The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022525	Pseudomonas aeruginosa strain Ocean-1175 chromosome, complete genome	6943220	293415	401342	6943220	tail,tRNA,plate,terminase,lysis,capsid,head,portal	uncultured_Caudovirales_phage(25.53%)	112	NA	NA
WP_003092163.1|293415_293886_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003092166.1|294150_294990_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	30.4	5.2e-16
WP_003092168.1|295029_296547_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003092173.1|296752_297508_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.7	1.6e-24
WP_003098460.1|297786_299325_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003119370.1|299457_299787_+	GlpM family protein	NA	NA	NA	NA	NA
WP_003092179.1|299803_300790_-	alpha/beta hydrolase	NA	A0A249XTE1	Mycobacterium_phage	29.3	3.0e-07
WP_003109716.1|301088_302009_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023100870.1|302014_303265_-	OprD family porin	NA	NA	NA	NA	NA
WP_023100869.1|303317_304523_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_023100868.1|304545_306078_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_021265152.1|306074_306872_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_023092583.1|306931_308119_-	CoA transferase	NA	NA	NA	NA	NA
WP_094069632.1|308157_309885_-	DNA alkylation response protein	NA	NA	NA	NA	NA
WP_021265153.1|309998_310886_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003109708.1|311104_312514_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_003119362.1|312510_313584_-	bifunctional transcriptional activator/DNA repair protein Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	45.6	3.9e-16
WP_003138044.1|313673_314996_-	APC family permease	NA	NA	NA	NA	NA
WP_003092205.1|315195_316011_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003092207.1|316138_316924_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003092209.1|316951_317104_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_003092213.1|317103_317367_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003092223.1|317610_319221_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_003092226.1|319290_319662_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_003092229.1|319733_320387_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_021265155.1|320519_321446_+	DMT family transporter	NA	NA	NA	NA	NA
WP_021265156.1|321449_322166_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_073658164.1|322408_323515_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.6	1.7e-30
WP_003092241.1|323519_324413_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003092244.1|324405_325176_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017002184.1|325264_326329_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003092248.1|326504_326915_+	quorum-sensing-regulated virulence factor family protein	NA	NA	NA	NA	NA
WP_003092249.1|326933_327155_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_021265157.1|327278_329684_-	D-xylulose 5-phosphate/D-fructose 6-phosphate phosphoketolase	NA	NA	NA	NA	NA
WP_003098484.1|329863_331267_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003092255.1|331349_332420_+	LOG family protein	NA	NA	NA	NA	NA
WP_003109699.1|332441_332903_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003092260.1|332908_333949_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
WP_003092262.1|334082_334589_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_021265158.1|334736_335744_+	TolB family protein	NA	NA	NA	NA	NA
WP_015649036.1|336843_337530_+	hypothetical protein	NA	A0A2K8I970	Pseudomonas_phage	86.0	1.9e-117
WP_015649037.1|337511_337775_-	hypothetical protein	NA	B5WZU6	Pseudomonas_phage	92.0	1.3e-42
WP_011805433.1|338405_339827_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_015649038.1|340362_340860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079391887.1|341186_341768_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_062832760.1|341737_342367_-	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	68.9	2.4e-74
WP_014603877.1|342478_342664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015649041.1|342701_343754_-|tail	tail formation pyocin	tail	A0A2H4JBF6	uncultured_Caudovirales_phage	70.3	1.3e-133
WP_015649042.1|343768_343975_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	62.7	9.6e-17
WP_062832759.1|343949_344789_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	53.9	1.3e-80
WP_015649044.1|344797_347488_-|tail	tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	29.1	1.8e-41
WP_014603883.1|347626_347923_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_015649045.1|347932_348442_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	100.0	1.4e-88
WP_015649046.1|348454_349615_-|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	97.7	4.4e-215
WP_015649047.1|349658_350120_-	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	38.9	1.5e-17
WP_015649048.1|350116_352198_-|tail	tail fiber	tail	Q9ZXK6	Pseudomonas_virus	38.6	4.7e-111
WP_062832756.1|352194_352725_-|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	57.4	4.1e-51
