A127AVX2	Bacillus_phage	35.7	3.6e-25
WP_094247313.1|2173554_2174700_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.7	5.7e-50
WP_003150709.1|2174711_2175989_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.5	1.7e-98
WP_007615126.1|2176308_2176899_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_003150714.1|2176920_2177805_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_077721682.1|2178002_2179334_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.8	5.5e-20
WP_003150717.1|2179486_2180953_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	4.2e-98
>prophage 160
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2187362	2194891	4162569		Bacillus_virus(66.67%)	6	NA	NA
WP_004392898.1|2187362_2189822_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.7	6.0e-113
WP_004392900.1|2190037_2191954_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.1	3.5e-153
WP_004392908.1|2192013_2192259_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_094247314.1|2192276_2193389_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004392910.1|2193404_2193620_-	ribosome maturation protein RlbA	NA	NA	NA	NA	NA
WP_094247315.1|2193754_2194891_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	32.9	1.1e-16
>prophage 161
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2203651	2207050	4162569	protease	Leptospira_phage(25.0%)	4	NA	NA
WP_007409900.1|2203651_2204503_+	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	35.7	2.8e-17
WP_007409899.1|2204801_2205563_+	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	30.6	5.0e-26
WP_004392966.1|2205555_2206407_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	38.2	2.3e-19
WP_004392969.1|2206435_2207050_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	42.3	2.4e-18
>prophage 162
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2212892	2215773	4162569		Bacillus_phage(33.33%)	5	NA	NA
WP_004392979.1|2212892_2213411_+	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	70.9	2.1e-52
WP_004392983.1|2213454_2213694_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_025854038.1|2213882_2214464_+	methylphosphotriester-DNA--protein-cysteine methyltransferase family protein	NA	NA	NA	NA	NA
WP_048367907.1|2214460_2214988_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.1	2.6e-18
WP_094247317.1|2215014_2215773_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	45.5	6.6e-63
>prophage 163
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2222141	2223569	4162569		Lactococcus_phage(100.0%)	1	NA	NA
WP_094247319.1|2222141_2223569_-	SIR2 family protein	NA	Q38324	Lactococcus_phage	27.7	1.0e-16
>prophage 164
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2228291	2230394	4162569		Streptococcus_phage(50.0%)	3	NA	NA
WP_014306188.1|2228291_2229170_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.2	5.7e-34
WP_032875377.1|2229307_2229742_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004393039.1|2229755_2230394_+	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	49.0	3.1e-05
>prophage 165
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2233742	2235299	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_094247908.1|2233742_2235299_-	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	38.2	4.2e-88
>prophage 166
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2251742	2265085	4162569	protease	Bacillus_phage(42.86%)	11	NA	NA
WP_004393100.1|2251742_2253107_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.1	3.6e-128
WP_017418495.1|2253224_2253638_+	VOC family protein	NA	NA	NA	NA	NA
WP_004393102.1|2253876_2255169_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.9	1.4e-68
WP_004393104.1|2256133_2256841_+	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	42.3	1.2e-45
WP_004393106.1|2256847_2258683_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.5	3.4e-36
WP_014419341.1|2258672_2260031_+	regulatory protein	NA	NA	NA	NA	NA
WP_017418497.1|2260017_2260857_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_007407895.1|2260871_2261666_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	34.1	4.1e-39
WP_094247331.1|2261752_2262949_+|protease	serine protease	protease	W5SAB9	Pithovirus	31.7	7.1e-11
WP_004393115.1|2263457_2263670_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094247332.1|2263666_2265085_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	3.9e-32
>prophage 167
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2268879	2279057	4162569		Klosneuvirus(40.0%)	9	NA	NA
WP_094247335.1|2268879_2270505_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.5	5.4e-46
WP_048367869.1|2270518_2271238_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_094247909.1|2271279_2272665_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_058906481.1|2272868_2273156_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	6.3e-06
WP_058906480.1|2273152_2273788_+	SdpI family protein	NA	NA	NA	NA	NA
WP_094247336.1|2274017_2275223_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	3.4e-29
WP_004393132.1|2275446_2276847_+	amino acid permease	NA	NA	NA	NA	NA
WP_014306158.1|2276920_2277811_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	9.9e-26
WP_046560175.1|2277941_2279057_+	aspartate phosphatase	NA	D6R410	Bacillus_phage	30.5	6.4e-38
>prophage 168
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2287684	2288677	4162569		Lactococcus_phage(100.0%)	1	NA	NA
WP_020958089.1|2287684_2288677_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	29.0	5.7e-14
>prophage 169
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2303967	2305497	4162569		Lactococcus_phage(100.0%)	1	NA	NA
WP_007614902.1|2303967_2305497_-	alkyl hydroperoxide reductase subunit F	NA	V9VEY6	Lactococcus_phage	29.4	3.7e-20
>prophage 170
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2318309	2323505	4162569		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_007614881.1|2318309_2320190_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	33.1	1.3e-83
WP_004393218.1|2320232_2321621_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_070082618.1|2321739_2322672_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_004393223.1|2322749_2323505_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.5	1.4e-20
>prophage 171
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2337141	2337915	4162569		Planktothrix_phage(100.0%)	1	NA	NA
WP_094247360.1|2337141_2337915_+	ABC transporter ATP-binding protein YxdL	NA	G9BWD6	Planktothrix_phage	36.8	7.6e-30
>prophage 172
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2347602	2348904	4162569		Geobacillus_virus(100.0%)	1	NA	NA
WP_094247365.1|2347602_2348904_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	60.5	2.7e-133
>prophage 173
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2354303	2355842	4162569		Catovirus(100.0%)	1	NA	NA
WP_094247366.1|2354303_2355842_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	9.6e-93
>prophage 174
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2360441	2362128	4162569		Thermus_virus(50.0%)	2	NA	NA
WP_032875608.1|2360441_2361548_-	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	31.9	1.6e-33
WP_024085991.1|2361717_2362128_+	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	37.8	2.1e-15
>prophage 175
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2380212	2381652	4162569		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_007407785.1|2380212_2381652_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	34.8	4.5e-60
>prophage 176
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2386437	2388489	4162569		Tupanvirus(100.0%)	1	NA	NA
WP_094247377.1|2386437_2388489_+	catalase	NA	A0A2K9L0T1	Tupanvirus	52.9	5.8e-154
>prophage 177
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2393256	2394393	4162569		uncultured_virus(100.0%)	1	NA	NA
WP_079004947.1|2393256_2394393_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.5	1.8e-88
>prophage 178
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2397407	2416546	4162569		Tupanvirus(25.0%)	15	NA	NA
WP_065180333.1|2397407_2398424_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	50.2	6.8e-95
WP_119834765.1|2398470_2399010_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_003150818.1|2399523_2400360_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.3	2.3e-40
WP_094247380.1|2400526_2401420_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014306096.1|2401537_2402638_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	1.6e-20
WP_094247381.1|2402737_2403580_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014306094.1|2403614_2404958_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	25.7	2.3e-05
WP_003150828.1|2405460_2406867_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003150830.1|2406850_2407867_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_070082577.1|2407866_2409570_+	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	31.9	1.9e-17
WP_077723035.1|2409566_2411297_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	22.3	2.1e-16
WP_003150837.1|2411387_2412218_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_014306090.1|2412231_2413590_-	cytosine permease	NA	NA	NA	NA	NA
WP_025853653.1|2413906_2414893_+	choloylglycine hydrolase family protein	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	30.0	6.7e-31
WP_077723034.1|2414932_2416546_-	catalase	NA	A0A2K9L572	Tupanvirus	45.1	1.8e-97
>prophage 179
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2419567	2424794	4162569		Pandoravirus(33.33%)	5	NA	NA
WP_025650059.1|2419567_2420968_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.0	6.1e-46
WP_025650060.1|2420997_2422317_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003150849.1|2422335_2422653_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_017418621.1|2423131_2424430_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	65.6	3.3e-155
WP_014306081.1|2424443_2424794_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.3	9.3e-12
>prophage 180
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2437131	2448242	4162569		Pseudomonas_phage(20.0%)	10	NA	NA
WP_094247387.1|2437131_2438313_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	25.4	9.2e-19
WP_094247388.1|2438309_2439821_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2H4PQU7	Staphylococcus_phage	24.7	7.1e-16
WP_003150882.1|2439836_2439986_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003150884.1|2440429_2441365_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_007407732.1|2441495_2442128_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003150888.1|2442387_2443248_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.5	3.2e-05
WP_094247916.1|2443305_2445051_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	41.3	7.9e-43
WP_094247389.1|2445212_2446547_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_014419203.1|2446576_2446960_-	VOC family protein	NA	NA	NA	NA	NA
WP_070082561.1|2447054_2448242_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	43.9	2.2e-76
>prophage 181
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2470410	2472822	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_094247396.1|2470410_2472822_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.8	3.8e-19
>prophage 182
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2476111	2477551	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_094247399.1|2476111_2477551_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.8	7.7e-20
>prophage 183
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2481326	2482010	4162569		Canid_alphaherpesvirus(100.0%)	1	NA	NA
WP_012118732.1|2481326_2482010_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
>prophage 184
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2485137	2485908	4162569		uncultured_marine_virus(100.0%)	1	NA	NA
