The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016766	Lactobacillus agilis strain La3, complete genome	2187209	211850	221178	2187209		Enterococcus_phage(33.33%)	12	NA	NA
WP_094127889.1|211850_214022_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	62.7	1.4e-262
WP_050611661.1|214002_214389_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	34.4	3.2e-13
WP_056977194.1|214410_214641_-	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	41.6	3.0e-11
WP_094127892.1|214862_215471_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_094127895.1|215472_215937_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_094127898.1|216172_217882_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.3	1.3e-58
WP_094127901.1|217900_218218_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_056977199.1|218246_218846_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_050611655.1|218847_219102_+	DUF2508 domain-containing protein	NA	NA	NA	NA	NA
WP_094127904.1|219185_219830_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	46.6	1.6e-46
WP_094127907.1|219843_220173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094127910.1|220182_221178_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.8	7.4e-38
>prophage 2
NZ_CP016766	Lactobacillus agilis strain La3, complete genome	2187209	300219	386770	2187209	protease,tRNA,head,portal,transposase,holin,capsid,terminase,tail	Lactobacillus_phage(20.51%)	99	NA	NA
WP_094128084.1|300219_301431_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.7	1.7e-124
WP_094131305.1|301579_302635_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_094128087.1|302780_303884_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_050610763.1|304094_305096_+	catabolite control protein A	NA	NA	NA	NA	NA
WP_094128090.1|305358_306165_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_094128093.1|306165_307683_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_094128096.1|307675_308407_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_094128099.1|308528_309404_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_094128102.1|309438_309969_+	VanZ family protein	NA	NA	NA	NA	NA
WP_050610757.1|310052_310781_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_089144484.1|310957_311866_+	ribokinase	NA	NA	NA	NA	NA
WP_094128105.1|311940_312903_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_094131307.1|312918_314829_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.5	1.2e-07
WP_094128108.1|315071_316040_+	competence protein ComG	NA	NA	NA	NA	NA
WP_094128113.1|317101_318484_-	recombinase family protein	NA	A0A2H4J6X5	uncultured_Caudovirales_phage	47.7	2.9e-117
WP_094128116.1|318945_319416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094128119.1|319626_320466_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_094128122.1|320465_320795_-	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	44.1	5.5e-14
WP_094128125.1|321031_321247_+	XRE family transcriptional regulator	NA	A0A1S5SDM7	Streptococcus_phage	55.0	4.4e-12
WP_094131309.1|321239_321956_+	phage regulatory protein	NA	A0A0P0IDD0	Lactobacillus_phage	57.7	3.5e-66
WP_094128128.1|322052_322250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128131.1|322236_322536_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_094128134.1|322549_323104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128137.1|323241_323817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094131311.1|324041_325229_+	ATP-dependent helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	53.7	7.6e-114
WP_094128140.1|325212_325398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128143.1|325397_325712_+	hypothetical protein	NA	A0A1B1P7L0	Bacillus_phage	37.5	1.1e-11
WP_094128146.1|325711_326125_+	VRR-NUC domain-containing protein	NA	A0A2H4J095	uncultured_Caudovirales_phage	45.0	6.4e-20
WP_094128149.1|326046_327801_+	NTP-binding protein	NA	A0A2H4J7Q2	uncultured_Caudovirales_phage	48.3	6.1e-128
WP_094128152.1|327820_328273_+	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	54.3	4.9e-37
WP_094128155.1|328359_330111_+	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	53.3	6.9e-172
WP_094128158.1|330080_332012_+	hypothetical protein	NA	H7BVJ4	unidentified_phage	46.8	1.8e-157
WP_094128161.1|332008_332254_+	hypothetical protein	NA	A0A0E3TAK6	Staphylococcus_phage	48.1	2.6e-08
WP_094128164.1|332234_332825_+	HNH endonuclease	NA	M1PKJ5	Streptococcus_phage	33.9	7.1e-20
WP_094128167.1|332894_333083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128171.1|333079_333685_+	hypothetical protein	NA	H2A0H0	Bacteroides_phage	38.0	1.4e-23
WP_094128174.1|333918_334311_+	hypothetical protein	NA	A0A0S0N9G6	Pseudomonas_phage	36.9	2.0e-10
WP_094128177.1|334312_334513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128180.1|334512_334719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128183.1|334715_334913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128186.1|334912_335299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128189.1|335326_335968_+	hypothetical protein	NA	B0YL94	Streptococcus_virus	33.5	2.3e-16
WP_094128192.1|335960_336149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128196.1|336151_336355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128199.1|336370_336835_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094128203.1|336835_337033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128206.1|337026_337272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128209.1|337268_337487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128212.1|337483_337816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128215.1|337799_338057_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_094128218.1|338053_338470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128221.1|339246_339477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094131313.1|339472_339799_+	HNH endonuclease	NA	A0A0K2CZH3	Paenibacillus_phage	45.0	1.6e-18