WP_014603889.1|352721_353606_-|plate	baseplate assembly protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	73.6	7.4e-114
WP_014603890.1|353602_353929_-	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	65.7	2.3e-33
WP_014603891.1|353938_354160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014603892.1|354217_354775_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	67.0	3.4e-48
WP_015649050.1|354771_355308_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	44.5	7.8e-34
WP_015649051.1|355300_355969_-	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	58.8	8.2e-65
WP_015649052.1|355968_356283_-	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	45.8	2.1e-18
WP_043501284.1|356285_356471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015649053.1|356472_357510_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	40.5	1.7e-69
WP_014603897.1|357525_357876_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	42.2	2.5e-12
WP_015649054.1|357889_359110_-	S49 family peptidase	NA	A0A219YAK4	Aeromonas_phage	34.6	7.0e-46
WP_031757828.1|359112_360726_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	39.6	9.4e-91
WP_014603900.1|360728_360944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052168395.1|360956_362843_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	49.7	4.5e-161
WP_015649057.1|362886_363411_-|terminase	phage DNA packaging protein, Nu1 subunit of terminase	terminase	A0A2D1GMW4	Marinobacter_phage	37.2	1.2e-18
WP_014603903.1|363527_363890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011805433.1|364039_365461_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_019396873.1|366382_366754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094069682.1|366750_368964_-	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	46.8	8.7e-188
WP_023107143.1|368960_369170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726483.1|369162_369717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726484.1|370033_370288_-	hypothetical protein	NA	A0A2H4JA29	uncultured_Caudovirales_phage	45.6	1.5e-06
WP_094069681.1|370394_371108_+	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	34.4	1.8e-22
WP_031691633.1|371390_371702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019727252.1|371711_372005_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_031631574.1|372158_372467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031691635.1|372463_372781_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062832749.1|372831_373458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726491.1|373454_373694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153995490.1|373702_374263_+	hypothetical protein	NA	A0A2I7S6F6	Vibrio_phage	56.2	5.7e-11
WP_043503416.1|374259_374742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094069680.1|374738_376574_+	DNA cytosine methyltransferase	NA	A0A1I9KFW0	Aeromonas_phage	38.3	9.0e-98
WP_094069679.1|377059_377272_+	excisionase	NA	NA	NA	NA	NA
WP_062832747.1|377238_378477_+	DUF3596 domain-containing protein	NA	A0A1I9KF78	Aeromonas_phage	39.8	6.6e-68
WP_062832746.1|378883_379672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094069742.1|379956_382524_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_003092272.1|382590_382914_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_011805433.1|383041_384463_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_003113871.1|385263_386268_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_021265159.1|386372_387266_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003098558.1|387311_387947_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003092341.1|387979_388729_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.0	6.8e-68
WP_023100864.1|388716_389784_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_003092346.1|389780_390254_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_003163269.1|390324_391176_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003092351.1|391229_392342_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.1	1.3e-35
WP_003092354.1|392473_393382_+	glutathione-dependent formaldehyde neutralization regulator	NA	NA	NA	NA	NA
WP_003092355.1|393457_394684_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_003092358.1|394649_394898_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_003092359.1|394958_395663_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003098569.1|395682_395967_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_003092364.1|396031_397321_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	61.5	2.5e-139
WP_021265161.1|397366_398212_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.9	2.3e-48
WP_003092366.1|398214_399843_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.1	4.0e-158
WP_044727069.1|400013_401342_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	M1IB95	Acanthocystis_turfacea_Chlorella_virus	24.1	7.7e-06
>prophage 2
NZ_CP022525	Pseudomonas aeruginosa strain Ocean-1175 chromosome, complete genome	6943220	1153070	1188253	6943220	tRNA,tail,holin,plate	uncultured_Caudovirales_phage(27.27%)	41	NA	NA
