The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020082	Streptococcus pyogenes strain STAB120304 chromosome, complete genome	1890354	36869	49256	1890354		Synechococcus_phage(28.57%)	8	NA	NA
WP_087486699.1|36869_40595_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.4	9.2e-41
WP_087486700.1|40828_42283_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.5	8.3e-54
WP_032464121.1|42310_43333_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.4	4.0e-63
WP_002986700.1|43500_44055_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_076639719.1|44238_45786_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_076639718.1|45843_46968_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_076639717.1|47220_48486_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002986689.1|48764_49256_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	1.9e-18
>prophage 2
NZ_CP020082	Streptococcus pyogenes strain STAB120304 chromosome, complete genome	1890354	512639	616477	1890354	holin,protease,tail,head,tRNA,integrase,portal,terminase,capsid	Streptococcus_phage(59.15%)	116	519343:519360	590912:590929
WP_021775322.1|512639_513764_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_096466706.1|513832_514930_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_002985455.1|514949_515642_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	1.0e-30
WP_002990498.1|515634_516564_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011284638.1|516872_517571_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	62.9	1.0e-78
WP_002990495.1|517738_518503_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_076639550.1|518610_521112_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	48.0	2.8e-203
519343:519360	attL	ATATCAAAAAGCTTCCCT	NA	NA	NA	NA
WP_002985439.1|521448_522642_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002985437.1|522662_524009_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
WP_030127588.1|524422_525313_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.5	5.1e-06
WP_020905024.1|525309_526287_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.2	9.6e-139
WP_002985428.1|526283_527195_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.3e-105
WP_010922052.1|527371_528787_-	recombinase family protein	NA	A5GZ62	Lactococcus_phage	47.0	2.3e-109
WP_011106738.1|528906_529212_-	membrane protein	NA	NA	NA	NA	NA
WP_030127591.1|529221_530010_-	phage repressor protein	NA	A0A1S5SD15	Streptococcus_phage	63.0	2.0e-86
WP_021340643.1|530379_530529_+	hypothetical protein	NA	J7KH12	Streptococcus_phage	91.8	4.3e-19
WP_014635530.1|530514_530730_-	hypothetical protein	NA	J7KBX0	Streptococcus_phage	97.1	8.8e-29
WP_021340638.1|530788_530947_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	5.8e-22
WP_001008979.1|531045_531687_-	hypothetical protein	NA	J7KJ31	Streptococcus_phage	100.0	1.5e-116
WP_014411882.1|531779_532019_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	98.7	1.4e-35
WP_023610918.1|532029_532791_+	phage antirepressor KilAC domain-containing protein	NA	A0A0C5AEJ9	Bacteriophage	61.9	3.6e-85
WP_011889039.1|532931_533114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076639549.1|533200_533338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032465394.1|533339_533525_+	hypothetical protein	NA	Q938N3	Temperate_phage	91.8	3.1e-22
WP_011017564.1|534043_534430_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
WP_010922205.1|534410_534644_+	hypothetical protein	NA	Q938N1	Temperate_phage	96.1	2.8e-36
WP_002988354.1|534640_534781_+	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
WP_002988357.1|534789_534996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011528796.1|535051_535381_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	84.4	7.1e-46
WP_011054700.1|535383_536310_+	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
WP_000594115.1|536306_536507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076639548.1|536499_537297_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	82.3	5.2e-127
WP_030127594.1|537473_537815_+	hypothetical protein	NA	M1NS23	Streptococcus_phage	39.6	1.4e-12
WP_029714370.1|537811_538324_+	hypothetical protein	NA	Q708P9	Streptococcus_phage	74.4	3.4e-63
WP_011017567.1|538310_538508_+	hypothetical protein	NA	A3F626	Streptococcus_phage	86.5	9.9e-11
WP_011017568.1|538501_538786_+	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	100.0	7.0e-50
WP_002987593.1|538782_539052_+	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
WP_094754159.1|539061_539475_+	hypothetical protein	NA	Q938M1	Temperate_phage	66.7	5.8e-37