WP_003150972.1|2485137_2485908_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
>prophage 185
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2492279	2494836	4162569		Bacillus_virus(33.33%)	3	NA	NA
WP_003150981.1|2492279_2493017_+	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_094247409.1|2493019_2493967_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.6	1.3e-68
WP_024085934.1|2493987_2494836_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
>prophage 186
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2502409	2507308	4162569		Salmonella_phage(50.0%)	5	NA	NA
WP_094247411.1|2502409_2503612_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	5.5e-27
WP_096034908.1|2503835_2505074_+	MFS transporter	NA	NA	NA	NA	NA
WP_003150997.1|2505235_2505850_+	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_003151000.1|2505839_2506550_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_038460243.1|2506546_2507308_+	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	1.3e-21
>prophage 187
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2515178	2516078	4162569		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_007407666.1|2515178_2516078_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
>prophage 188
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2520824	2525640	4162569		Staphylococcus_phage(50.0%)	6	NA	NA
WP_003151027.1|2520824_2521745_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	8.4e-36
WP_003151028.1|2521842_2522397_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_014306027.1|2522397_2522712_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025649388.1|2522973_2523750_-	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151034.1|2523953_2524178_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_094247418.1|2524338_2525640_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.4e-23
>prophage 189
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2542749	2543895	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_094247421.1|2542749_2543895_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	42.9	3.2e-77
>prophage 190
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2553642	2555106	4162569		Escherichia_phage(100.0%)	1	NA	NA
WP_094247423.1|2553642_2555106_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.7	7.1e-21
>prophage 191
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2558804	2561902	4162569		Bacillus_phage(100.0%)	3	NA	NA
WP_017418722.1|2558804_2560532_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	1.1e-57
WP_003151087.1|2560598_2560871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017418723.1|2560939_2561902_-	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	35.3	9.1e-41
>prophage 192
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2566356	2570862	4162569		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_014419113.1|2566356_2567964_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	3.6e-151
WP_017418727.1|2568011_2568533_-	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_012118670.1|2568697_2569072_+	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	36.5	1.3e-11
WP_003151102.1|2569247_2570105_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_007407613.1|2570223_2570862_+	fructose-6-phosphate aldolase	NA	A0A1D7SX77	Cyanophage	50.0	4.3e-47
>prophage 193
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2575559	2576150	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_014306007.1|2575559_2576150_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	45.9	5.9e-35
>prophage 194
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2580369	2581440	4162569		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003151139.1|2580369_2581440_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	3.1e-05
>prophage 195
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2584523	2589252	4162569		Pandoravirus(50.0%)	6	NA	NA
WP_070082510.1|2584523_2585564_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	43.0	4.2e-60
WP_003151147.1|2585631_2586189_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_029325731.1|2586262_2586718_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_003151149.1|2586851_2587301_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_007407598.1|2587314_2587857_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_094247426.1|2588004_2589252_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.8	6.6e-100
>prophage 196
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2600691	2601723	4162569		Pseudomonas_phage(100.0%)	1	NA	NA
WP_014306003.1|2600691_2601723_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	37.1	5.0e-37
>prophage 197
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2606031	2607162	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_017418744.1|2606031_2607162_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	41.4	3.4e-79
>prophage 198
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2616499	2617369	4162569		Clostridium_phage(100.0%)	1	NA	NA
WP_017418752.1|2616499_2617369_+	M23 family metallopeptidase	NA	I3PV24	Clostridium_phage	38.3	1.1e-05
>prophage 199
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2627232	2627514	4162569		Clostridium_phage(100.0%)	1	NA	NA
WP_003151236.1|2627232_2627514_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	50.7	9.4e-15
>prophage 200
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2633733	2644726	4162569		Listeria_phage(25.0%)	10	NA	NA
WP_003151249.1|2633733_2634075_+	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	63.2	3.2e-33
WP_003151250.1|2634284_2635067_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_094247430.1|2635063_2635921_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_094247431.1|2636034_2638809_-	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	26.3	1.6e-37
WP_003151257.1|2638795_2640406_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_003151259.1|2640609_2640753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070082498.1|2640968_2641715_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_014305982.1|2641701_2642391_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	35.9	7.0e-27
WP_025649368.1|2642436_2643201_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_071182032.1|2643400_2644726_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.0	8.8e-87
>prophage 201
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2649674	2650391	4162569		Klosneuvirus(100.0%)	1	NA	NA
WP_094247434.1|2649674_2650391_+	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.2	3.8e-20
>prophage 202
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2660508	2662943	4162569		Staphylococcus_phage(50.0%)	2	NA	NA
WP_025853570.1|2660508_2661840_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	30.2	1.8e-55
WP_003151316.1|2662034_2662943_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	1.2e-10
>prophage 203
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2668877	2670371	4162569		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_094247441.1|2668877_2670371_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	4.3e-13
>prophage 204
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2680273	2681509	4162569		Clostridioides_phage(100.0%)	1	NA	NA
WP_077722947.1|2680273_2681509_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.7	1.8e-17
>prophage 205
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2684685	2686062	4162569		Aichi_virus(100.0%)	1	NA	NA
WP_094247445.1|2684685_2686062_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	30.5	8.1e-35
>prophage 206
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2692570	2699667	4162569		Staphylococcus_phage(33.33%)	5	NA	NA
WP_094247447.1|2692570_2695216_+	glucosaminidase domain-containing protein	NA	A0A1W6JQU5	Staphylococcus_phage	44.3	1.7e-36
WP_025853551.1|2695276_2696443_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_025853550.1|2696475_2697246_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_025853549.1|2697601_2697991_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	43.4	1.1e-18
WP_025853548.1|2698128_2699667_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.7	7.8e-10
>prophage 207
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2704508	2711875	4162569		Bacillus_phage(50.0%)	6	NA	NA
WP_003151367.1|2704508_2705393_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.7	6.7e-83
WP_015387618.1|2705621_2706761_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.7	2.4e-24
WP_003151369.1|2706793_2707711_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151370.1|2707892_2708210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003151371.1|2708242_2710363_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	28.8	5.3e-17
WP_015387619.1|2710384_2711875_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	31.3	4.6e-15
>prophage 208
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2715435	2716776	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_094247449.1|2715435_2716776_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.4	5.6e-89
>prophage 209
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2723484	2728723	4162569		Streptococcus_phage(66.67%)	5	NA	NA
WP_060657503.1|2723484_2724132_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.1	9.7e-39
WP_003151385.1|2724354_2725518_+	two-component sensor histidine kinase DegS	NA	NA	NA	NA	NA
WP_094247453.1|2725594_2726284_+	two-component system response regulator DegU	NA	NA	NA	NA	NA
WP_003151387.1|2726381_2727230_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	7.5e-15
WP_094247454.1|2727337_2728723_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.2	5.1e-61
>prophage 210
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2734662	2734887	4162569		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003151402.1|2734662_2734887_+	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	49.0	6.4e-06
>prophage 211
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2745182	2749776	4162569		Planktothrix_phage(50.0%)	4	NA	NA
WP_003151418.1|2745182_2745869_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.8	3.8e-25
WP_013353766.1|2745861_2746752_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_071392356.1|2746798_2748205_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_094247455.1|2748372_2749776_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.8	2.5e-23
>prophage 212
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2755260	2763341	4162569		Hokovirus(50.0%)	4	NA	NA
WP_094247457.1|2755260_2757762_-	phosphotransferase	NA	A0A1V0SGR7	Hokovirus	30.7	3.6e-33
WP_003151438.1|2758062_2758299_+	CsbA family protein	NA	NA	NA	NA	NA
WP_015387640.1|2758474_2760460_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_071543379.1|2760467_2763341_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	0.0e+00
>prophage 213
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2784073	2795901	4162569		Bacillus_phage(50.0%)	10	NA	NA
WP_014418969.1|2784073_2785843_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	60.2	1.1e-164
WP_012118540.1|2786044_2786722_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	56.6	9.8e-66
WP_025649332.1|2786718_2787804_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	39.1	1.2e-62
WP_025649331.1|2787896_2789351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025649330.1|2789747_2791163_+	C40 family peptidase	NA	A0A0A0RVE6	Bacillus_phage	51.7	3.5e-25
WP_007407423.1|2791369_2792320_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.9	3.7e-87
WP_003151491.1|2792593_2793061_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_012118535.1|2793086_2793974_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.8	5.1e-06
WP_007407422.1|2793970_2794924_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	39.9	2.6e-64
