The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022564	Rhizobium leguminosarum bv. viciae strain BIHB 1148 chromosome, complete genome	4418978	829656	839900	4418978		uncultured_Mediterranean_phage(83.33%)	9	NA	NA
WP_003539661.1|829656_830166_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.4	2.5e-45
WP_017960446.1|830195_830768_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	52.0	1.8e-41
WP_094085979.1|830810_831305_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.2	3.6e-25
WP_094085980.1|831442_831721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003539654.1|831854_832010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094085981.1|832360_835198_-	DNA gyrase subunit A	NA	A0A1B1IVS2	uncultured_Mediterranean_phage	42.4	1.0e-76
WP_012757442.1|835434_836082_+	MarC family protein	NA	NA	NA	NA	NA
WP_094085982.1|836181_836694_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	73.7	1.2e-44
WP_094085983.1|836978_839900_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	62.2	0.0e+00
>prophage 2
NZ_CP022564	Rhizobium leguminosarum bv. viciae strain BIHB 1148 chromosome, complete genome	4418978	1102733	1229187	4418978	portal,protease,transposase,capsid,terminase,integrase,head,tail,tRNA	uncultured_Mediterranean_phage(25.64%)	125	1136000:1136021	1180384:1180405
WP_094086090.1|1102733_1105274_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.6	6.9e-56
WP_003539006.1|1105319_1105667_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	39.1	1.4e-12
WP_094086091.1|1105977_1106850_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_026158654.1|1106992_1108594_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	29.2	5.1e-12
WP_011651660.1|1108732_1109386_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	33.5	7.6e-15
WP_017960203.1|1109382_1110156_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	30.2	5.2e-23
WP_017960202.1|1110160_1111444_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.6	1.1e-97
WP_017960201.1|1111645_1112473_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.1	1.0e-53
WP_017960200.1|1112469_1113081_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_017960199.1|1113132_1113324_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	76.9	2.6e-08
WP_094086092.1|1113507_1114224_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	47.2	1.4e-38
WP_094086093.1|1114220_1115078_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	38.5	4.3e-34
WP_094086094.1|1115096_1116110_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.6	1.3e-24
WP_094086095.1|1116221_1119461_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017960194.1|1119505_1121263_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_065279719.1|1121328_1122546_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_017960192.1|1122767_1123100_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	47.6	1.5e-19
WP_094086096.1|1123222_1124014_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_026158651.1|1124025_1124823_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_094086097.1|1124842_1125313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086098.1|1125541_1126822_-	transporter	NA	NA	NA	NA	NA
WP_094086099.1|1127222_1130066_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	2.0e-136
WP_017960187.1|1130181_1131051_-	DUF2497 domain-containing protein	NA	NA	NA	NA	NA
WP_172426283.1|1131385_1132051_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_085994567.1|1132537_1132723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094086100.1|1133287_1133608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017960183.1|1134728_1135067_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_017960182.1|1135063_1135405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017960181.1|1135507_1135825_-	membrane protein	NA	NA	NA	NA	NA
1136000:1136021	attL	ATCCGGCCCGGGGAGCCATTTT	NA	NA	NA	NA
WP_094086102.1|1136210_1137311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094087640.1|1137528_1137918_-	BA14K family protein	NA	NA	NA	NA	NA
WP_150131644.1|1138144_1138447_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_094086104.1|1138412_1138721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172426284.1|1138850_1139012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094086105.1|1139070_1140447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094086107.1|1140874_1141180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094086108.1|1141176_1141479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094086109.1|1141475_1141706_+	hypothetical protein	NA	A0A141GEZ4	Brucella_phage	51.6	1.3e-14
WP_150131645.1|1141894_1143598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094086111.1|1143727_1144291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094086113.1|1145430_1145682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094086114.1|1145761_1147012_-	SGNH/GDSL hydrolase family protein	NA	A0A068CDE5	Rhizobium_phage	76.1	1.3e-164
WP_094086115.1|1147004_1147268_-	hypothetical protein	NA	A0A1J0GUZ4	Halomonas_phage	40.9	5.7e-06
WP_094086116.1|1147305_1147647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150131646.1|1147881_1148265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086119.1|1148261_1148858_-	lysozyme	NA	L7TM06	Rhizobium_phage	59.3	7.0e-60