WP_003113167.1|1153070_1154270_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_073656511.1|1154554_1155898_+	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
WP_004355127.1|1155900_1156992_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_003085254.1|1157045_1157396_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_003120826.1|1157473_1157896_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003085249.1|1157896_1158616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003101649.1|1158615_1159650_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003085245.1|1159940_1160363_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_003085244.1|1160379_1161348_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003085240.1|1161469_1162552_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003085237.1|1162612_1163413_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004355118.1|1163452_1164934_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.8	6.7e-67
WP_003085225.1|1165012_1165351_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003085224.1|1165450_1166098_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003085223.1|1166152_1166947_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_003085219.1|1167266_1167689_-	OsmC family protein	NA	NA	NA	NA	NA
WP_021263052.1|1167961_1168606_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_021263053.1|1168667_1169504_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	1.6e-70
WP_003085203.1|1169500_1170550_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003117978.1|1170551_1171157_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003118919.1|1171504_1171762_-	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_023100785.1|1171758_1172121_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.1	7.1e-15
WP_023100784.1|1172117_1172747_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	7.1e-87
WP_021263054.1|1172779_1173769_-	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.5	3.7e-106
WP_003101635.1|1173826_1174033_-	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_094069670.1|1174007_1174880_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_023100783.1|1174889_1177127_-|tail	phage tail length determinator protein	tail	NA	NA	NA	NA
WP_094069669.1|1177296_1177641_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003085175.1|1177655_1178159_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003109051.1|1178171_1179332_-|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003085172.1|1179374_1179815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015502281.1|1179823_1181932_-|tail	tail fiber	tail	Q9ZXK6	Pseudomonas_virus	52.3	6.5e-225
WP_003137385.1|1181933_1182467_-|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_003085151.1|1182459_1183347_-	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003085143.1|1183343_1183670_-	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003121844.1|1183822_1184380_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
WP_021263056.1|1184376_1184892_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	6.3e-33
WP_094069668.1|1184913_1185339_-|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	4.7e-26
WP_011805433.1|1185392_1186814_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_003085135.1|1187645_1188005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085132.1|1188052_1188253_-	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
>prophage 3
NZ_CP022525	Pseudomonas aeruginosa strain Ocean-1175 chromosome, complete genome	6943220	1736957	1791420	6943220	plate,transposase	Moumouvirus(20.0%)	50	NA	NA
WP_003104969.1|1736957_1738004_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_003083676.1|1737967_1739827_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003111625.1|1739823_1740333_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_073665600.1|1740334_1741180_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003083670.1|1741347_1741836_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003104973.1|1741911_1743408_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003083666.1|1743420_1743939_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_023100711.1|1744027_1745062_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_023098299.1|1745429_1746953_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_003083660.1|1746997_1747462_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_003115052.1|1747477_1748812_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014603461.1|1748818_1750168_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_094069663.1|1750164_1753698_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_003083642.1|1753694_1754375_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_003083639.1|1754384_1755113_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_023100709.1|1755120_1758219_+	protein kinase	NA	M1PCM5	Moumouvirus	27.8	2.5e-23
WP_023100708.1|1758215_1758935_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	3.3e-19