WP_017418846.1|2794950_2795901_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	8.6e-52
>prophage 214
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2799558	2802204	4162569		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_025649327.1|2799558_2801148_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.6	2.2e-44
WP_003151506.1|2801192_2801513_-	hypothetical protein	NA	G3MBI9	Bacillus_virus	43.3	2.3e-17
WP_015387658.1|2801628_2802204_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	26.4	1.5e-11
>prophage 215
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2806039	2806636	4162569		Agrobacterium_phage(100.0%)	1	NA	NA
WP_003151513.1|2806039_2806636_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	7.5e-54
>prophage 216
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2819886	2830836	4162569		Mollivirus(25.0%)	10	NA	NA
WP_094247473.1|2819886_2821335_-	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	33.8	5.0e-35
WP_007407395.1|2821415_2821871_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071347564.1|2822116_2822824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003151543.1|2822829_2823510_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_014472284.1|2823732_2825550_+	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	29.3	5.9e-25
WP_094247474.1|2825565_2826705_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_013353690.1|2826701_2827544_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.7	7.0e-05
WP_094247475.1|2827536_2828673_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_094247476.1|2828676_2829780_+	EpsG family protein	NA	NA	NA	NA	NA
WP_013353687.1|2829798_2830836_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	43.5	6.0e-14
>prophage 217
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2835715	2836888	4162569		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_094247479.1|2835715_2836888_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.6	2.7e-10
>prophage 218
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2869608	2870901	4162569		Streptococcus_phage(100.0%)	1	NA	NA
WP_007409956.1|2869608_2870901_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	71.0	1.9e-174
>prophage 219
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2873903	2879545	4162569		Tupanvirus(33.33%)	6	NA	NA
WP_142385910.1|2873903_2875133_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	31.0	1.4e-38
WP_094247489.1|2875129_2876059_+	NAD(P)-dependent oxidoreductase	NA	M4QPK0	Synechococcus_phage	28.5	4.5e-21
WP_094247490.1|2876024_2877281_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_015387692.1|2877292_2878174_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_076851287.1|2878146_2878905_+	WbqC family protein	NA	NA	NA	NA	NA
WP_077722860.1|2878867_2879545_+	PIG-L family deacetylase	NA	A0A2D2W2P2	Stenotrophomonas_phage	28.2	1.9e-13
>prophage 220
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2886758	2887898	4162569	holin	Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_094247493.1|2886758_2887898_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	9.5e-13
>prophage 221
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2891049	2895317	4162569	holin	Anomala_cuprea_entomopoxvirus(50.0%)	5	NA	NA
WP_017418897.1|2891049_2892195_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	9.5e-13
WP_017418898.1|2892211_2892865_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017418899.1|2892879_2893797_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017418900.1|2893815_2894493_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017418901.1|2894603_2895317_+	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.1	3.3e-56
>prophage 222
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2899387	2904810	4162569		Thermus_phage(50.0%)	7	NA	NA
WP_003151674.1|2899387_2899819_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	64.2	6.5e-15
WP_003151677.1|2899843_2900254_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.0	7.8e-18
WP_087920807.1|2900449_2900635_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003151681.1|2900758_2900989_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_007409986.1|2901107_2901848_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017418905.1|2901866_2904200_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.3	1.1e-92
WP_029973572.1|2904339_2904810_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	9.2e-47
>prophage 223
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2914066	2914846	4162569		Planktothrix_phage(100.0%)	1	NA	NA
WP_094247496.1|2914066_2914846_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	7.1e-36
>prophage 224
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2920198	2924889	4162569		uncultured_virus(50.0%)	2	NA	NA
WP_094247500.1|2920198_2922628_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	4.8e-115
WP_071543372.1|2922777_2924889_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.4	6.9e-118
>prophage 225
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2927925	2930241	4162569		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_094247501.1|2927925_2930241_+	UvrD-helicase domain-containing protein	NA	A0A1S5V1I8	Saudi_moumouvirus	27.7	9.3e-07
>prophage 226
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2937072	2941136	4162569		Staphylococcus_phage(100.0%)	4	NA	NA
WP_094247503.1|2937072_2937903_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	54.9	4.7e-78
WP_094247504.1|2937935_2939081_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_094247505.1|2939082_2940177_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014418872.1|2940200_2941136_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.7e-24
>prophage 227
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2947538	2948021	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_014305800.1|2947538_2948021_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.9	6.4e-11
>prophage 228
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2954536	2955343	4162569		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_063637067.1|2954536_2955343_+	ABC transporter ATP-binding protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	27.5	3.1e-10
>prophage 229
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2958484	2960943	4162569		Bacillus_phage(50.0%)	2	NA	NA
WP_003151779.1|2958484_2959204_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	2.3e-33
WP_053285168.1|2959200_2960943_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.7	9.7e-17
>prophage 230
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2964864	2966091	4162569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003151786.1|2964864_2966091_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.0	1.2e-13
>prophage 231
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2980811	2983639	4162569	protease	Bacillus_phage(33.33%)	3	NA	NA
WP_014418841.1|2980811_2981489_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.8	1.6e-28
WP_017418949.1|2981766_2983128_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	5.6e-20
WP_007410071.1|2983174_2983639_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	48.6	4.1e-31
>prophage 232
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	2987195	2988020	4162569		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_014418835.1|2987195_2988020_+	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	28.6	2.4e-10
>prophage 233
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3001044	3014606	4162569		Streptococcus_phage(14.29%)	19	NA	NA
WP_094247514.1|3001044_3001401_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	51.9	2.9e-21
WP_003151844.1|3001460_3001844_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003151845.1|3001898_3002135_+	YusG family protein	NA	NA	NA	NA	NA
WP_094247515.1|3002204_3002570_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_003151847.1|3002572_3002893_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003151848.1|3002989_3003340_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003151850.1|3003662_3004688_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	2.2e-32
WP_003151851.1|3004680_3005349_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012118382.1|3005362_3006178_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032864325.1|3006272_3006650_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003151857.1|3006842_3006995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003151872.1|3007171_3007957_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	23.6	6.5e-05
WP_003151874.1|3007974_3009288_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_007410089.1|3009287_3010508_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.6	6.8e-118
WP_003151877.1|3010497_3010941_+	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
WP_003151878.1|3010960_3012358_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003151879.1|3012393_3013230_-	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.4	3.4e-20
WP_058906334.1|3013365_3013827_-	DUF2691 family protein	NA	NA	NA	NA	NA
WP_094247516.1|3013904_3014606_+	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	27.5	7.9e-10
>prophage 234
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3019846	3020833	4162569		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_071392250.1|3019846_3020833_+	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-11
>prophage 235
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3025751	3026858	4162569		Mycoplasma_phage(100.0%)	1	NA	NA
WP_043867399.1|3025751_3026858_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	46.1	7.3e-18
>prophage 236
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3030631	3033718	4162569		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_007410110.1|3030631_3031828_+	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	20.5	5.8e-05
WP_094247523.1|3031860_3032109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247524.1|3032971_3033718_+	hypothetical protein	NA	D2XR29	Bacillus_phage	37.9	5.8e-35
>prophage 237
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3042731	3047092	4162569		Staphylococcus_phage(50.0%)	6	NA	NA
WP_017419458.1|3042731_3043709_-	M23 family metallopeptidase	NA	A0A1J0MFP9	Staphylococcus_phage	36.9	3.5e-08
WP_003151923.1|3043911_3044808_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003151928.1|3045025_3045301_+	YutD family protein	NA	NA	NA	NA	NA
WP_017419457.1|3045326_3045761_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_094247528.1|3045794_3046565_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_003151934.1|3046591_3047092_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.4	6.8e-40
>prophage 238
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3053870	3058989	4162569		Prochlorococcus_phage(33.33%)	7	NA	NA
WP_169510385.1|3053870_3054206_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	42.4	3.7e-10
WP_044052935.1|3054285_3054612_+	YuzD family protein	NA	NA	NA	NA	NA
WP_060657594.1|3054648_3055716_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007408721.1|3055982_3056219_+	YuzB family protein	NA	NA	NA	NA	NA
WP_024085753.1|3056353_3057571_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	23.2	2.0e-13
WP_012118345.1|3057694_3058549_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003151967.1|3058626_3058989_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	44.9	1.4e-18
>prophage 239
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3063775	3072787	4162569		Staphylococcus_phage(20.0%)	12	NA	NA
WP_003151975.1|3063775_3064480_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.5	1.5e-29
WP_094247531.1|3064476_3065004_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_003151978.1|3065020_3065242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247532.1|3065304_3066285_-	GMP reductase	NA	G3MBI2	Bacillus_virus	82.8	4.6e-157