WP_094128224.1|339927_340380_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	35.4	1.7e-18
WP_094131315.1|340369_342142_+|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	59.1	7.2e-201
WP_094131317.1|342217_343405_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	52.0	2.8e-100
WP_094128227.1|343331_344087_+|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	60.6	6.6e-71
WP_094128229.1|344077_345205_+|capsid	phage major capsid protein	capsid	A0A0C5AEH1	Paenibacillus_phage	46.1	7.8e-84
WP_094128232.1|345423_345738_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_094128235.1|345734_346073_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_094128238.1|346086_346515_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_094128255.1|346511_346880_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_094128258.1|346899_347535_+|tail	phage tail protein	tail	A0A060AKE9	Staphylococcus_phage	34.0	5.6e-15
WP_094128261.1|347534_347921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128264.1|347968_348097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094131319.1|350542_352399_+	hypothetical protein	NA	D6PSZ3	Lactobacillus_phage	61.1	7.6e-36
WP_094128267.1|352410_353226_+|tail	phage tail family protein	tail	A0A0B5CTY7	Listeria_phage	33.6	4.3e-07
WP_094128270.1|353225_354605_+	peptidase M23	NA	A0A0M7RDS2	Lactobacillus_phage	31.9	3.5e-54
WP_094128273.1|354608_355367_+|holin	holin	holin	A0A1U9WQS3	Geobacillus_phage	32.7	3.6e-16
WP_094128276.1|355359_355806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128279.1|355805_357152_+	DUF2479 domain-containing protein	NA	NA	NA	NA	NA
WP_094128282.1|357159_357669_+|tail	phage tail protein	tail	A0A288TYH2	Enterococcus_phage	45.6	3.2e-05
WP_094128285.1|357674_358571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128288.1|358584_359052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128291.1|359070_359433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089144865.1|359433_359577_+	XkdX family protein	NA	NA	NA	NA	NA
WP_094128294.1|359626_359932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089144867.1|359928_360225_+	hypothetical protein	NA	A0A0M7REJ4	Lactobacillus_phage	51.6	2.0e-07
WP_094128297.1|360217_361498_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2MYF3	Enterococcus_phage	52.6	3.3e-115
WP_094128300.1|361694_361886_+	hypothetical protein	NA	F8J1H1	Lactobacillus_phage	45.5	2.1e-05
WP_094128303.1|361878_362346_+	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	43.1	1.2e-27
WP_094131321.1|362392_362776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128306.1|363428_363677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128309.1|363666_364125_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_094128312.1|364108_364357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128315.1|364328_364811_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_094128318.1|364815_365076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128321.1|365146_366157_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_094128324.1|366303_367665_+	amino acid permease	NA	NA	NA	NA	NA
WP_094131323.1|367849_368344_+	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
WP_094128327.1|368355_369132_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_094128330.1|369091_369757_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_050610811.1|369802_370447_-	cytochrome o ubiquinol oxidase	NA	NA	NA	NA	NA
WP_056977407.1|370545_371556_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	53.6	2.3e-26
WP_094128333.1|371680_372262_+	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	39.4	3.9e-23
WP_050610740.1|372382_372772_+	general stress protein	NA	NA	NA	NA	NA
WP_094128336.1|380102_381290_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.4	1.1e-139
WP_094128339.1|381517_384031_+	LysM peptidoglycan-binding domain-containing protein	NA	A5A5E0	Lactobacillus_phage	38.0	2.2e-17
WP_094128342.1|384352_386770_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.5	0.0e+00
>prophage 3
NZ_CP016766	Lactobacillus agilis strain La3, complete genome	2187209	415533	424551	2187209		Prochlorococcus_phage(33.33%)	7	NA	NA
WP_094128403.1|415533_417756_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.0	1.3e-146
WP_094128406.1|417731_419168_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.2	8.4e-59
WP_094128409.1|419181_420228_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.8	1.4e-58
WP_094128412.1|420232_420808_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.1	2.2e-26
WP_094128415.1|420822_422361_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	45.1	3.3e-69
WP_094128418.1|422373_423639_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_094128421.1|423711_424551_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.7	1.1e-47
>prophage 4
NZ_CP016766	Lactobacillus agilis strain La3, complete genome	2187209	642588	682840	2187209	integrase,portal,capsid,terminase,tail	Lactobacillus_phage(62.5%)	52	635523:635537	663882:663896
635523:635537	attL	AAATAATTTCACCAA	NA	NA	NA	NA
WP_094128865.1|642588_643746_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	35.6	6.6e-62
WP_094128868.1|643965_644751_-	DUF1828 domain-containing protein	NA	Q6SEA4	Lactobacillus_prophage	37.1	5.0e-29
WP_094131347.1|644737_644995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094128871.1|645324_645738_-	ImmA/IrrE family metallo-endopeptidase	NA	E9LUL3	Lactobacillus_phage	42.6	4.8e-23
WP_094128874.1|645738_646053_-	XRE family transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	43.6	4.6e-18
WP_094128877.1|646586_646793_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_094128880.1|647845_648112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128883.1|648471_648729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128886.1|648744_649743_+	hypothetical protein	NA	E9LUM3	Lactobacillus_phage	60.5	1.7e-82