WP_094086120.1|1148844_1149096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086121.1|1149123_1149636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086122.1|1149632_1149944_-	hypothetical protein	NA	A0A0F6WBI7	Sinorhizobium_phage	59.5	7.7e-18
WP_094086123.1|1150795_1154029_-	hypothetical protein	NA	G8GWG0	Rhodobacter_phage	33.0	4.8e-102
WP_094086124.1|1154079_1154556_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094086125.1|1154552_1154909_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_094086126.1|1154980_1156513_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.8	5.6e-101
WP_094086127.1|1156522_1156984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094087641.1|1156999_1157407_-	C40 family peptidase	NA	G8GWF9	Rhodobacter_phage	37.6	1.3e-12
WP_094086128.1|1157421_1157925_-	DUF1833 family protein	NA	NA	NA	NA	NA
WP_094086129.1|1157921_1158272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086130.1|1158268_1161418_-|tail	phage tail length tape measure family protein	tail	A0A076G7H2	Sinorhizobium_phage	32.2	2.9e-59
WP_094086131.1|1161463_1161931_+	YbjQ family protein	NA	M4STD1	Rhodobacter_phage	51.2	7.8e-22
WP_094086132.1|1161927_1162119_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_094086133.1|1162139_1162490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086134.1|1162513_1162948_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_094086135.1|1162996_1163401_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_094086136.1|1163401_1163893_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_094086137.1|1163892_1164249_-|head,tail	head-tail adaptor protein	head,tail	B4UTP9	Rhizobium_phage	38.7	2.3e-13
WP_094086138.1|1164412_1164823_-	hypothetical protein	NA	B4UTP8	Rhizobium_phage	54.7	9.5e-32
WP_094086139.1|1164840_1165380_-|head,tail	phage head-tail connector protein	head,tail	B4UTP7	Rhizobium_phage	57.2	1.6e-55
WP_094086140.1|1165342_1165555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086141.1|1165604_1166858_-|capsid	phage major capsid protein	capsid	B4UTP3	Rhizobium_phage	64.0	5.7e-144
WP_094086142.1|1166954_1167566_-|head,protease	HK97 family phage prohead protease	head,protease	B4UTP2	Rhizobium_phage	57.9	3.3e-44
WP_094086143.1|1167562_1168819_-|portal	phage portal protein	portal	B4UTP1	Rhizobium_phage	79.3	7.6e-173
WP_172426285.1|1168818_1170717_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	48.7	9.5e-159
WP_094086145.1|1170682_1171069_-	hypothetical protein	NA	A0A0U2C0X7	Paracoccus_phage	37.8	6.7e-11
WP_094086147.1|1172236_1172608_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_094087642.1|1172862_1174023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086148.1|1174022_1174424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086149.1|1174884_1175139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086150.1|1175293_1177819_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_172426286.1|1177787_1178069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086151.1|1178068_1178530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086152.1|1178626_1178839_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_094086153.1|1179056_1180241_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	42.8	4.6e-79
WP_017960166.1|1182238_1182553_-	hypothetical protein	NA	NA	NA	NA	NA
1180384:1180405	attR	ATCCGGCCCGGGGAGCCATTTT	NA	NA	NA	NA
WP_017960165.1|1182678_1182930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017960164.1|1183265_1183469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157626479.1|1184147_1184429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094086154.1|1184957_1185878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017960160.1|1186084_1188202_+	catalase	NA	A0A2K9L572	Tupanvirus	49.8	4.5e-141
WP_017960159.1|1188349_1188709_+	low affinity iron permease family protein	NA	NA	NA	NA	NA
WP_017960158.1|1188809_1189217_-	low affinity iron permease family protein	NA	Q19XG2	Mycobacterium_phage	40.5	3.3e-08
WP_017960157.1|1189558_1190650_+	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_017960156.1|1190692_1190992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051077381.1|1191101_1193027_-	adenine deaminase	NA	NA	NA	NA	NA
WP_017960154.1|1193251_1194292_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017960153.1|1194404_1195229_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017960152.1|1195225_1196017_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017960151.1|1196024_1197083_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	52.7	7.4e-20
WP_094086155.1|1197100_1198498_+	dipeptidase	NA	NA	NA	NA	NA
WP_094086156.1|1198636_1199902_+	glycerate kinase	NA	NA	NA	NA	NA
WP_172426287.1|1199989_1200946_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_094086157.1|1201037_1201994_-	lytic transglycosylase domain-containing protein	NA	A0A0A0P1R1	Enterobacteria_phage	35.6	1.5e-06
WP_094086158.1|1202215_1202938_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_094086159.1|1203092_1203752_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_094086161.1|1204045_1205044_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_094086162.1|1205057_1206890_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_094086163.1|1207008_1207992_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077981205.1|1207988_1208984_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072638702.1|1208980_1210519_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-15