WP_003151982.1|3066502_3066646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031378399.1|3066686_3067682_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	51.6	2.3e-31
WP_007408709.1|3067993_3069214_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007408708.1|3069387_3069513_+	YuiA family protein	NA	NA	NA	NA	NA
WP_003151989.1|3069581_3069902_+	YuiB family protein	NA	NA	NA	NA	NA
WP_050556585.1|3070026_3070644_+	3D domain-containing protein	NA	A0A127AW72	Bacillus_phage	43.2	2.7e-14
WP_003151991.1|3070672_3071149_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_094247533.1|3071296_3072787_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.3	1.1e-56
>prophage 240
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3081373	3088501	4162569		Tupanvirus(100.0%)	1	NA	NA
WP_094247537.1|3081373_3088501_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.1	1.7e-96
>prophage 241
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3094317	3098793	4162569		Mycobacterium_phage(100.0%)	1	NA	NA
WP_025650214.1|3094317_3098793_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.9	1.3e-33
>prophage 242
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3107232	3108699	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_014418767.1|3107232_3108699_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.9	2.4e-117
>prophage 243
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3123978	3125511	4162569		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_024085738.1|3123978_3125511_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.0	1.8e-11
>prophage 244
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3156594	3165578	4162569		uncultured_Caudovirales_phage(80.0%)	5	NA	NA
WP_071392228.1|3156594_3158580_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.3	6.7e-14
WP_077722748.1|3158764_3160753_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.4	1.1e-16
WP_094247551.1|3160880_3162866_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.9	1.4e-14
WP_070082266.1|3162981_3164988_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.0	2.1e-15
WP_003152143.1|3165053_3165578_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	35.4	2.6e-18
>prophage 245
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3169198	3287859	4162569	integrase,portal,protease,tail,terminase,capsid,holin,head,plate	Bacillus_phage(51.47%)	137	3169014:3169060	3239032:3239078
3169014:3169060	attL	GCTGGCAGCGTAGAGGTCAGGGGTTCGAGCCCCCTTGGCTCCATACC	NA	NA	NA	NA
WP_088030644.1|3169198_3170257_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	26.7	2.9e-16
WP_094247553.1|3170404_3171352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069013195.1|3171348_3171768_+	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	1.6e-34
WP_094247554.1|3172001_3172340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046341149.1|3172329_3172653_+	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	38.9	7.5e-08
WP_094247555.1|3172867_3173230_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	39.5	3.3e-12
WP_094247556.1|3173226_3173595_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	41.4	6.1e-22
WP_094247557.1|3174862_3175219_+	hypothetical protein	NA	A0A2I6UHX7	Bacillus_phage	58.7	8.0e-27
WP_172424417.1|3175215_3175368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247558.1|3175387_3176155_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	49.6	2.8e-61
WP_094247559.1|3176151_3176679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473275.1|3176675_3176900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025851649.1|3176896_3178291_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.9	2.6e-129
WP_094247560.1|3178425_3179421_+	toprim domain-containing protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	46.5	2.1e-72
WP_076982979.1|3179437_3179683_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	41.2	2.8e-07
WP_094247561.1|3179832_3181059_+	hypothetical protein	NA	A0A288WGA2	Bacillus_phage	38.0	1.4e-67
WP_088030631.1|3181368_3181977_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094247562.1|3182271_3182790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088030629.1|3183027_3183783_+	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	51.1	1.0e-55
WP_094247563.1|3183817_3184252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145956748.1|3184248_3184521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247565.1|3184534_3185488_+	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	36.2	5.8e-48
WP_157829260.1|3185653_3185803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247566.1|3185837_3188123_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	37.3	5.0e-122
WP_094247567.1|3188124_3188829_+	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	44.3	1.7e-33
WP_094247568.1|3188829_3189891_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	52.3	1.5e-76
WP_094247569.1|3189890_3190211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172424418.1|3190207_3190741_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A2H4IZL3	uncultured_Caudovirales_phage	43.5	4.3e-32
WP_094247571.1|3190741_3190939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072588572.1|3190939_3191191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247572.1|3191190_3191553_+	hypothetical protein	NA	A0A140HLL8	Bacillus_phage	36.8	5.1e-13
WP_094247573.1|3191558_3191804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069013224.1|3191800_3191986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172424419.1|3192030_3192186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247575.1|3192179_3192536_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	55.9	5.0e-29
WP_094247576.1|3192525_3194649_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	78.9	0.0e+00
WP_045208667.1|3194677_3194860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247577.1|3194944_3195943_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	75.8	6.5e-143
WP_157670119.1|3196022_3196169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247578.1|3196165_3196777_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	53.8	4.3e-44
WP_094247579.1|3196777_3197002_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	95.8	1.6e-33
WP_094247580.1|3196998_3197694_+	FAD-dependent thymidylate synthase	NA	M1IQ81	Bacillus_virus	68.6	6.7e-86
WP_094247581.1|3197720_3198287_+	3D domain-containing protein	NA	A0A142F1S8	Bacillus_phage	58.8	8.3e-26
WP_094247582.1|3198483_3199290_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	46.5	4.3e-28
WP_094247583.1|3199286_3199532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247584.1|3199528_3200101_+	dephospho-CoA kinase	NA	U5PRK9	Bacillus_phage	44.2	5.6e-38
WP_094247585.1|3200097_3201246_+	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	75.5	6.6e-139
WP_094247586.1|3201218_3201599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247587.1|3202061_3202691_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	39.4	5.2e-13
WP_094247588.1|3202729_3202909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247589.1|3202941_3203370_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157829256.1|3203486_3203648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247590.1|3203687_3204500_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	62.1	4.0e-98
WP_025851583.1|3204591_3204948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351549.1|3204962_3205142_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
WP_094247591.1|3205272_3205710_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.2	1.5e-51
WP_045208646.1|3206021_3206225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165698141.1|3206430_3206577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247592.1|3206636_3208403_-	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	47.2	6.6e-146
WP_094247593.1|3208402_3209200_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	49.6	3.7e-56
WP_045208644.1|3209331_3209556_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094247594.1|3209655_3210678_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	43.0	5.5e-12
WP_094247596.1|3211519_3211738_+	hypothetical protein	NA	A0A2H4IZN0	uncultured_Caudovirales_phage	59.5	4.0e-05
WP_094247597.1|3211737_3212016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247598.1|3212362_3212584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247600.1|3212762_3213062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247601.1|3213054_3213594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247603.1|3214227_3214566_+	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	56.4	5.8e-27
WP_088030590.1|3214688_3215012_+|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZN8	Paenibacillus_phage	72.0	3.7e-31
WP_094247604.1|3214986_3216768_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	66.4	4.0e-244
WP_094247605.1|3216780_3218067_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	44.1	5.9e-88
WP_094247606.1|3218020_3218767_+|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	50.6	5.7e-59
WP_094247607.1|3218766_3219921_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	63.2	2.2e-126
WP_076983301.1|3219961_3220450_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_065180432.1|3220452_3220692_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	48.6	1.4e-11
WP_094247608.1|3220697_3221039_+|head	phage head closure protein	head	A6M954	Geobacillus_virus	45.8	4.1e-20
WP_094247609.1|3221035_3221464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247610.1|3221460_3221805_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	48.7	2.3e-23
WP_065180464.1|3221822_3222410_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_094247611.1|3223075_3228424_+|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	44.7	2.1e-107
WP_094247612.1|3228423_3229242_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	43.2	9.1e-58
WP_094247613.1|3229253_3230783_+|tail	phage tail protein	tail	A0A0U4JID8	Exiguobacterium_phage	34.7	2.2e-49
WP_094247614.1|3230797_3233359_+	peptidase G2	NA	D6R401	Bacillus_phage	61.0	4.4e-300
WP_094247925.1|3233375_3234809_+|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	50.8	1.8e-64
WP_094247615.1|3234823_3235108_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	44.7	1.2e-14
WP_094247616.1|3235109_3235295_+	XkdX family protein	NA	NA	NA	NA	NA
WP_094247617.1|3235323_3235587_+	hemolysin XhlA family protein	NA	D2J075	Enterococcus_phage	44.6	1.2e-08
WP_094247618.1|3235666_3236605_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	65.4	1.8e-97
WP_013351583.1|3236626_3236884_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.0e-23
WP_094247619.1|3237013_3237343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088030573.1|3237361_3237697_-	YolD-like family protein	NA	O64030	Bacillus_phage	35.7	8.9e-12
WP_013351586.1|3237756_3237963_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094247620.1|3238099_3238891_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	30.7	1.1e-15
WP_070082264.1|3239536_3239740_-	hypothetical protein	NA	NA	NA	NA	NA
3239032:3239078	attR	GCTGGCAGCGTAGAGGTCAGGGGTTCGAGCCCCCTTGGCTCCATACC	NA	NA	NA	NA
WP_070082263.1|3240059_3241190_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.6	1.8e-64
WP_094247621.1|3242333_3242654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247622.1|3242721_3243363_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_094247926.1|3243579_3244755_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_070082259.1|3244897_3245743_+	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	1.1e-26
WP_058906302.1|3245776_3246445_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_070082729.1|3246608_3247148_-	DUF1016 domain-containing protein	NA	NA	NA	NA	NA