WP_094128889.1|649742_650594_+	hypothetical protein	NA	E9LUM4	Lactobacillus_phage	46.2	5.3e-61
WP_094128892.1|650673_651492_+	DnaD domain protein	NA	A0A1W6JNI1	Staphylococcus_phage	55.6	7.0e-34
WP_094128895.1|651469_652279_+	ATP-binding protein	NA	O03914	Lactobacillus_phage	29.6	2.1e-22
WP_094128898.1|652606_652825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128901.1|652992_653439_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_094128904.1|653425_653635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128907.1|653624_653933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128910.1|653929_654157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128913.1|654146_654596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128916.1|654579_655041_+	DUF1064 domain-containing protein	NA	A0A1S5RCT5	Lactobacillus_phage	52.4	3.7e-32
WP_094128919.1|655551_656019_+	hypothetical protein	NA	B8R690	Lactobacillus_phage	34.0	2.2e-16
WP_094128922.1|656097_656763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128925.1|656743_657871_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	33.1	1.3e-49
WP_094128928.1|657949_658549_+	DUF4145 domain-containing protein	NA	Q20DE2	Lactobacillus_phage	51.3	7.8e-51
WP_094128949.1|659065_659905_+|terminase	terminase	terminase	Q6SE85	Lactobacillus_prophage	63.0	9.9e-84
WP_094128952.1|659897_661205_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	66.6	1.1e-182
WP_094128955.1|661218_662799_+|portal	phage portal protein	portal	U3PCP8	Lactobacillus_phage	56.7	3.0e-166
WP_094128958.1|662755_664354_+	hypothetical protein	NA	U3PFU0	Lactobacillus_phage	54.1	1.1e-107
663882:663896	attR	AAATAATTTCACCAA	NA	NA	NA	NA
WP_094128961.1|664350_664569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128964.1|664616_664925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128966.1|665024_665645_+	hypothetical protein	NA	O03931	Lactobacillus_phage	43.0	3.9e-13
WP_094128969.1|665660_666695_+	replication protein	NA	O03966	Lactobacillus_phage	77.3	1.0e-151
WP_094128972.1|666711_667098_+	hypothetical protein	NA	Q5YA68	Bacillus_phage	32.8	6.9e-08
WP_094128975.1|667091_667442_+|capsid	minor capsid protein	capsid	O03932	Lactobacillus_phage	44.8	1.9e-25
WP_094128978.1|667442_667823_+|capsid	capsid protein	capsid	O03933	Lactobacillus_phage	42.3	8.3e-14
WP_094128981.1|667812_668202_+|capsid	minor capsid protein	capsid	O03934	Lactobacillus_phage	40.3	5.7e-18
WP_094131349.1|668490_668769_+	hypothetical protein	NA	O03972	Lactobacillus_phage	51.6	3.5e-14
WP_094128984.1|668849_669284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094128987.1|669296_669935_+	hypothetical protein	NA	O03936	Lactobacillus_phage	36.8	2.1e-22
WP_094128990.1|669938_674597_+	hypothetical protein	NA	A0A075KJK1	Lactobacillus_phage	49.6	1.0e-73
WP_094128993.1|674583_675312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094131351.1|675362_677264_+	hypothetical protein	NA	A0A1B2APX2	Phage_Wrath	37.3	1.8e-72
WP_094128996.1|677280_678135_+	hypothetical protein	NA	A0A1X9IGH6	Lactococcus_phage	43.0	2.2e-22
WP_094128998.1|678142_678652_+|tail	phage tail protein	tail	A0A288TYH2	Enterococcus_phage	45.6	1.5e-05
WP_094129001.1|678658_679105_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_094129005.1|679118_679535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129008.1|679564_679927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089144865.1|679927_680071_+	XkdX family protein	NA	NA	NA	NA	NA
WP_094128294.1|680120_680426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089144867.1|680422_680719_+	hypothetical protein	NA	A0A0M7REJ4	Lactobacillus_phage	51.6	2.0e-07
WP_094128297.1|680711_681992_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2MYF3	Enterococcus_phage	52.6	3.3e-115
WP_094128300.1|682188_682380_+	hypothetical protein	NA	F8J1H1	Lactobacillus_phage	45.5	2.1e-05
WP_094128303.1|682372_682840_+	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	43.1	1.2e-27
>prophage 5
NZ_CP016766	Lactobacillus agilis strain La3, complete genome	2187209	908583	1021187	2187209	tRNA,integrase,head,portal,transposase,holin,capsid,terminase,tail	Bacillus_phage(13.33%)	112	983116:983170	1031975:1032029
WP_050612315.1|908583_909885_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	28.8	7.4e-54
WP_094129489.1|909898_911083_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_094129492.1|911098_911596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129495.1|911695_914473_-	hypothetical protein	NA	A0A127AW80	Bacillus_phage	24.8	2.2e-31
WP_094129498.1|914583_915573_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_089144171.1|915544_916507_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_094129501.1|916531_917599_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_094129504.1|917610_918648_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_094129507.1|918699_920070_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_094129510.1|920069_921053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050612325.1|921071_921395_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_094129513.1|921404_922148_-	abhydrolase domain-containing 18	NA	NA	NA	NA	NA
WP_094129516.1|922317_923130_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_050612328.1|923183_924056_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	51.7	1.8e-75
WP_094129519.1|924708_925272_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_094129522.1|925321_925771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129525.1|925831_927742_-	hypothetical protein	NA	S5MNT2	Brevibacillus_phage	37.9	3.1e-40