WP_094086164.1|1210596_1211736_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020049643.1|1211964_1212969_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.0	5.6e-25
WP_072638704.1|1213054_1213642_+	ANTAR domain-containing response regulator	NA	NA	NA	NA	NA
WP_172426288.1|1213676_1214957_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077981208.1|1215437_1216706_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_094086165.1|1216723_1219174_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017960132.1|1219178_1219514_+	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_094086166.1|1219514_1222172_+	nitrate reductase	NA	NA	NA	NA	NA
WP_094086167.1|1222209_1222887_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_029873043.1|1223002_1223320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017960128.1|1223533_1223860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094086168.1|1224028_1224331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017960127.1|1224327_1225587_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	33.8	1.1e-41
WP_094086169.1|1225587_1226421_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172426289.1|1226519_1227179_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_017960124.1|1227405_1228443_+	cysteine synthase A	NA	NA	NA	NA	NA
WP_094086171.1|1228449_1229187_+|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP022564	Rhizobium leguminosarum bv. viciae strain BIHB 1148 chromosome, complete genome	4418978	1449002	1459878	4418978	protease	Cyanophage(16.67%)	7	NA	NA
WP_172426291.1|1449002_1451213_-	esterase-like activity of phytase family protein	NA	M4SLV1	Cyanophage	43.6	1.1e-81
WP_094086268.1|1451296_1452196_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003547346.1|1452677_1452953_-	HU family DNA-binding protein	NA	A0A172Q061	Acinetobacter_phage	34.1	7.1e-07
WP_094086269.1|1453159_1455577_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	49.5	1.1e-204
WP_003547337.1|1455979_1457257_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.6	7.9e-133
WP_017959926.1|1457553_1458189_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.2	9.5e-63
WP_172426292.1|1458462_1459878_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.1	2.6e-12
>prophage 4
NZ_CP022564	Rhizobium leguminosarum bv. viciae strain BIHB 1148 chromosome, complete genome	4418978	1522266	1531574	4418978		Acanthamoeba_polyphaga_mimivirus(14.29%)	9	NA	NA
WP_017959872.1|1522266_1524234_+	hypothetical protein	NA	A0A0G2Y9S0	Acanthamoeba_polyphaga_mimivirus	26.9	1.5e-05
WP_017959871.1|1524257_1524836_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	46.2	1.2e-32
WP_017959870.1|1524842_1525898_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.2	1.6e-94
WP_017959869.1|1525901_1526789_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_026158619.1|1526799_1527669_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	59.2	1.5e-95
WP_026158618.1|1527789_1528401_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.4	2.6e-17
WP_017959867.1|1528400_1529786_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	38.1	1.0e-32
WP_003547190.1|1529789_1530266_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_017959866.1|1530275_1531574_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.3	1.3e-98
>prophage 5
NZ_CP022564	Rhizobium leguminosarum bv. viciae strain BIHB 1148 chromosome, complete genome	4418978	3719022	3729024	4418978		Streptococcus_phage(12.5%)	9	NA	NA
WP_094087348.1|3719022_3721254_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.1	1.2e-123
WP_018243700.1|3721918_3722140_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	52.1	7.9e-17
WP_094087349.1|3722149_3722554_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.1	8.5e-17
WP_094087350.1|3722532_3724737_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.9	2.5e-211
WP_017962232.1|3724911_3725886_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	75.1	2.1e-138
WP_094087351.1|3725990_3727214_+	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	29.4	5.4e-14
WP_094087352.1|3727232_3727961_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	38.0	3.1e-41
WP_025396142.1|3727957_3728314_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_017962228.1|3728313_3729024_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2P1JXV3	Rhodococcus_phage	47.8	4.3e-48
>prophage 1
NZ_CP022567	Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence	407945	124063	137523	407945		Vibrio_phage(25.0%)	10	NA	NA
WP_017961411.1|124063_126121_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.6	1.7e-36
WP_094088730.1|126588_126936_-	GFA family protein	NA	NA	NA	NA	NA
WP_011652887.1|126945_127983_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	68.6	7.1e-15
WP_094088731.1|128093_129281_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	27.5	1.4e-35
WP_094088732.1|129347_130076_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	42.4	1.8e-49
WP_094088733.1|130145_132014_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	34.9	4.6e-73
WP_094088734.1|132013_134023_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.5	7.1e-88
WP_094088735.1|134694_135585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028758328.1|135588_136044_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.7	2.0e-14
WP_077979249.1|136317_137523_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.8	7.4e-40