WP_071392220.1|3247307_3247862_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003152180.1|3248062_3249535_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_094247623.1|3249552_3250761_+|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_003152182.1|3250832_3251414_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_070082256.1|3251415_3251904_-	DinB family protein	NA	NA	NA	NA	NA
WP_032876878.1|3252049_3252580_+	NfeD family protein	NA	NA	NA	NA	NA
WP_094247624.1|3252599_3254129_+	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	2.1e-07
WP_044052963.1|3254158_3254740_-	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_029974104.1|3262146_3262617_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_094247625.1|3262772_3263492_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_094247626.1|3263774_3265190_+	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_094247627.1|3265186_3266923_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_096034902.1|3266910_3267735_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_003152221.1|3267793_3268612_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_094247628.1|3268699_3270163_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.9	5.9e-76
WP_003152223.1|3270159_3271275_+	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	21.9	2.4e-13
WP_007408842.1|3271648_3271807_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_094247629.1|3271864_3272905_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071392556.1|3272927_3274259_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003152229.1|3274456_3274705_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003152233.1|3274823_3275393_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003152235.1|3275389_3275617_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	66.2	6.9e-24
WP_003152237.1|3275740_3276214_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_094247630.1|3276328_3276772_+	FixH family protein	NA	NA	NA	NA	NA
WP_003152241.1|3276768_3276918_-	YtzI protein	NA	NA	NA	NA	NA
WP_003152242.1|3277042_3277480_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	6.5e-47
WP_003152243.1|3277631_3278036_+|holin	holin family protein	holin	NA	NA	NA	NA
WP_003152244.1|3278168_3278648_+	nucleoside triphosphatase YtkD	NA	NA	NA	NA	NA
WP_014418698.1|3278683_3279496_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003152246.1|3279470_3280253_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	1.6e-32
WP_094247631.1|3280264_3281269_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015418056.1|3281408_3282182_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	38.3	9.2e-36
WP_003152249.1|3282239_3282482_+	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_094247632.1|3282524_3284108_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.0	4.0e-195
WP_003152253.1|3284614_3285817_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	74.4	9.6e-165
WP_003152255.1|3285960_3287859_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	28.3	1.3e-30
>prophage 246
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3293333	3297000	4162569		Staphylococcus_phage(100.0%)	5	NA	NA
WP_014305624.1|3293333_3293915_-	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	53.2	3.1e-44
WP_003152268.1|3293911_3294880_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	74.5	3.2e-54
WP_003152272.1|3295117_3295390_+	YtzC family protein	NA	NA	NA	NA	NA
WP_003152275.1|3295736_3296129_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003152276.1|3296121_3297000_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	1.4e-19
>prophage 247
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3300017	3300713	4162569		Planktothrix_phage(100.0%)	1	NA	NA
WP_003152281.1|3300017_3300713_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	1.2e-39
>prophage 248
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3303871	3313152	4162569	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_003152289.1|3303871_3304627_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	35.8	1.7e-18
WP_003152291.1|3304623_3306564_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015387829.1|3306670_3307381_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_094247637.1|3307576_3308761_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	52.9	1.9e-101
WP_070082239.1|3308801_3309587_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_015418038.1|3309976_3310312_+	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_015418037.1|3310737_3313152_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.2	0.0e+00
>prophage 249
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3319991	3322968	4162569		Vibrio_phage(50.0%)	2	NA	NA
WP_094247641.1|3319991_3321527_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	4.7e-23
WP_003152311.1|3321702_3322968_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.0	3.4e-27
>prophage 250
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3326216	3331910	4162569		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_014418670.1|3326216_3326921_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.6	1.3e-20
WP_094247642.1|3326917_3328078_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_070082232.1|3328110_3329415_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.2	2.7e-48
WP_094247643.1|3329510_3330902_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_094247644.1|3330938_3331910_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.1	6.9e-81
>prophage 251
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3342336	3346537	4162569		Staphylococcus_phage(50.0%)	3	NA	NA
WP_012118213.1|3342336_3343146_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	51.5	9.0e-34
WP_003152375.1|3343160_3343766_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_094247646.1|3343933_3346537_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.3	9.2e-88
>prophage 252
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3356245	3359566	4162569	tRNA	Staphylococcus_phage(50.0%)	2	NA	NA
WP_014418650.1|3356245_3357964_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	72.1	9.4e-206
WP_007613147.1|3358300_3359566_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.8	6.5e-79
>prophage 253
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3363569	3364322	4162569		Staphylococcus_phage(100.0%)	1	NA	NA
WP_029973317.1|3363569_3364322_+	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	44.4	1.1e-54
>prophage 254
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3373080	3376707	4162569		Bacillus_phage(100.0%)	4	NA	NA
WP_070082214.1|3373080_3373638_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	53.3	1.6e-45
WP_162886258.1|3373771_3373921_+	PhrK family phosphatase-inhibitory pheromone	NA	Q9ZXD2	Bacillus_phage	86.5	7.0e-09
WP_003152406.1|3374065_3374668_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_094247654.1|3374958_3376707_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.5	1.1e-20
>prophage 255
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3384744	3390328	4162569		Bacillus_phage(33.33%)	5	NA	NA
WP_003152415.1|3384744_3384963_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	82.8	8.9e-21
WP_094247658.1|3385110_3386697_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.4	5.4e-75
WP_094247659.1|3386720_3388316_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003152418.1|3388332_3389139_-	NAD kinase	NA	NA	NA	NA	NA
WP_003152419.1|3389320_3390328_+	signal peptide peptidase SppA	NA	Q6UAX7	Klebsiella_phage	27.8	1.2e-16
>prophage 256
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3404561	3407900	4162569		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_094247665.1|3404561_3407900_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	34.8	2.9e-179
>prophage 257
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3419743	3430666	4162569		Bacillus_phage(50.0%)	9	NA	NA
WP_003152454.1|3419743_3421015_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	4.0e-12
WP_003152455.1|3421060_3421999_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003152457.1|3422214_3422934_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.3	5.0e-44
WP_094247669.1|3422926_3424666_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	42.4	6.9e-47
WP_094247670.1|3424912_3427552_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	28.8	1.6e-42
WP_003152460.1|3427576_3428407_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	31.2	5.6e-23
WP_014305562.1|3428543_3429176_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_031379146.1|3429191_3429785_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003152464.1|3429823_3430666_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	51.5	3.9e-80
>prophage 258
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3433962	3447126	4162569	tRNA,holin	Synechococcus_phage(20.0%)	13	NA	NA
WP_003152471.1|3433962_3434343_+	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	2.1e-17
WP_003152473.1|3434591_3435050_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_094247671.1|3435161_3436571_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_007408085.1|3436595_3437531_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	30.4	5.7e-32
WP_070082726.1|3437562_3438204_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_003152478.1|3438269_3439100_+	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_015417978.1|3439509_3441441_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.3	4.9e-110
WP_014418604.1|3441495_3442290_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_031379151.1|3442474_3444256_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.8	1.6e-75
WP_058906272.1|3444233_3444968_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003152485.1|3445097_3445538_+|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_094247672.1|3445550_3446234_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_071543361.1|3446604_3447126_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.5	9.3e-16
>prophage 259
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3468924	3469959	4162569	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003152530.1|3468924_3469959_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	32.4	5.0e-29
>prophage 260
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3474402	3481524	4162569		Cafeteria_roenbergensis_virus(33.33%)	5	NA	NA
WP_077723170.1|3474402_3476115_+	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	23.9	1.9e-12
WP_071391528.1|3476135_3478493_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	43.4	2.9e-16
WP_003152541.1|3478509_3478914_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_094247677.1|3479052_3479730_-	DUF2711 family protein	NA	NA	NA	NA	NA
WP_094247678.1|3479835_3481524_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.9	2.4e-36
>prophage 261
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3486637	3486952	4162569		Indivirus(100.0%)	1	NA	NA
WP_003152560.1|3486637_3486952_+	thioredoxin	NA	A0A1V0SD63	Indivirus	43.0	3.5e-10
>prophage 262
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3495034	3495259	4162569		Caldibacillus_phage(100.0%)	1	NA	NA
WP_003152579.1|3495034_3495259_+	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	77.0	1.5e-15
>prophage 263
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3498761	3506716	4162569		Bodo_saltans_virus(33.33%)	8	NA	NA
WP_088005422.1|3498761_3499358_+	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	31.7	1.1e-09
WP_038459402.1|3499373_3499883_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_007408136.1|3500513_3500699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020954258.1|3500738_3501089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060387298.1|3501882_3503607_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	29.7	2.4e-60