WP_030127595.1|539471_539756_+	hypothetical protein	NA	A3F628	Streptococcus_phage	95.7	7.0e-42
WP_011017571.1|539759_540242_+	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	98.8	9.6e-92
WP_076639547.1|540432_540834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054572.1|540833_541469_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.9	2.2e-88
WP_011017866.1|541742_542183_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
WP_030127683.1|542737_543649_+	DNA adenine methylase	NA	A0A126HDT5	Lactococcus_phage	64.5	4.3e-101
WP_002987543.1|543774_544152_-	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
WP_001132273.1|544203_544389_-	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
WP_002985371.1|545132_545600_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_002985368.1|545602_545833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024623442.1|545836_547591_+	amino acid transporter	NA	J7KKD1	Streptococcus_phage	96.1	0.0e+00
WP_021299470.1|547587_547758_+	hypothetical protein	NA	J7KK43	Streptococcus_phage	60.4	3.9e-08
WP_002985363.1|547750_547975_+	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_011017578.1|548008_549229_+|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	6.9e-187
WP_011017579.1|549206_549872_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.1	3.5e-92
WP_011017580.1|549896_551084_+|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	74.7	1.3e-158
WP_011017581.1|551228_551531_+|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	88.8	1.3e-41
WP_011017582.1|551527_551875_+|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	88.2	2.9e-50
WP_011527557.1|551871_552249_+	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	72.8	1.8e-45
WP_011017584.1|552245_552671_+	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	84.4	7.2e-67
WP_011017585.1|552686_553295_+	hypothetical protein	NA	J7KKC8	Streptococcus_phage	71.9	6.7e-74
WP_011017586.1|553347_553674_+	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	8.3e-39
WP_021299462.1|553721_553871_+	hypothetical protein	NA	J7KBS0	Streptococcus_phage	85.7	1.7e-15
WP_030127684.1|553883_557807_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.3	2.5e-238
WP_011527559.1|557806_558514_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	71.9	6.8e-94
WP_076639342.1|558510_560658_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	93.1	0.0e+00
WP_063808246.1|560657_561932_+	collagen-like protein	NA	A3F657	Streptococcus_phage	39.9	2.1e-21
WP_063808247.1|561934_562582_+	hypothetical protein	NA	A3F658	Streptococcus_phage	47.0	1.4e-50
WP_076639341.1|562592_564629_+	gp58-like family protein	NA	Q938J9	Temperate_phage	69.5	8.3e-169
WP_002983467.1|564640_565072_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.5	1.3e-63
WP_011017592.1|565074_565692_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	89.3	5.0e-77
WP_002987582.1|565701_565977_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_000609113.1|565973_566201_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	5.8e-31
WP_002985329.1|566316_567522_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	83.3	1.6e-204
WP_002985327.1|567589_568297_-	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_002985324.1|568407_569166_-	DNase Mf2	NA	NA	NA	NA	NA
WP_063723270.1|569477_570896_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_076639340.1|571047_572595_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002990479.1|572742_573465_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_076639339.1|573484_574684_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002985307.1|574780_575041_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_076639338.1|575155_576097_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_032460256.1|576490_576940_+	flavodoxin	NA	NA	NA	NA	NA
WP_063631291.1|577115_577400_+	chorismate mutase	NA	NA	NA	NA	NA
WP_076639337.1|577392_578655_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	51.0	1.1e-94
WP_002985298.1|578769_579117_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_087486710.1|579478_579772_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141DZH6	Streptococcus_phage	45.9	1.2e-09
WP_002985295.1|580131_580701_+	hydrolase	NA	NA	NA	NA	NA
WP_011017600.1|580701_582654_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.2	8.9e-144
WP_002990455.1|583021_584746_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002990451.1|584877_585336_-	YueI family protein	NA	W6LLD2	Streptococcus_phage	39.1	1.8e-18
WP_002985288.1|585568_586876_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.2e-240
WP_002985285.1|587550_587712_+	TOMM family cytolysin streptolysin S	NA	NA	NA	NA	NA