WP_094129528.1|927826_928495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094131367.1|929009_930089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050612333.1|930184_931057_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	26.9	6.3e-17
WP_094129529.1|931057_931582_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
WP_094129532.1|931687_933457_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_094129535.1|933460_934750_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_056977599.1|935340_935916_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094129538.1|935918_937214_+	purine permease	NA	NA	NA	NA	NA
WP_094129541.1|937341_938226_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	35.9	1.1e-19
WP_094129544.1|938237_938687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129547.1|938724_939342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129549.1|939345_940290_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_089144190.1|940302_940740_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_094129552.1|940752_942981_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1S6L1R3	Vibrio_phage	34.8	6.2e-08
WP_094129555.1|943028_943361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129558.1|943532_944270_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_094129561.1|944272_945157_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_094129564.1|945174_945654_-	DUF3013 domain-containing protein	NA	NA	NA	NA	NA
WP_094129567.1|945876_946794_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	50.8	3.1e-83
WP_094129570.1|947042_948002_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_056977619.1|948022_948373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129573.1|948506_949610_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_094129576.1|949626_950811_-	MFS transporter	NA	NA	NA	NA	NA
WP_094129578.1|950794_952123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129581.1|952245_953139_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094129584.1|953135_953948_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_089145063.1|954018_954918_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	33.6	7.4e-37
WP_094129587.1|954914_955451_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094129590.1|955723_956182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129593.1|956183_956564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129596.1|956706_956907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129599.1|956899_957151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129602.1|958827_959943_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.2	9.2e-37
WP_094129606.1|960114_960708_-	XRE family transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	44.6	9.9e-06
WP_094129609.1|960878_961133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129612.1|961408_962383_+	hypothetical protein	NA	A0A2H4JB92	uncultured_Caudovirales_phage	33.4	3.7e-26
WP_094129615.1|962441_964133_+	hypothetical protein	NA	A7J282	Streptococcus_phage	27.0	6.7e-23
WP_094129618.1|964201_964432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129621.1|964431_964761_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_094129624.1|965054_965405_+	HNH endonuclease	NA	X2KRF8	Campylobacter_phage	41.9	7.1e-12
WP_094129627.1|965571_966021_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0MG04	Staphylococcus_phage	32.0	1.6e-11
WP_094129629.1|966022_967735_+|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	37.0	1.1e-94
WP_094129632.1|967879_968938_+|portal	phage portal protein	portal	Q8LTC2	Lactobacillus_phage	24.6	3.9e-13
WP_094129635.1|968942_970430_+|capsid	phage major capsid protein	capsid	Q9AZE1	Lactococcus_phage	46.7	1.5e-26
WP_094129638.1|970429_970693_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0M4S687	Enterococcus_phage	33.7	2.6e-06
WP_094129641.1|970786_971200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129644.1|971820_972840_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_094129648.1|973002_973506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129651.1|975676_975868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129654.1|976041_976248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129657.1|976406_976679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129660.1|976681_976960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129663.1|977354_977555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129666.1|979073_979322_-	hypothetical protein	NA	S5VXZ8	Leptospira_phage	42.3	7.3e-11
WP_094129669.1|979671_981537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089145063.1|981681_982581_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	33.6	7.4e-37
WP_094129587.1|982577_983114_-|transposase	transposase	transposase	NA	NA	NA	NA
983116:983170	attL	AAAAAAGTGCCTCACAATCGTTAAGACTTTTGTCTAACAATTATGACGCACTTCA	NA	NA	NA	NA
WP_094129672.1|983227_983446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003709292.1|983757_984681_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.7	1.1e-32
WP_094129674.1|984696_985380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129677.1|985386_986502_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	78.9	5.9e-169
WP_094129680.1|986521_987868_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_094129683.1|987887_989402_-	carnitine transporter	NA	NA	NA	NA	NA
WP_094129685.1|989391_990120_-|holin	choline kinase	holin	NA	NA	NA	NA
WP_094129688.1|990112_991864_-|holin	choline kinase	holin	NA	NA	NA	NA
WP_094129691.1|992134_993340_+	acyltransferase	NA	NA	NA	NA	NA
WP_094129693.1|993615_994308_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094129696.1|994427_995183_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_094129698.1|995347_996208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129701.1|996174_996876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129705.1|996948_997305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129708.1|997589_998411_-	LicD family protein	NA	A0A1V0SD50	Indivirus	31.3	6.2e-06