WP_003152598.1|3503603_3504122_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_007408142.1|3504144_3505173_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_094247684.1|3505159_3506716_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	34.1	1.3e-09
>prophage 264
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3512797	3560400	4162569	protease,coat,tRNA	uncultured_Mediterranean_phage(25.0%)	48	NA	NA
WP_003152620.1|3512797_3514060_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
WP_003152622.1|3514210_3515869_+|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_052827698.1|3516068_3518393_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.4e-183
WP_003152626.1|3518389_3518977_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_094247686.1|3519009_3519501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152628.1|3519695_3521063_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003152629.1|3521070_3521901_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_077722658.1|3521935_3522877_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_077722657.1|3522866_3523649_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_094247687.1|3523651_3524626_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_025649691.1|3524654_3525944_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_094247688.1|3526076_3527954_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025649689.1|3527987_3529010_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_003152639.1|3529024_3529216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247689.1|3529668_3532311_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.2	3.7e-161
WP_094247690.1|3532369_3533662_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_094247691.1|3533801_3534554_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_094247692.1|3534680_3535682_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_012118105.1|3535822_3536392_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_007408165.1|3536423_3537119_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003152647.1|3537210_3538224_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_016938781.1|3538254_3539118_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_007408167.1|3539114_3539633_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003152653.1|3539686_3540367_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_060674730.1|3540369_3541173_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_007408168.1|3541300_3542104_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_007408169.1|3542096_3542963_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003152660.1|3543108_3543417_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_012118103.1|3543419_3543761_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152662.1|3543773_3544058_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_014418543.1|3544375_3544954_+	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003152665.1|3544985_3546272_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_007408173.1|3546325_3546769_+	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003152668.1|3546782_3547640_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_014305508.1|3547669_3548212_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_094247693.1|3548208_3549360_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	26.8	3.5e-31
WP_070082164.1|3549465_3551031_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_094247694.1|3551012_3551861_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_025649684.1|3551862_3552966_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_094247695.1|3553092_3554298_+|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_069013531.1|3554445_3555039_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_012118093.1|3555423_3555933_+	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003152683.1|3556068_3556674_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003152685.1|3556684_3557689_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
WP_003152687.1|3557681_3557882_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152692.1|3557907_3558936_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_007408186.1|3558963_3560109_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_003152695.1|3560139_3560400_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
>prophage 265
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3563673	3580412	4162569	tRNA	Bacillus_phage(25.0%)	13	NA	NA
WP_070082161.1|3563673_3565893_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	2.0e-27
WP_012118088.1|3566024_3566522_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_003152709.1|3566585_3566912_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_094247697.1|3566967_3569328_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	1.4e-90
WP_003152714.1|3569333_3569846_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_060674703.1|3570003_3572208_+	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_007408194.1|3572220_3572664_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_094247698.1|3572689_3574252_-	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	2.0e-13
WP_094247699.1|3574382_3574553_+	YrzK family protein	NA	NA	NA	NA	NA
WP_094247700.1|3574909_3576184_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_007408199.1|3576198_3577977_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	6.6e-13
WP_094247701.1|3578303_3579068_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	32.0	4.1e-20
WP_003152729.1|3579143_3580412_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.6	1.5e-112
>prophage 266
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3584059	3586438	4162569		Brevibacillus_phage(100.0%)	1	NA	NA
WP_094247704.1|3584059_3586438_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.9	3.4e-81
>prophage 267
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3589637	3594614	4162569	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_094247706.1|3589637_3590366_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	7.3e-35
WP_014305488.1|3590584_3591646_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_094247707.1|3591977_3594614_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.1	4.1e-67
>prophage 268
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3598644	3600555	4162569		Phage_TP(50.0%)	2	NA	NA
WP_003152759.1|3598644_3599913_+	U32 family peptidase	NA	Q6DW11	Phage_TP	32.1	7.3e-38
WP_003152763.1|3599919_3600555_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	4.1e-34
>prophage 269
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3605700	3607768	4162569		Lactococcus_phage(50.0%)	2	NA	NA
WP_014305481.1|3605700_3606624_+	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	43.4	6.4e-60
WP_003152778.1|3606625_3607768_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	29.2	2.8e-20
>prophage 270
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3615686	3618848	4162569		Mycobacterium_phage(100.0%)	1	NA	NA
WP_094247710.1|3615686_3618848_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	36.7	4.6e-73
>prophage 271
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3632043	3632565	4162569		Streptococcus_phage(100.0%)	1	NA	NA
WP_052587356.1|3632043_3632565_+	streptothricin N-acetyltransferase SatA	NA	A0A1B0RXL7	Streptococcus_phage	51.1	6.6e-46
>prophage 272
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3639269	3642936	4162569	portal	Staphylococcus_phage(50.0%)	5	NA	NA
WP_094247713.1|3639269_3640121_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.7	7.5e-55
WP_082181728.1|3640124_3640232_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094247930.1|3640801_3641071_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_052586312.1|3641164_3641863_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_020956104.1|3642210_3642936_-	RNA polymerase sporulation sigma factor SigK	NA	A0A0A0RV91	Bacillus_phage	27.1	7.4e-11
>prophage 273
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3650941	3651511	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_003152860.1|3650941_3651511_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	30.2	6.2e-21
>prophage 274
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3654798	3657720	4162569		Bacillus_phage(50.0%)	2	NA	NA
WP_003152868.1|3654798_3655368_+	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	56.3	3.7e-34
WP_094247717.1|3655368_3657720_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	33.9	3.5e-38
>prophage 275
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3662489	3670447	4162569		Streptococcus_phage(33.33%)	6	NA	NA
WP_013352938.1|3662489_3664325_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.2	7.6e-20
WP_094247718.1|3664384_3665524_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_017418176.1|3665604_3666636_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003152892.1|3666695_3667271_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003152893.1|3667295_3669134_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.5	4.0e-138
WP_003152895.1|3669319_3670447_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.7	6.7e-27
>prophage 276
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3674877	3675324	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_094247720.1|3674877_3675324_+	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	41.2	3.8e-18
>prophage 277
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3679784	3680744	4162569		Rhizobium_phage(100.0%)	1	NA	NA
WP_003152970.1|3679784_3680744_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	44.7	1.8e-52
>prophage 278
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3691890	3701842	4162569	tRNA	Caulobacter_phage(20.0%)	9	NA	NA
WP_007408290.1|3691890_3693702_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	30.8	3.1e-50
WP_003152998.1|3693894_3695016_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.1	5.8e-39
WP_003152999.1|3695367_3695730_+	cytochrome c	NA	NA	NA	NA	NA
WP_094247931.1|3695855_3696560_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_094247724.1|3696552_3697674_+	Nif3-like dinuclear metal center hexameric protein	NA	H2ECW0	Moumouvirus	46.9	1.9e-21
WP_069473508.1|3697695_3698640_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_094247725.1|3698762_3699455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017418162.1|3699620_3700937_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.4	1.7e-53
WP_094247726.1|3700948_3701842_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.7	3.2e-24
>prophage 279
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3708031	3708637	4162569		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003153025.1|3708031_3708637_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.6	9.3e-68
>prophage 280
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3712448	3716832	4162569		Bacillus_virus(66.67%)	5	NA	NA
WP_094247729.1|3712448_3713351_+	phosphate ABC transporter substrate-binding protein	NA	M1U9L0	Synechococcus_phage	29.0	5.4e-11
WP_007612605.1|3713399_3714329_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_094247730.1|3714328_3715213_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_070082116.1|3715231_3716038_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	7.9e-14
WP_094247731.1|3716049_3716832_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.1	1.4e-15
>prophage 281
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3738606	3747611	4162569		Prochlorococcus_phage(50.0%)	8	NA	NA
WP_069013074.1|3738606_3740277_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	31.1	2.8e-61