WP_002985278.1|587933_588884_+	streptolysin S biosynthesis dehydrogenase SagB	NA	NA	NA	NA	NA
WP_002985275.1|588880_589939_+	streptolysin associated protein SagC	NA	NA	NA	NA	NA
WP_002990434.1|589958_591317_+	YcaO-like family protein	NA	NA	NA	NA	NA
590912:590929	attR	ATATCAAAAAGCTTCCCT	NA	NA	NA	NA
WP_076639336.1|591291_591963_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002990431.1|591959_592643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990429.1|592665_593589_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	38.1	6.7e-33
WP_014407462.1|593597_594725_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_076639335.1|594721_595840_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_076639334.1|596410_599143_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_002985256.1|599420_599921_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	31.8	5.4e-05
WP_014635380.1|600114_602073_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	34.9	1.3e-102
WP_002985252.1|602086_603109_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.9	3.6e-19
WP_002985249.1|603500_603698_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_002985244.1|603732_604449_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002990420.1|604466_604961_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_030126744.1|604960_605497_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_011889023.1|605512_607018_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_002985236.1|607036_607912_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_076639333.1|608074_609484_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_002985233.1|609493_609910_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_002994426.1|610175_610433_+	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_002994428.1|610497_611769_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_023078815.1|611772_611961_+	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_003057440.1|612818_613862_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.3	4.6e-30
WP_076639331.1|614071_616477_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP020082	Streptococcus pyogenes strain STAB120304 chromosome, complete genome	1890354	651887	662490	1890354		Streptococcus_phage(57.14%)	9	NA	NA
WP_044559748.1|651887_654098_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	6.5e-268
WP_002985142.1|654205_655369_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_002985140.1|655365_656052_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_076639328.1|656145_657312_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.2	1.9e-32
WP_002990260.1|657372_657714_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_044559750.1|657934_659287_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	4.5e-30
WP_021775342.1|659374_660643_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_021775338.1|660672_661113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184383.1|661347_662490_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
>prophage 4
NZ_CP020082	Streptococcus pyogenes strain STAB120304 chromosome, complete genome	1890354	754313	805469	1890354	holin,tail,integrase,tRNA,portal,terminase,capsid	Streptococcus_pyogenes_phage(48.21%)	67	754893:754908	809721:809736
WP_002990117.1|754313_755213_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
754893:754908	attL	GACCGTATCAATCAGC	NA	NA	NA	NA
WP_030127486.1|755285_756524_+	GTPase HflX	NA	NA	NA	NA	NA
WP_002990114.1|756516_757152_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_023611152.1|757166_758096_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_002984893.1|758095_758860_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_076639688.1|758856_761067_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.2	3.9e-71
WP_002990109.1|761216_761735_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.4	3.9e-30
WP_002984890.1|761815_762499_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.8	2.9e-09
WP_002990106.1|762495_763152_+	endonuclease III	NA	NA	NA	NA	NA
WP_020905114.1|763223_763910_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002984887.1|763899_764688_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_076639687.1|764727_765834_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002992970.1|765891_766761_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.6	2.4e-101
WP_002990099.1|766760_767354_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_076639686.1|767597_768638_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	8.5e-69
WP_011528538.1|768720_769860_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	55.8	4.4e-119