WP_003128189.1|1758934_1760134_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023100707.1|1760126_1761839_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_003083630.1|1761900_1762815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023100706.1|1763045_1764104_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_003083624.1|1764192_1764468_-	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_003083621.1|1764464_1766510_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.3	4.6e-34
WP_003083618.1|1766587_1767130_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_021263017.1|1767122_1767788_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_023100705.1|1767820_1768804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118564.1|1768811_1769939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083614.1|1770030_1770447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083612.1|1770503_1770941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003114662.1|1770952_1771186_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_021263016.1|1771296_1771752_-	OsmC family protein	NA	NA	NA	NA	NA
WP_009314899.1|1771835_1772540_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003083599.1|1772602_1773490_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003083596.1|1773597_1774518_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021263013.1|1774583_1775090_+	DUF1993 family protein	NA	NA	NA	NA	NA
WP_023100703.1|1775128_1775677_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	41.6	6.1e-34
WP_003083588.1|1775884_1776313_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_023100702.1|1776365_1778198_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	28.3	2.7e-17
WP_003083582.1|1779018_1779159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023100701.1|1779775_1781437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083575.1|1781718_1782102_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003083573.1|1782116_1782782_-	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_003083569.1|1782778_1783132_-	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_003111706.1|1783162_1783849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003111705.1|1784344_1785718_-	T3SS effector bifunctional cytotoxin exoenzyme T	NA	NA	NA	NA	NA
WP_021263010.1|1785881_1787291_+	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_003083536.1|1787555_1787951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003114585.1|1788049_1788328_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153549618.1|1789683_1790673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021263006.1|1790718_1791420_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP022525	Pseudomonas aeruginosa strain Ocean-1175 chromosome, complete genome	6943220	2935916	2977186	6943220	tRNA,transposase,integrase,coat	Pseudomonas_phage(50.0%)	45	2927232:2927248	2959981:2959997
2927232:2927248	attL	CGGCGCCGGCGGCCAGC	NA	NA	NA	NA
WP_094069644.1|2935916_2937005_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	37.0	3.9e-08
WP_124142479.1|2937005_2937941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094069643.1|2937940_2938738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094069642.1|2938738_2939626_-	thymidylate synthase	NA	A0A218MKK4	uncultured_virus	33.3	2.5e-21
WP_004577240.1|2939571_2940534_-|transposase	IS30-like element ISPpu17 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.7	9.7e-43
WP_058128192.1|2940851_2941160_-	DUF4031 domain-containing protein	NA	A0A0M7QF68	Escherichia_phage	42.0	6.5e-09
WP_003115921.1|2941650_2941923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034028223.1|2942134_2942422_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	91.6	2.4e-50
WP_003133746.1|2942429_2943074_+	DNA cytosine methyltransferase	NA	E3SMD8	Cyanophage	64.4	4.3e-63
WP_094069641.1|2943077_2943455_+	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	97.6	1.2e-60
WP_031635504.1|2943589_2944024_+	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	97.9	7.9e-61
WP_033981266.1|2944040_2944133_+	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	96.7	6.1e-08
WP_003115979.1|2944145_2944397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003125072.1|2944409_2944658_+|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_094069640.1|2944793_2946062_+	attachment protein	NA	Q56VP1	Pseudomonas_phage	57.2	4.1e-57
WP_003114150.1|2946066_2946423_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_094069639.1|2946426_2947701_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	86.8	1.8e-198
WP_004352686.1|2947930_2949223_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.8e-241
WP_016253914.1|2949219_2950221_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.8	3.4e-75
WP_070341487.1|2950201_2950612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099270.1|2951006_2952107_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_003099278.1|2952147_2952732_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003095013.1|2952772_2953387_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099281.1|2953503_2954445_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_009878189.1|2954611_2955460_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003095005.1|2955461_2956079_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_003135130.1|2956083_2957856_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_023101596.1|2957999_2959268_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003094997.1|2959285_2960368_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	4.3e-07