WP_094129711.1|998427_999270_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_094129714.1|999334_1000474_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	K7YFA0	Megavirus	30.8	9.7e-34
WP_094129717.1|1000491_1001580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129720.1|1001584_1003063_-	flippase	NA	NA	NA	NA	NA
WP_094129723.1|1003090_1004359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129726.1|1004477_1005479_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_094129729.1|1005506_1006421_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	39.7	5.8e-29
WP_089144636.1|1006477_1007509_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	39.2	2.1e-59
WP_094129732.1|1007520_1008102_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	46.0	3.6e-32
WP_094129735.1|1008120_1008990_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.8	4.0e-104
WP_094129738.1|1009117_1009843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129741.1|1009844_1010897_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_094129743.1|1010899_1011628_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_094129746.1|1011657_1012725_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_094129749.1|1012753_1013404_-	sugar transferase	NA	NA	NA	NA	NA
WP_094129752.1|1013485_1014256_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_094129755.1|1014262_1015000_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_094129759.1|1015012_1015774_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_094129762.1|1016360_1017656_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_050612398.1|1017726_1017915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129765.1|1018090_1019527_+	dipeptidase	NA	NA	NA	NA	NA
WP_094129768.1|1019537_1020395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094075311.1|1020482_1021187_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	38.8	3.1e-30
1031975:1032029	attR	TGAAGTGCGTCATAATTGTTAGACAAAAGTCTTAACGATTGTGAGGCACTTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP016766	Lactobacillus agilis strain La3, complete genome	2187209	1032029	1081609	2187209	protease,tRNA,transposase	Bacillus_phage(14.29%)	54	NA	NA
WP_094129587.1|1032029_1032566_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_089145063.1|1032562_1033462_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	33.6	7.4e-37
WP_094129786.1|1033529_1034315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056976887.1|1034295_1034511_-	transcriptional regulator	NA	S5M643	Brevibacillus_phage	43.4	8.8e-05
WP_050612409.1|1034799_1035282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129789.1|1035278_1037393_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_082174247.1|1037393_1037552_+	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_094129792.1|1037703_1038267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129797.1|1038602_1038941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082618700.1|1038912_1039353_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	63.6	5.8e-43
WP_094129802.1|1039418_1040816_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094129805.1|1041198_1041528_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_094129808.1|1041939_1043529_+	asparagine synthase B	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	39.9	3.9e-97
WP_094129811.1|1043725_1044382_-	class A sortase	NA	NA	NA	NA	NA
WP_094129814.1|1044399_1045707_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_089144332.1|1045784_1047563_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_094129817.1|1047700_1048579_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_094129820.1|1048678_1049479_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_094129823.1|1049643_1050636_-	lactate dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	33.8	2.2e-42
WP_050612421.1|1050785_1051058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050612422.1|1051044_1051800_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_089144335.1|1051878_1052508_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_050612424.1|1052611_1052836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129826.1|1052916_1053171_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_050612426.1|1053315_1053939_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	52.9	9.8e-12
WP_094129829.1|1053988_1055680_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_056976873.1|1055698_1056160_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094129833.1|1056196_1057018_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_094129836.1|1057020_1057914_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_056976870.1|1057906_1058137_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_094129839.1|1058136_1059480_-	exodeoxyribonuclease VII large subunit	NA	A0A160DEV2	Gordonia_phage	32.2	3.6e-27
WP_094129842.1|1059469_1060330_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.8	4.8e-33
WP_050612434.1|1060453_1060864_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_050612435.1|1060863_1061295_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_050612436.1|1061323_1061881_-	elongation factor P	NA	NA	NA	NA	NA
WP_094129845.1|1061973_1063038_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_094129848.1|1063429_1064386_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_050612439.1|1064559_1064841_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_056976526.1|1064861_1065188_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_050612441.1|1065205_1065514_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_089144344.1|1065817_1066909_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_089144345.1|1067229_1067679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129851.1|1067681_1068659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094129854.1|1068651_1069536_-	exonuclease SbcC	NA	NA	NA	NA	NA