WP_011528539.1|769981_770668_-	hypothetical protein	NA	A0A1P8VVT3	Streptococcus_phage	100.0	5.7e-122
WP_011054825.1|770838_770991_-	hypothetical protein	NA	A0A1P8VVQ0	Streptococcus_phage	100.0	5.2e-20
WP_011054824.1|771001_771379_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	100.0	4.0e-69
WP_011528540.1|771362_771722_-	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN3	Streptococcus_phage	98.3	1.8e-58
WP_009881062.1|771910_772129_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVR5	Streptococcus_phage	100.0	4.1e-34
WP_011528542.1|772223_772475_+	hypothetical protein	NA	A0A1P8VVV6	Streptococcus_phage	100.0	2.8e-42
WP_011528544.1|772655_772970_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	100.0	1.7e-52
WP_011528545.1|773196_773679_+	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	100.0	1.2e-78
WP_002995975.1|773679_774360_+	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	100.0	1.6e-129
WP_011528546.1|774461_775691_+	DEAD/DEAH box helicase	NA	A0A1P8VVM2	Streptococcus_phage	100.0	3.3e-237
WP_002995969.1|775706_776165_+	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	100.0	3.8e-82
WP_030126642.1|776167_776980_+	bifunctional DNA primase/polymerase	NA	A0A1P8VVM6	Streptococcus_phage	99.6	5.5e-156
WP_020905118.1|776969_778451_+	DNA primase	NA	A0A1P8VVM0	Streptococcus_phage	100.0	1.3e-296
WP_002995960.1|778695_779016_+	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	100.0	2.0e-53
WP_011018138.1|778999_779356_+	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	100.0	5.0e-61
WP_011017568.1|779597_779882_+	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	100.0	7.0e-50
WP_002987593.1|779878_780148_+	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
WP_011054753.1|780157_780562_+	hypothetical protein	NA	Q938M1	Temperate_phage	100.0	6.0e-71
WP_011054752.1|780558_780729_+	hypothetical protein	NA	Q938M0	Temperate_phage	100.0	4.2e-26
WP_011054751.1|780725_781232_+	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	100.0	9.8e-95
WP_164997036.1|781228_781399_+	hypothetical protein	NA	A0A097PAS8	Streptococcus_pyogenes_phage	98.2	1.1e-26
WP_011285571.1|781923_782304_+	hypothetical protein	NA	A0A097PAR5	Streptococcus_pyogenes_phage	100.0	1.0e-64
WP_021299302.1|782293_783568_+|terminase	PBSX family phage terminase large subunit	terminase	A0A097PAV9	Streptococcus_pyogenes_phage	99.8	1.9e-251
WP_011528552.1|783567_784893_+|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	95.6	6.3e-234
WP_011528553.1|784861_785770_+|capsid	minor capsid protein	capsid	A0A097PBF2	Streptococcus_pyogenes_phage	94.5	2.4e-83
WP_011528554.1|785776_786007_+	hypothetical protein	NA	Q938K9	Temperate_phage	62.5	4.0e-19
WP_021299309.1|786118_786688_+	DUF4355 domain-containing protein	NA	A0A097PAW3	Streptococcus_pyogenes_phage	90.5	1.4e-60
WP_009880261.1|786706_787597_+	hypothetical protein	NA	A0A097PAW2	Streptococcus_pyogenes_phage	99.4	8.6e-86
WP_011528557.1|787608_787902_+	Rho termination factor N-terminal domain-containing protein	NA	A0A097PBF3	Streptococcus_pyogenes_phage	99.0	1.3e-46
WP_011528558.1|787915_788260_+	hypothetical protein	NA	A0A097PAS2	Streptococcus_pyogenes_phage	99.1	1.5e-54
WP_011528559.1|788256_788568_+	hypothetical protein	NA	A0A097PAW7	Streptococcus_pyogenes_phage	94.2	4.6e-47
WP_011528560.1|788564_788960_+	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	93.0	1.8e-56
WP_011528561.1|788961_789372_+	DUF5072 family protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	99.3	1.8e-70
WP_079890482.1|789383_789890_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	98.7	8.3e-78
WP_011528563.1|789902_790220_+	hypothetical protein	NA	A0A097PAS6	Streptococcus_pyogenes_phage	98.1	1.9e-51
WP_011528564.1|790192_790651_+	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	93.4	7.0e-76
WP_011528565.1|790643_792449_+|tail	tail protein	tail	A0A097PAU2	Streptococcus_pyogenes_phage	95.5	9.1e-252
WP_011528566.1|792449_793934_+|tail	phage tail family protein	tail	A0A097PAW9	Streptococcus_pyogenes_phage	98.8	1.8e-290
WP_050336170.1|793934_797384_+|tail	phage tail protein	tail	A0A097PBF5	Streptococcus_pyogenes_phage	99.0	0.0e+00
WP_011528568.1|797388_799251_+	hypothetical protein	NA	A0A097PAT0	Streptococcus_pyogenes_phage	99.8	0.0e+00
WP_009880247.1|799261_799609_+	DUF1366 domain-containing protein	NA	A0A097PAX5	Streptococcus_pyogenes_phage	100.0	3.5e-59
WP_015055952.1|799758_800082_+	hypothetical protein	NA	A0A097PAX2	Streptococcus_pyogenes_phage	100.0	7.7e-53
WP_011054798.1|800081_800414_+|holin	phage holin	holin	A0A097PBF6	Streptococcus_pyogenes_phage	100.0	5.7e-51