WP_094247736.1|3740700_3741801_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_077722590.1|3741815_3743162_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.4	1.9e-57
WP_094247737.1|3743154_3744630_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3ST28	Prochlorococcus_phage	42.0	3.2e-85
WP_007408335.1|3744682_3745063_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003153114.1|3745256_3746093_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_007408338.1|3746192_3746621_+	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_003153118.1|3746735_3747611_+	patatin-like phospholipase family protein	NA	A0A1V0SFX9	Hokovirus	27.8	3.2e-16
>prophage 282
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3760405	3762727	4162569		Enterococcus_phage(50.0%)	2	NA	NA
WP_007408350.1|3760405_3761257_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	43.9	1.7e-43
WP_003153166.1|3761380_3762727_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.1	2.3e-42
>prophage 283
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3770775	3807961	4162569		Bacillus_phage(51.28%)	61	NA	NA
WP_003153177.1|3770775_3771576_+	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	35.3	4.2e-07
WP_094247739.1|3771891_3772269_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172424422.1|3772464_3772629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247740.1|3772618_3772942_+	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	40.0	2.0e-08
WP_094247741.1|3773156_3773519_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	37.1	5.7e-12
WP_094247742.1|3773515_3773893_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	42.6	2.0e-20
WP_153986733.1|3773918_3774089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145956751.1|3774079_3774730_+	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	52.5	2.2e-30
WP_094247744.1|3774726_3775083_+	hypothetical protein	NA	S6B1B0	Bacillus_phage	55.0	2.6e-25
WP_172424417.1|3775079_3775232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247745.1|3775251_3776034_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	54.2	8.6e-74
WP_172424423.1|3776030_3776402_+	DUF2493 domain-containing protein	NA	A0A0S2MWK3	Cellulophaga_phage	62.7	5.8e-36
WP_094247746.1|3776398_3776926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247748.1|3777143_3778538_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.7	2.6e-129
WP_094247749.1|3778672_3779668_+	toprim domain-containing protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.6	9.6e-70
WP_094247750.1|3779684_3779924_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	41.2	2.1e-07
WP_094247751.1|3779977_3780187_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094247752.1|3780290_3781460_+	hypothetical protein	NA	W8CYT9	Bacillus_phage	31.6	3.4e-42
WP_094247753.1|3781749_3782277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172424424.1|3782419_3782581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247754.1|3782577_3783144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247755.1|3783381_3784152_+	hypothetical protein	NA	A0A2H4IZK6	uncultured_Caudovirales_phage	51.4	3.5e-51
WP_094247756.1|3784183_3784621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247757.1|3784621_3785899_+	hypothetical protein	NA	A0A2H4J459	uncultured_Caudovirales_phage	30.5	6.9e-28
WP_145956752.1|3785888_3786068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155759818.1|3786064_3786220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247758.1|3786254_3788411_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	52.7	4.8e-207
WP_094247759.1|3788410_3789115_+	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	44.8	4.6e-34
WP_094247760.1|3789115_3790174_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.4	1.6e-78
WP_094247761.1|3790173_3790488_+	hypothetical protein	NA	A0A0F6YQ61	Sinorhizobium_phage	60.3	6.6e-17
WP_094247762.1|3790484_3791018_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A2H4IZL3	uncultured_Caudovirales_phage	42.9	4.7e-31
WP_094247571.1|3791018_3791216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072588572.1|3791216_3791468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247763.1|3791467_3791833_+	hypothetical protein	NA	A0A140HLL8	Bacillus_phage	36.8	5.2e-13
WP_094247764.1|3791833_3792343_+	hypothetical protein	NA	A0A109ZVT6	Bacillus_phage	29.2	1.5e-10
WP_094247765.1|3792590_3792776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145956753.1|3792756_3792975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247767.1|3792968_3793367_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	54.4	8.1e-28
WP_094247768.1|3793312_3793837_+	hypothetical protein	NA	A0A2K9VD13	Lactobacillus_phage	47.9	1.0e-22
WP_094247769.1|3793833_3795951_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	79.4	0.0e+00
WP_045208667.1|3795979_3796162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247770.1|3796246_3797245_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	75.8	6.5e-143
WP_157670119.1|3797324_3797471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247578.1|3797467_3798079_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	53.8	4.3e-44
WP_094247579.1|3798079_3798304_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	95.8	1.6e-33
WP_094247580.1|3798300_3798996_+	FAD-dependent thymidylate synthase	NA	M1IQ81	Bacillus_virus	68.6	6.7e-86
WP_094247581.1|3799022_3799589_+	3D domain-containing protein	NA	A0A142F1S8	Bacillus_phage	58.8	8.3e-26
WP_094247771.1|3799785_3800595_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	44.9	1.9e-28
WP_094247772.1|3800591_3800837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247773.1|3800833_3801406_+	dephospho-CoA kinase	NA	J9Q953	Bacillus_phage	43.9	1.2e-37
WP_094247585.1|3801402_3802551_+	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	75.5	6.6e-139
WP_094247586.1|3802523_3802904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247774.1|3802983_3803367_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	46.7	2.7e-20
WP_094247775.1|3803366_3803909_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	40.8	9.4e-19
WP_094247776.1|3803996_3804797_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	53.5	3.8e-69
WP_158649798.1|3804910_3805072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247777.1|3805111_3805924_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	61.7	4.4e-97
WP_094247778.1|3806004_3806448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247779.1|3806462_3806642_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	79.7	3.0e-22
WP_094247780.1|3806772_3807210_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	66.7	1.6e-48
WP_094247781.1|3807223_3807961_-	DUF2786 domain-containing protein	NA	A0A1U9WR73	Streptococcus_virus	34.5	1.3e-23
>prophage 284
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3811741	3840023	4162569	integrase,portal,protease,tail,terminase,capsid,holin,plate	Bacillus_phage(29.17%)	32	3825284:3825298	3844361:3844375
WP_014470951.1|3811741_3812290_-|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	2.4e-38
WP_033575279.1|3812372_3814127_+|terminase	phage terminase large subunit	terminase	A0A2H4J484	uncultured_Caudovirales_phage	71.6	3.4e-251
WP_046341194.1|3814143_3814575_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	6.5e-31
WP_046341196.1|3814577_3816209_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	57.6	1.6e-167
WP_094247783.1|3816208_3817033_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	51.6	1.5e-71
WP_094247784.1|3817125_3817797_+|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	44.5	4.6e-15
WP_045208630.1|3817808_3818912_+	DUF5309 family protein	NA	A0A2I7S650	Vibrio_phage	27.6	1.7e-30
WP_046341201.1|3819220_3819439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045208627.1|3819453_3819840_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	40.7	1.2e-20
WP_046341203.1|3819840_3820176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247786.1|3820172_3820580_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	6.1e-31
WP_033575287.1|3820586_3820976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351570.1|3821000_3821555_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_069473325.1|3821612_3821984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470937.1|3822316_3822925_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.2	7.0e-31
WP_069449005.1|3823025_3823787_+	hypothetical protein	NA	A0A1W6JL91	Lactococcus_phage	36.5	4.2e-41
WP_094247787.1|3823966_3826192_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.8	4.7e-56
3825284:3825298	attL	AAAGCGGCCGGAAAC	NA	NA	NA	NA
WP_094247788.1|3826195_3827620_+|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	43.6	4.0e-61
WP_094247789.1|3827631_3829032_+|tail	phage tail protein	tail	A6M966	Geobacillus_virus	32.0	4.0e-37
WP_094247790.1|3829046_3831611_+	peptidase G2	NA	D6R401	Bacillus_phage	74.2	0.0e+00
WP_094247934.1|3831656_3833207_+|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	54.2	6.1e-55
WP_033575347.1|3833221_3833491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470930.1|3833491_3833680_+	XkdX family protein	NA	NA	NA	NA	NA
WP_013351581.1|3833683_3833893_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_094247791.1|3833972_3834911_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.4	2.2e-92
WP_069013261.1|3834931_3835189_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	56.5	1.6e-21
WP_029973247.1|3835281_3835842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094247792.1|3835857_3836193_-	YolD-like family protein	NA	O64030	Bacillus_phage	34.7	4.4e-11
WP_029973246.1|3836238_3836451_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094247793.1|3836610_3837396_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	30.8	2.0e-17
WP_094247794.1|3837423_3838485_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	29.7	5.0e-32
WP_094247795.1|3838841_3840023_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.2	1.8e-27
3844361:3844375	attR	AAAGCGGCCGGAAAC	NA	NA	NA	NA
>prophage 285
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3844564	3846016	4162569		Bacillus_phage(50.0%)	2	NA	NA
WP_003153193.1|3844564_3845191_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1S5QTQ1	Bacillus_phage	38.8	3.5e-17
WP_094247796.1|3845278_3846016_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	29.2	3.7e-18
>prophage 286
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3863369	3867329	4162569		Catovirus(50.0%)	5	NA	NA
WP_014418333.1|3863369_3864266_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	23.9	9.4e-16
WP_003153223.1|3864443_3864881_+	bacilliredoxin BrxB	NA	NA	NA	NA	NA
WP_094247800.1|3865125_3865893_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003153227.1|3865954_3866614_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_070082084.1|3866606_3867329_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	2.7e-37
>prophage 287
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3874926	3877897	4162569		Synechococcus_phage(50.0%)	2	NA	NA
WP_003153241.1|3874926_3876336_+	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	34.2	7.5e-36
WP_053573216.1|3876427_3877897_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	38.8	1.6e-81
>prophage 288
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3889252	3908923	4162569		Paenibacillus_phage(66.67%)	3	NA	NA
WP_003153268.1|3889252_3889990_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.6	1.3e-15
WP_094247806.1|3890029_3902608_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.5	1.5e-34
WP_094247807.1|3902626_3908923_+	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	27.7	1.1e-30
>prophage 289
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3930332	3950441	4162569		Paenibacillus_phage(100.0%)	3	NA	NA