WP_094129857.1|1069744_1070902_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_050612447.1|1071005_1071281_+	acylphosphatase	NA	NA	NA	NA	NA
WP_056976520.1|1071372_1072299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094129860.1|1072344_1073856_-	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.8	4.5e-10
WP_050612450.1|1073857_1074544_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.2	8.7e-30
WP_050612451.1|1074743_1076165_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.0	7.9e-41
WP_094129864.1|1076290_1077526_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.0	5.3e-134
WP_056941552.1|1077619_1078669_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.0	1.8e-42
WP_050612453.1|1078950_1080264_-	trigger factor	NA	NA	NA	NA	NA
WP_094129868.1|1080421_1081609_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	29.5	8.9e-30
>prophage 7
NZ_CP016766	Lactobacillus agilis strain La3, complete genome	2187209	1376824	1451721	2187209	protease,bacteriocin,transposase	Streptococcus_phage(31.25%)	60	NA	NA
WP_094075311.1|1376824_1377529_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	38.8	3.1e-30
WP_094127723.1|1377558_1378386_+	DDE domain-containing protein	NA	NA	NA	NA	NA
WP_089144104.1|1378438_1379464_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_089144103.1|1379572_1380445_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.7	3.9e-06
WP_094130331.1|1387065_1389129_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.5	3.1e-147
WP_050610950.1|1389242_1389476_-	DUF1797 domain-containing protein	NA	NA	NA	NA	NA
WP_056975973.1|1389661_1390678_-	TIGR00374 family protein	NA	NA	NA	NA	NA
WP_094130334.1|1390796_1391813_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_094130337.1|1391839_1393024_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_094130340.1|1393214_1394933_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_050610945.1|1394932_1395202_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_056975965.1|1395399_1395588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130343.1|1395786_1397976_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	37.6	1.1e-118
WP_050610942.1|1398138_1398423_+	DUF1827 domain-containing protein	NA	NA	NA	NA	NA
WP_094130346.1|1398602_1399649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094130349.1|1399677_1401516_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_094130352.1|1401496_1403935_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	36.8	1.7e-11
WP_094130354.1|1404043_1405480_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_094130356.1|1405484_1406630_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_089145041.1|1406619_1407762_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_094131406.1|1407823_1409758_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_089145040.1|1410182_1410497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056975951.1|1410782_1411031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094130359.1|1411106_1412462_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_094130362.1|1412488_1413637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050610932.1|1413633_1414476_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_094130365.1|1414678_1415353_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_050610930.1|1415425_1416334_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_094130368.1|1416463_1417003_+	exonuclease	NA	A0A1S5SEW3	Streptococcus_phage	40.0	1.9e-24
WP_094130371.1|1417058_1417946_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_050610927.1|1417926_1418622_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.0	5.9e-26
WP_099049334.1|1418703_1419832_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_094130377.1|1419895_1422259_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_094130381.1|1422433_1422988_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_094130385.1|1423148_1423853_-	ComF family protein	NA	NA	NA	NA	NA
WP_094130388.1|1423845_1425174_-	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	42.9	7.3e-73
WP_094130391.1|1425232_1425880_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.4	2.6e-39
WP_089144732.1|1425918_1427037_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_089144733.1|1427234_1429070_-	APC family permease	NA	NA	NA	NA	NA
WP_050610917.1|1429334_1430954_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	8.1e-159
WP_094130394.1|1430992_1431277_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	40.9	5.8e-12
WP_094130396.1|1431480_1432116_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_050610914.1|1432157_1432802_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_094130399.1|1433031_1435020_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	4.6e-47
WP_094130402.1|1435253_1436612_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_094131408.1|1436682_1437495_-	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_050610910.1|1438150_1438519_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_050610909.1|1438580_1439084_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_094130405.1|1439293_1439935_-|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	36.2	1.2e-25
WP_094130408.1|1439927_1441994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130410.1|1442027_1442483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050610907.1|1442690_1443383_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_050610906.1|1443493_1443919_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_094130412.1|1444140_1444956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094130414.1|1444986_1445658_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_094128766.1|1445848_1447180_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	2.5e-49