WP_011054797.1|800415_801180_+	CHAP domain-containing protein	NA	A0A097PAT3	Streptococcus_pyogenes_phage	100.0	1.5e-150
WP_011054796.1|801191_801794_+	hypothetical protein	NA	A0A097PAX9	Streptococcus_pyogenes_phage	98.8	7.8e-91
WP_011528569.1|801804_802578_+	hypothetical protein	NA	A0A097PAV0	Streptococcus_pyogenes_phage	94.6	4.6e-128
WP_009880241.1|802587_802809_+	hypothetical protein	NA	A0A097PAX7	Streptococcus_pyogenes_phage	84.5	2.5e-18
WP_011528570.1|802808_803468_+	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	96.3	6.3e-118
WP_011017966.1|803536_803971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285611.1|804242_805043_-	streptodornase Sda3	NA	NA	NA	NA	NA
WP_011528571.1|805280_805469_+	hypothetical protein	NA	A3F673	Streptococcus_phage	73.3	6.1e-18
809721:809736	attR	GCTGATTGATACGGTC	NA	NA	NA	NA
>prophage 5
NZ_CP020082	Streptococcus pyogenes strain STAB120304 chromosome, complete genome	1890354	1141687	1247744	1890354	protease,tail,head,tRNA,integrase,portal,terminase,capsid	Streptococcus_phage(47.14%)	116	1182769:1182788	1225448:1225467
WP_011184658.1|1141687_1142383_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_020905286.1|1142401_1143163_-	DUF3169 family protein	NA	NA	NA	NA	NA
WP_002989220.1|1143159_1143375_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_076639299.1|1143735_1146354_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.1	1.1e-61
WP_020905289.1|1146740_1147796_-	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_002989211.1|1147858_1148566_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	2.6e-08
WP_002995765.1|1148631_1149828_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_011054652.1|1150203_1152009_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_002983995.1|1152021_1152984_-	competence protein CoiA	NA	NA	NA	NA	NA
WP_020905292.1|1153279_1153996_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_009880651.1|1154114_1154819_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_076639300.1|1155020_1156049_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002983986.1|1156055_1157276_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_020905297.1|1157963_1158212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020905298.1|1158266_1158422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020905299.1|1158583_1159189_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	52.7	3.9e-58
WP_020905300.1|1159285_1160326_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_076639301.1|1160396_1162640_-	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	58.2	7.5e-54
WP_002983967.1|1162620_1163283_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_011054661.1|1163482_1164223_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_020905303.1|1164262_1165117_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011017953.1|1165106_1165385_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	7.9e-06
WP_020905304.1|1165408_1167409_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.0	3.4e-66
WP_020905305.1|1167536_1169156_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.5e-59
WP_020905306.1|1169462_1171007_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.8	1.1e-35
WP_011017956.1|1171254_1171950_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_076639302.1|1172029_1173421_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_020905307.1|1173619_1174666_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002983939.1|1174766_1175363_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_076639303.1|1176161_1176941_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_002989140.1|1177064_1177607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002983930.1|1177767_1178289_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002983928.1|1178395_1179091_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_023610138.1|1179329_1180265_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	44.8	3.0e-65
WP_076639304.1|1180564_1182427_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	1.9e-90
1182769:1182788	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_032463717.1|1182957_1183140_-	hypothetical protein	NA	A3F673	Streptococcus_phage	81.7	4.4e-21
WP_021340779.1|1183254_1184043_-	streptococcal pyrogenic exotoxin SpeL	NA	Q938J1	Temperate_phage	41.4	9.1e-47
WP_032463716.1|1184324_1185038_-	streptococcal pyrogenic exotoxin SpeM	NA	Q938J1	Temperate_phage	59.1	9.0e-78
WP_003051628.1|1185421_1186015_-	GNAT family N-acetyltransferase	NA	A0A0A8WFI2	Clostridium_phage	38.2	2.4e-23