WP_094247810.1|3930332_3938051_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	28.6	3.5e-34
WP_094247811.1|3938073_3944229_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	27.9	1.6e-34
WP_094247812.1|3944225_3950441_+	zinc-binding dehydrogenase	NA	D0R7J2	Paenibacillus_phage	29.8	3.0e-36
>prophage 290
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3953812	3954655	4162569		Streptococcus_phage(100.0%)	1	NA	NA
WP_094247813.1|3953812_3954655_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.3	2.9e-27
>prophage 291
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3958233	3962903	4162569		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_003153290.1|3958233_3959193_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	36.1	2.6e-32
WP_025852786.1|3959217_3959607_+	VOC family protein	NA	V5UQY3	Oenococcus_phage	51.6	9.0e-32
WP_024085556.1|3959608_3959776_-	DUF4083 family protein	NA	NA	NA	NA	NA
WP_094247815.1|3959867_3960938_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003153294.1|3961011_3961218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071391657.1|3961317_3961662_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_094247816.1|3961676_3962903_-	DNA polymerase IV	NA	O64031	Bacillus_phage	44.3	3.1e-78
>prophage 292
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3966893	3970159	4162569		Klosneuvirus(50.0%)	5	NA	NA
WP_071391661.1|3966893_3967814_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	34.4	1.6e-07
WP_003153315.1|3967876_3967999_-	Z-ring formation inhibitor MciZ	NA	NA	NA	NA	NA
WP_003153317.1|3968077_3968632_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_094247819.1|3968631_3969795_+	TIGR00375 family protein	NA	NA	NA	NA	NA
WP_003153320.1|3969805_3970159_-	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	36.7	5.3e-07
>prophage 293
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3977983	3984030	4162569		Brevibacillus_phage(25.0%)	7	NA	NA
WP_012117897.1|3977983_3978874_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.7	1.7e-41
WP_071391665.1|3979041_3980226_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_003153340.1|3980237_3981056_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	48.0	7.4e-68
WP_003153342.1|3981192_3982362_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.3	1.6e-36
WP_007409411.1|3982457_3982811_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_094247820.1|3982807_3983251_+	anti-sigma F factor	NA	NA	NA	NA	NA
WP_003153348.1|3983262_3984030_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	60.9	1.3e-71
>prophage 294
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	3991754	4002563	4162569		Staphylococcus_phage(50.0%)	15	NA	NA
WP_003153363.1|3991754_3992186_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	36.6	9.4e-14
WP_014305331.1|3992335_3992827_+	DUF1453 family protein	NA	NA	NA	NA	NA
WP_032861567.1|3992907_3993483_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003153366.1|3993730_3994075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014305330.1|3994471_3995587_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	1.5e-55
WP_003153370.1|3995567_3996215_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_094247822.1|3996229_3997426_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	3.7e-116
WP_003153372.1|3997458_3997923_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153373.1|3998039_3998414_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153375.1|3998479_3999001_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153376.1|3999088_3999178_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_094247823.1|3999385_4000141_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
WP_094247824.1|4000130_4000724_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.0e-14
WP_003153380.1|4000813_4001299_+	DUF3907 family protein	NA	NA	NA	NA	NA
WP_003153383.1|4001411_4002563_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.6	6.0e-07
>prophage 295
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4008034	4018225	4162569		Bacillus_phage(60.0%)	9	NA	NA
WP_045510934.1|4008034_4008757_+	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	43.0	1.3e-44
WP_094247826.1|4008753_4010535_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	38.1	3.0e-37
WP_003153399.1|4010725_4011310_+	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_094247827.1|4011284_4012346_+	sugar dehydratase	NA	NA	NA	NA	NA
WP_094247828.1|4012392_4013970_-	phosphoglycerate dehydrogenase	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	32.4	2.5e-27
WP_123117875.1|4014398_4015031_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003153403.1|4015166_4015415_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	56.8	1.6e-18
WP_017418053.1|4015683_4016742_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025649802.1|4016734_4018225_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.0	4.3e-58
>prophage 296
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4025121	4025991	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_003153416.1|4025121_4025991_+	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	39.9	5.5e-21
>prophage 297
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4038240	4044907	4162569		Bacillus_phage(25.0%)	9	NA	NA
WP_003153447.1|4038240_4038519_+	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	75.3	1.1e-28
WP_003153448.1|4038705_4039278_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.7	1.3e-50
WP_003153449.1|4039298_4039526_+	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_007409455.1|4039682_4040438_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003153453.1|4040443_4041145_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_003153454.1|4041173_4042136_+	heptaprenyl diphosphate synthase component II	NA	NA	NA	NA	NA
WP_003153455.1|4042256_4042703_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.0	6.3e-29
WP_017418041.1|4042892_4043663_+	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_003153459.1|4043734_4044907_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.5	5.0e-41
>prophage 298
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4048117	4053604	4162569		Acinetobacter_phage(66.67%)	6	NA	NA
WP_017418038.1|4048117_4049134_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.5	7.6e-54
WP_017418037.1|4049126_4049879_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	40.5	2.9e-42
WP_021494238.1|4049883_4050537_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_014418255.1|4050517_4051720_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_025649797.1|4051712_4052510_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_025649796.1|4052521_4053604_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	2.0e-20
>prophage 299
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4057732	4058272	4162569		Bacillus_virus(100.0%)	1	NA	NA
WP_003153482.1|4057732_4058272_+	YpiB family protein	NA	G3MAV7	Bacillus_virus	48.6	1.6e-42
>prophage 300
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4063668	4064541	4162569		Streptococcus_phage(100.0%)	1	NA	NA
WP_003153493.1|4063668_4064541_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.5	2.4e-72
>prophage 301
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4068107	4078938	4162569	tRNA	unidentified_phage(25.0%)	10	NA	NA
WP_094247831.1|4068107_4069298_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	31.3	1.8e-38
WP_094247832.1|4069282_4070260_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_070082024.1|4070503_4071337_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	38.3	3.8e-51
WP_058906142.1|4071340_4072201_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003153510.1|4072202_4072586_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_094247833.1|4072707_4075494_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	28.9	1.8e-60
WP_003153512.1|4075641_4075812_+	YpmA family protein	NA	NA	NA	NA	NA
WP_094247834.1|4075821_4076307_+	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_094247835.1|4076329_4077511_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003153515.1|4077645_4078938_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.5	7.9e-56
>prophage 302
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4083797	4084406	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_094247938.1|4083797_4084406_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	34.9	4.6e-22
>prophage 303
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4088418	4090665	4162569		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_094247840.1|4088418_4090665_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.3	9.6e-09
>prophage 304
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4095843	4097763	4162569		Streptomyces_phage(100.0%)	1	NA	NA
WP_094247843.1|4095843_4097763_+	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	1.8e-11
>prophage 305
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4112069	4116040	4162569		Bacillus_phage(33.33%)	9	NA	NA
WP_094247850.1|4112069_4112957_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	31.1	2.5e-21
WP_003153575.1|4112962_4113091_-	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
WP_094247939.1|4113142_4113535_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_077722490.1|4113541_4114222_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.2	9.6e-13
WP_024085518.1|4114303_4114975_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_003153581.1|4114977_4115160_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_094247851.1|4115186_4115444_-	DUF2564 family protein	NA	NA	NA	NA	NA
WP_070082002.1|4115605_4115788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153604.1|4115839_4116040_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.9	5.5e-17
>prophage 306
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4125354	4126631	4162569		Geobacillus_virus(50.0%)	2	NA	NA
WP_003153622.1|4125354_4126149_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	67.4	3.5e-107
WP_015417676.1|4126145_4126631_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	45.3	3.2e-34
>prophage 307
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4134457	4148076	4162569		Bacillus_phage(88.89%)	15	NA	NA
WP_032868763.1|4134457_4135048_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	31.1	1.7e-13
WP_145956754.1|4135070_4136738_-	recombinase family protein	NA	O64015	Bacillus_phage	90.4	1.7e-276
WP_070081995.1|4137258_4137579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153650.1|4137717_4138698_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	75.1	5.5e-78
WP_088412337.1|4138959_4139394_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_094247855.1|4139430_4141230_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	61.5	1.4e-151
WP_094247856.1|4141245_4141704_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_003153654.1|4141916_4142276_+	hypothetical protein	NA	O64028	Bacillus_phage	60.5	1.3e-32
WP_003153655.1|4143687_4143870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094247857.1|4143859_4144996_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	76.4	1.1e-165
WP_094247858.1|4145346_4145799_+	hypothetical protein	NA	O64117	Bacillus_phage	78.0	5.7e-62
WP_094247859.1|4146037_4146412_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.0	5.8e-28
WP_063636671.1|4146535_4146772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032860646.1|4147195_4147549_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_094247860.1|4147899_4148076_+	hypothetical protein	NA	O64196	Bacillus_phage	91.4	1.9e-21
>prophage 308
NZ_CP022654	Bacillus velezensis strain SCDB 291 chromosome, complete genome	4162569	4154473	4154920	4162569		Bacillus_phage(100.0%)	1	NA	NA
WP_014305226.1|4154473_4154920_+	GyrI-like domain-containing protein	NA	A0A1P8CX48	Bacillus_phage	73.2	6.9e-60