WP_094130416.1|1447286_1448444_-	hypothetical protein	NA	D2KRB9	Lactobacillus_phage	40.0	8.7e-14
WP_056975906.1|1448662_1449685_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
WP_094130417.1|1449700_1450651_-	malate transporter	NA	NA	NA	NA	NA
WP_094130419.1|1450821_1451721_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	33.6	2.2e-36
>prophage 8
NZ_CP016766	Lactobacillus agilis strain La3, complete genome	2187209	1570663	1636820	2187209	tRNA,transposase	Lactobacillus_phage(27.27%)	59	NA	NA
WP_094131426.1|1570663_1571881_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.7	9.2e-123
WP_094130550.1|1572164_1572401_-	cytochrome B5	NA	NA	NA	NA	NA
WP_050610732.1|1572481_1573435_-	peroxidase	NA	NA	NA	NA	NA
WP_089144407.1|1573796_1574357_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_094130552.1|1574356_1575760_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_094130554.1|1575752_1576418_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_050610728.1|1576590_1576770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130556.1|1576902_1577538_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	41.6	9.0e-21
WP_094130558.1|1578098_1578464_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094130560.1|1578515_1579223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130562.1|1579347_1579983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094130473.1|1579955_1580660_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	38.8	6.9e-30
WP_094130475.1|1580689_1581517_+	DDE domain-containing protein	NA	NA	NA	NA	NA
WP_094130564.1|1581556_1581937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094130566.1|1582034_1583402_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_094130568.1|1583447_1583822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130570.1|1583920_1585015_+	phosphoesterase	NA	NA	NA	NA	NA
WP_094130572.1|1585057_1585855_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_094130574.1|1585900_1586614_-	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	29.9	1.1e-14
WP_094130576.1|1586616_1587099_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_094130578.1|1587207_1587894_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_094130580.1|1587983_1589174_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_094130582.1|1589175_1590243_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_094130584.1|1590387_1591281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094130586.1|1591354_1592206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130588.1|1592395_1593445_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_050610703.1|1593870_1594173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089145142.1|1594292_1595294_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.6	3.0e-47
WP_094130590.1|1595492_1596218_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094130592.1|1596369_1598739_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_094128766.1|1598885_1600217_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	2.5e-49
WP_089145139.1|1600491_1600920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094130594.1|1600981_1601572_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_094130596.1|1601617_1602805_-	MFS transporter	NA	NA	NA	NA	NA
WP_094130598.1|1602936_1603782_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_094130599.1|1603823_1604669_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_094130601.1|1605157_1605673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094130603.1|1605719_1606202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094130605.1|1606241_1606760_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_050610691.1|1606875_1607364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130607.1|1607408_1607909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130608.1|1608000_1608522_-|tRNA	tRNA (uracil-5-)-methyltransferase	tRNA	NA	NA	NA	NA
WP_094130610.1|1608521_1612238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130612.1|1613033_1614008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130614.1|1614032_1616450_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	65.0	7.3e-305
WP_094051178.1|1616464_1617019_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	58.0	7.8e-53
WP_094130616.1|1617183_1618764_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_094130618.1|1618868_1620227_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_094130620.1|1620239_1621091_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_094130622.1|1621187_1622294_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_089145063.1|1627725_1628625_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	33.6	7.4e-37
WP_094129587.1|1628621_1629158_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094130624.1|1629238_1629736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130625.1|1629811_1631410_-	APC family permease	NA	NA	NA	NA	NA
WP_089144780.1|1631556_1632201_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094130627.1|1632387_1633575_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	9.2e-27
WP_094130630.1|1633588_1635322_+	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_094130632.1|1635443_1635794_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_094130634.1|1636133_1636820_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	3.5e-127
>prophage 9
NZ_CP016766	Lactobacillus agilis strain La3, complete genome	2187209	1672049	1696075	2187209	transposase	Bacillus_phage(25.0%)	18	NA	NA
WP_094129587.1|1672049_1672586_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094130303.1|1672582_1673482_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	33.6	1.3e-36