WP_011018107.1|1186014_1186218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002994484.1|1187081_1187774_-	AP2 domain-containing protein	NA	A0A2H4J2S8	uncultured_Caudovirales_phage	34.2	1.5e-32
WP_023078271.1|1188006_1188564_-	glycoside hydrolase family 73 protein	NA	Q938J4	Temperate_phage	89.2	2.8e-95
WP_011054731.1|1188674_1188860_-	hypothetical protein	NA	Q938J5	Temperate_phage	100.0	1.7e-25
WP_023078532.1|1188856_1189153_-	hypothetical protein	NA	Q938J6	Temperate_phage	99.0	2.9e-46
WP_011017396.1|1189163_1189796_-	hypothetical protein	NA	Q938J7	Temperate_phage	50.0	8.9e-45
WP_032463718.1|1189798_1190227_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.3	9.8e-64
WP_076639305.1|1190238_1192125_-	gp58-like family protein	NA	Q938J9	Temperate_phage	84.9	8.1e-219
WP_032463712.1|1192139_1193153_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	98.2	1.6e-181
WP_050436577.1|1193152_1195258_-|tail	phage tail protein	tail	A3F656	Streptococcus_phage	43.1	2.3e-129
WP_030127447.1|1195254_1196025_-|tail	phage tail family protein	tail	A1EAB1	Streptococcus_phage	45.0	1.2e-56
WP_050436576.1|1196024_1198772_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	36.4	8.3e-55
WP_030127445.1|1198771_1199089_-	hypothetical protein	NA	A1EAF6	Streptococcus_phage	44.4	6.9e-14
WP_030127444.1|1199109_1199478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030127443.1|1199531_1200050_-|tail	phage major tail protein, TP901-1 family	tail	A1EAF4	Streptococcus_phage	51.7	2.2e-41
WP_030127442.1|1200037_1200436_-	DUF3168 domain-containing protein	NA	A1EAF3	Streptococcus_phage	44.5	3.8e-25
WP_030127441.1|1200432_1200789_-	HK97 gp10 family phage protein	NA	A1EAF2	Streptococcus_phage	44.0	4.7e-19
WP_032463711.1|1200788_1201085_-	hypothetical protein	NA	A0A1P8BKV3	Lactococcus_phage	35.6	9.6e-10
WP_030127439.1|1201081_1201435_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J002	uncultured_Caudovirales_phage	52.1	3.9e-26
WP_030127438.1|1201446_1201713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030127437.1|1201724_1202774_-|capsid	major capsid protein	capsid	A0A286QR01	Streptococcus_phage	57.7	1.8e-106
WP_002990036.1|1202776_1203157_-	structural protein	NA	A0A0K2CNR0	Brevibacillus_phage	36.3	6.4e-06
WP_030127436.1|1203166_1203700_-	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	82.5	1.8e-14
WP_030127435.1|1203843_1204110_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	77.3	4.1e-28
WP_032463710.1|1204125_1205040_-|capsid	minor capsid protein	capsid	A1EAE3	Streptococcus_phage	50.0	2.2e-73
WP_032461297.1|1205020_1206511_-|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.0	1.3e-142
WP_014635515.1|1206522_1207830_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	75.0	2.9e-183
WP_030127432.1|1207807_1208260_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	95.7	1.7e-66
WP_011054881.1|1208349_1208766_-	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
WP_023079210.1|1208749_1208896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054882.1|1208898_1209171_-	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_164972002.1|1209163_1209334_-	hypothetical protein	NA	A7J285	Streptococcus_phage	92.3	9.0e-21
WP_030127431.1|1209334_1210657_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.5	4.3e-251
WP_011054885.1|1210653_1210929_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	96.7	2.9e-45
WP_032463709.1|1211314_1213699_-	DNA primase	NA	A7J282	Streptococcus_phage	94.6	6.3e-277
WP_030127429.1|1213703_1215626_-	DNA polymerase	NA	A7J280	Streptococcus_phage	99.1	0.0e+00
WP_086934854.1|1215668_1216232_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_011888943.1|1216240_1217398_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	98.2	1.0e-216
WP_030127427.1|1217397_1217697_-	hypothetical protein	NA	A7J277	Streptococcus_phage	96.0	3.7e-41
WP_030127426.1|1217784_1217988_-	hypothetical protein	NA	A7J276	Streptococcus_phage	89.6	3.7e-29
WP_017647437.1|1217984_1218137_-	hypothetical protein	NA	A7J275	Streptococcus_phage	98.0	9.9e-19
WP_030127425.1|1218133_1218520_-	hypothetical protein	NA	A7J274	Streptococcus_phage	87.4	6.8e-56
WP_030127424.1|1218516_1218720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023611037.1|1218712_1218883_-	hypothetical protein	NA	A7J273	Streptococcus_phage	87.5	2.9e-19
WP_014411880.1|1218884_1219196_-	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.6	1.4e-43
WP_011054585.1|1219273_1219459_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011284879.1|1219625_1219865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|1220014_1220224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157159.1|1220469_1220676_-	helix-turn-helix domain-containing protein	NA	A0A1X9I5S3	Streptococcus_phage	64.7	1.1e-17
WP_050429000.1|1220725_1221232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340823.1|1221228_1221375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030127422.1|1221429_1222029_+	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	99.5	9.1e-108
WP_076636802.1|1222059_1222218_-	hypothetical protein	NA	A0A097PAP2	Streptococcus_pyogenes_phage	98.1	1.1e-23
WP_030127421.1|1222607_1223366_+	helix-turn-helix domain-containing protein	NA	A0A097PBE5	Streptococcus_pyogenes_phage	65.9	3.1e-84
WP_030127420.1|1223400_1224081_+	hypothetical protein	NA	A0A097PAS7	Streptococcus_pyogenes_phage	87.7	1.2e-74
WP_003051793.1|1224217_1225360_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_002983920.1|1225449_1225725_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
1225448:1225467	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_002989129.1|1225823_1226411_-	YpmS family protein	NA	NA	NA	NA	NA
WP_002992620.1|1226388_1227231_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_161237429.1|1227223_1228075_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	9.2e-13
WP_076639306.1|1228290_1229205_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_076639307.1|1229376_1231038_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002983907.1|1231058_1231529_-	arginine repressor	NA	NA	NA	NA	NA
WP_011017996.1|1231515_1232343_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_076639308.1|1232335_1233208_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002983901.1|1233207_1233423_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_076639309.1|1233400_1234741_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	6.3e-40
WP_010922486.1|1234893_1235748_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.0e-39
WP_076639310.1|1235955_1237650_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.2	4.5e-128
WP_023610117.1|1237827_1239237_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	8.8e-61
WP_010922488.1|1239385_1240120_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	8.2e-34
WP_011054708.1|1240119_1240806_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002983885.1|1240932_1241163_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_002983882.1|1241460_1243743_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.6	1.1e-124
WP_020905319.1|1243870_1244326_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002983878.1|1244376_1244679_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_076639311.1|1244942_1247744_-|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	27.0	1.4e-70
>prophage 6
NZ_CP020082	Streptococcus pyogenes strain STAB120304 chromosome, complete genome	1890354	1281049	1324865	1890354	holin,tail,integrase,portal,terminase,capsid	Temperate_phage(80.0%)	65	1306656:1306672	1325044:1325060
WP_076639316.1|1281049_1282783_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.2	2.3e-26
WP_023610925.1|1282779_1283520_-	response regulator	NA	NA	NA	NA	NA
WP_011054726.1|1283764_1283947_-	hypothetical protein	NA	A3F673	Streptococcus_phage	76.7	2.6e-18
WP_011054727.1|1284292_1284868_-	hypothetical protein	NA	Q938J0	Temperate_phage	100.0	1.7e-111
WP_011054728.1|1285343_1286123_-	streptococcal pyrogenic exotoxin SpeK	NA	Q938J1	Temperate_phage	100.0	5.4e-145
WP_076639317.1|1286426_1287293_-	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	99.3	2.4e-133
WP_011017840.1|1287280_1287805_-	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
WP_011054730.1|1287944_1289147_-	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	100.0	3.3e-242
WP_011054444.1|1289262_1289490_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	7.6e-31
WP_011017397.1|1289486_1289759_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_172841026.1|1289770_1290058_-	hypothetical protein	NA	Q938J7	Temperate_phage	86.3	2.7e-41
WP_002988448.1|1290406_1290835_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	84.3	8.1e-58
WP_047235372.1|1290846_1292736_-	gp58-like family protein	NA	Q938J9	Temperate_phage	75.6	1.4e-189
WP_011284842.1|1292746_1293076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284843.1|1293062_1294277_-	hypothetical protein	NA	A3F657	Streptococcus_phage	49.5	5.0e-44
WP_076639318.1|1294273_1296421_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	93.8	0.0e+00
WP_076639319.1|1296417_1297134_-|tail	phage tail family protein	tail	Q938K2	Temperate_phage	95.8	1.8e-131
WP_076639320.1|1297130_1300391_-	tape measure protein	NA	Q938K3	Temperate_phage	99.8	0.0e+00
WP_011054739.1|1300380_1300962_-	hypothetical protein	NA	Q938K4	Temperate_phage	100.0	1.3e-106