WP_094130700.1|1673541_1674534_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_094130702.1|1674624_1676007_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_094051187.1|1676006_1677215_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_094129587.1|1677490_1678027_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_089145063.1|1678023_1678923_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	33.6	7.4e-37
WP_094130705.1|1679200_1680352_+|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	46.4	2.7e-92
WP_089144660.1|1680752_1681730_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.6	6.8e-44
WP_094130707.1|1682050_1683676_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_056976739.1|1683697_1684669_+	malate permease	NA	NA	NA	NA	NA
WP_094130709.1|1684764_1684980_-	addiction module antidote protein, HigA family	NA	M9MUN2	Rhodococcus_phage	49.1	3.8e-08
WP_094130711.1|1685672_1686926_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	4.0e-105
WP_050611608.1|1686930_1687737_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.6	1.1e-44
WP_094130713.1|1687917_1688826_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_094130715.1|1688853_1691910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130717.1|1692512_1694630_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_094130718.1|1694923_1696075_+|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	47.2	3.8e-94
>prophage 10
NZ_CP016766	Lactobacillus agilis strain La3, complete genome	2187209	1714379	1759369	2187209	integrase,bacteriocin,transposase	Streptococcus_phage(35.29%)	39	1721951:1721966	1763295:1763310
WP_094130744.1|1714379_1715597_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	7.0e-123
WP_050611629.1|1715960_1716491_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_094130745.1|1716545_1717130_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_094130746.1|1717263_1718442_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	44.1	7.8e-95
WP_094130748.1|1718445_1719531_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	49.7	1.4e-93
WP_094130750.1|1720094_1721519_+	LysM peptidoglycan-binding domain-containing protein	NA	D2KRB9	Lactobacillus_phage	40.2	2.3e-16
WP_094130752.1|1721578_1722082_-	hypothetical protein	NA	NA	NA	NA	NA
1721951:1721966	attL	TGTTTTTAGTGCTTGA	NA	NA	NA	NA
WP_094130754.1|1722672_1723065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130756.1|1723084_1724863_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_094130758.1|1725069_1726449_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_094130760.1|1726584_1729209_+	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	1.2e-58
WP_094130762.1|1729543_1730698_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_094130764.1|1730706_1731951_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_094130766.1|1731943_1732834_-	sodium ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.1e-19
WP_089144531.1|1732936_1733236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130768.1|1733311_1734019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130770.1|1734160_1735186_-	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	44.3	5.3e-07
WP_094130772.1|1735371_1738344_-	DUF3427 domain-containing protein	NA	A0A097BY72	Enterococcus_phage	25.5	2.9e-29
WP_056976732.1|1738330_1738753_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_094130774.1|1738905_1739985_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_094129587.1|1740305_1740842_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_089145063.1|1740838_1741738_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	33.6	7.4e-37
WP_094130776.1|1741812_1742388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094130778.1|1742817_1743753_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_094130780.1|1743950_1745858_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.4	1.8e-93
WP_094130782.1|1745857_1746226_-	copper-binding protein	NA	NA	NA	NA	NA
WP_094130784.1|1746385_1746676_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_094130786.1|1746838_1747165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027826419.1|1747520_1747790_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_094130787.1|1748004_1748769_-	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	33.6	1.2e-30
WP_094130789.1|1748768_1749305_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094130791.1|1749369_1751289_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	98.3	0.0e+00
WP_011058339.1|1751304_1751391_-	tetracycline resistance protein	NA	NA	NA	NA	NA
WP_078377190.1|1751665_1752604_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	56.6	1.9e-83
WP_000768372.1|1752611_1753634_-	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	75.5	3.1e-132
WP_094130793.1|1753630_1755658_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	65.5	2.3e-195
WP_094130795.1|1756390_1757290_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	33.6	2.2e-36
WP_094130797.1|1757286_1757823_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094130799.1|1758184_1759369_-|integrase	site-specific integrase	integrase	Q6SEA7	Lactobacillus_prophage	34.5	8.3e-44
1763295:1763310	attR	TCAAGCACTAAAAACA	NA	NA	NA	NA
>prophage 11
NZ_CP016766	Lactobacillus agilis strain La3, complete genome	2187209	2091182	2098242	2187209	transposase	Planktothrix_phage(33.33%)	6	NA	NA
WP_094131177.1|2091182_2092226_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.4e-16
WP_094131179.1|2092248_2093205_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	4.6e-21
WP_094131181.1|2093553_2094771_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.6	5.9e-122
WP_089145165.1|2094927_2095617_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	3.3e-37
WP_094131183.1|2095630_2096788_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.0	6.6e-30
WP_094131185.1|2096910_2098242_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	25.8	4.1e-15