WP_011054740.1|1300965_1301400_-	hypothetical protein	NA	Q938K5	Temperate_phage	100.0	2.6e-72
WP_011054741.1|1301438_1301924_-	hypothetical protein	NA	Q938K6	Temperate_phage	100.0	1.6e-86
WP_010922084.1|1301923_1302322_-|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	100.0	3.5e-71
WP_010922083.1|1302318_1302675_-	hypothetical protein	NA	Q79S88	Temperate_phage	100.0	4.5e-62
WP_010922082.1|1302674_1303007_-	hypothetical protein	NA	Q79S86	Temperate_phage	100.0	9.6e-59
WP_011054743.1|1302996_1303413_-	hypothetical protein	NA	Q938K7	Temperate_phage	100.0	1.1e-56
WP_010922080.1|1303466_1304285_-|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
WP_011106689.1|1304288_1304903_-	hypothetical protein	NA	Q938K8	Temperate_phage	100.0	1.3e-96
WP_011054745.1|1305028_1305295_-	hypothetical protein	NA	Q938K9	Temperate_phage	100.0	1.5e-38
WP_002986829.1|1305356_1305596_-	hypothetical protein	NA	Q938L0	Temperate_phage	100.0	2.8e-36
WP_011054746.1|1305567_1307046_-|capsid	phage minor capsid protein	capsid	Q938L1	Temperate_phage	100.0	8.2e-275
1306656:1306672	attL	CATCAATAGCTTGTCTA	NA	NA	NA	NA
WP_002986832.1|1307050_1308553_-|portal	phage portal protein	portal	Q938L2	Temperate_phage	100.0	5.4e-282
WP_010922074.1|1308566_1309778_-|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	99.7	3.7e-225
WP_011054747.1|1309860_1310334_-	hypothetical protein	NA	Q938L4	Temperate_phage	99.4	4.3e-76
WP_002986841.1|1310384_1310762_-	ASCH domain-containing protein	NA	Q938L5	Temperate_phage	100.0	1.7e-67
WP_076639321.1|1310822_1311206_-	GNAT family N-acetyltransferase	NA	B5SP24	Lactococcus_phage	58.5	3.9e-35
WP_076639322.1|1311231_1311750_-	ParB N-terminal domain-containing protein	NA	Q938L7	Temperate_phage	99.4	1.1e-88
WP_011054748.1|1311830_1312088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164997036.1|1313103_1313274_-	hypothetical protein	NA	A0A097PAS8	Streptococcus_pyogenes_phage	98.2	1.1e-26
WP_011054751.1|1313270_1313777_-	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	100.0	9.8e-95
WP_011054752.1|1313773_1313944_-	hypothetical protein	NA	Q938M0	Temperate_phage	100.0	4.2e-26
WP_011054753.1|1313940_1314345_-	hypothetical protein	NA	Q938M1	Temperate_phage	100.0	6.0e-71
WP_011054754.1|1314354_1314624_-	hypothetical protein	NA	Q938M2	Temperate_phage	100.0	4.0e-47
WP_011054755.1|1314620_1314905_-	DUF3310 domain-containing protein	NA	Q938M3	Temperate_phage	100.0	5.4e-50
WP_011054756.1|1314898_1315150_-	hypothetical protein	NA	Q938M4	Temperate_phage	100.0	6.8e-41
WP_011054757.1|1315146_1315503_-	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	85.6	1.6e-51
WP_011054758.1|1315499_1315940_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	97.3	8.5e-79
WP_011106686.1|1315939_1316143_-	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
WP_011054759.1|1316148_1316568_-	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	100.0	1.6e-71
WP_011054760.1|1316560_1317235_-	ERF family protein	NA	Q938M8	Temperate_phage	100.0	2.5e-106
WP_011018142.1|1317235_1317718_-	siphovirus Gp157 family protein	NA	Q938M9	Temperate_phage	100.0	8.2e-51
WP_011054761.1|1317739_1317994_-	hypothetical protein	NA	Q938N0	Temperate_phage	100.0	7.4e-43
WP_011284979.1|1318004_1318145_-	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	52.3	7.5e-05
WP_011054762.1|1318141_1318375_-	hypothetical protein	NA	Q938N1	Temperate_phage	100.0	5.0e-38
WP_011054763.1|1318355_1318769_-	DnaD domain protein	NA	Q938N2	Temperate_phage	100.0	2.1e-63
WP_011054765.1|1319241_1319427_-	hypothetical protein	NA	Q938N3	Temperate_phage	100.0	1.1e-24
WP_002988339.1|1319455_1319713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054766.1|1319958_1320213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002986887.1|1320201_1320402_+	KTSC domain-containing protein	NA	A0A1S5S8T9	Streptococcus_phage	72.3	6.3e-21
WP_002986888.1|1320398_1320548_-	hypothetical protein	NA	Q938N4	Temperate_phage	100.0	1.8e-20
WP_011054767.1|1320580_1321309_-	phage antirepressor KilAC domain-containing protein	NA	Q938N5	Temperate_phage	100.0	6.9e-134
WP_002986891.1|1321319_1321511_-	hypothetical protein	NA	A7J270	Streptococcus_phage	90.5	1.2e-24
WP_011054768.1|1322306_1322666_+	helix-turn-helix transcriptional regulator	NA	Q938N6	Temperate_phage	100.0	1.1e-60
WP_002986894.1|1322679_1323060_+	hypothetical protein	NA	Q938N7	Temperate_phage	100.0	5.3e-69
WP_002986895.1|1323070_1323592_+	hypothetical protein	NA	Q938N8	Temperate_phage	100.0	2.3e-67
WP_002986896.1|1323710_1324865_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	100.0	2.8e-206
1325044:1325060	attR	TAGACAAGCTATTGATG	NA	NA	NA	NA