2959981:2959997	attR	CGGCGCCGGCGGCCAGC	NA	NA	NA	NA
WP_003114694.1|2960369_2961200_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003135128.1|2961193_2961952_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_003099300.1|2961941_2962739_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003099307.1|2962872_2963394_+	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_021264087.1|2963519_2964965_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	28.0	1.1e-45
WP_003141623.1|2964961_2965861_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_021264088.1|2965870_2966827_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003094987.1|2966979_2967963_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003114699.1|2968376_2969294_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_021264089.1|2969290_2970313_+	ferrochelatase	NA	NA	NA	NA	NA
WP_003099328.1|2970592_2971966_+	MFS transporter	NA	NA	NA	NA	NA
WP_003099330.1|2971967_2972915_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_021264091.1|2972911_2975287_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_021264092.1|2975303_2976092_-	molecular chaperone	NA	NA	NA	NA	NA
WP_021264093.1|2976110_2976653_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003135089.1|2976652_2977186_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP022525	Pseudomonas aeruginosa strain Ocean-1175 chromosome, complete genome	6943220	3552235	3559208	6943220	integrase	Pseudomonas_phage(100.0%)	10	3548392:3548409	3560153:3560170
3548392:3548409	attL	TGGAGCGGGCGAAGGGAA	NA	NA	NA	NA
WP_057391439.1|3552235_3552613_+	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	96.8	1.2e-60
WP_003140508.1|3552747_3553182_+	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_003115130.1|3553198_3553291_+	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003124954.1|3553302_3553554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124953.1|3553567_3553786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033953308.1|3554102_3555050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003133726.1|3555059_3555410_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	40.2	1.6e-19
WP_033953311.1|3555411_3556674_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	57.2	1.6e-117
WP_003123045.1|3556932_3558225_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.0	4.8e-247
WP_034014422.1|3558224_3559208_+|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.3	2.1e-93
3560153:3560170	attR	TGGAGCGGGCGAAGGGAA	NA	NA	NA	NA
>prophage 6
NZ_CP022525	Pseudomonas aeruginosa strain Ocean-1175 chromosome, complete genome	6943220	3745739	3795445	6943220	tail,holin,terminase,protease,lysis,transposase,portal,integrase	Pseudomonas_phage(88.14%)	65	3751634:3751662	3792329:3792357
WP_087920907.1|3745739_3746902_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	9.5e-85
WP_003111823.1|3747452_3748541_-	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	34.7	9.0e-37
WP_003111822.1|3748557_3749259_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	50.5	1.7e-49
WP_021264316.1|3749255_3749774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023101493.1|3749947_3750283_-	TM2 domain-containing protein	NA	A0A240F358	Aeromonas_phage	41.7	5.6e-06
WP_003109444.1|3750525_3751164_-	hypothetical protein	NA	NA	NA	NA	NA
3751634:3751662	attL	GTTTGGTGGAGCCGGGGGGATTTGAACCC	NA	NA	NA	NA
WP_014603615.1|3752147_3752591_-	SocA family protein	NA	I6R0L8	Salmonella_phage	56.8	4.3e-46
WP_023083766.1|3752657_3753836_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	96.3	8.7e-211
WP_025991893.1|3753978_3754308_-	hypothetical protein	NA	A0A1W6JT94	Pseudomonas_phage	97.2	2.4e-57
WP_019486526.1|3754300_3755020_-	hypothetical protein	NA	A0A1W6JTE0	Pseudomonas_phage	88.7	1.9e-115
WP_021205282.1|3755016_3755208_-	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	98.4	2.0e-29
WP_019486522.1|3756004_3756436_-	hypothetical protein	NA	H2BD44	Pseudomonas_phage	93.1	3.8e-63
WP_019486521.1|3756432_3756861_-	hypothetical protein	NA	A0A291AUJ5	Sinorhizobium_phage	40.9	2.3e-12
WP_025991892.1|3756905_3757742_-	prohibitin family protein	NA	A0A0A0YRT7	Pseudomonas_phage	99.6	2.2e-128
WP_019486519.1|3757738_3757993_-	hypothetical protein	NA	A0A0A0YUF2	Pseudomonas_phage	98.8	1.4e-38
WP_021205288.1|3758092_3758326_-	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	100.0	6.6e-38
WP_033955697.1|3758328_3758709_-	response regulator transcription factor	NA	A0A1W6JTA9	Pseudomonas_phage	61.2	2.2e-30
WP_079383751.1|3758822_3759593_-	helix-turn-helix transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	52.3	2.2e-61
WP_124142574.1|3760506_3760824_+	hypothetical protein	NA	A0A1W6JTB5	Pseudomonas_phage	76.2	5.2e-38
WP_079380365.1|3760895_3761093_+	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	69.2	5.6e-14
WP_033955703.1|3761089_3761398_+	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	98.0	9.3e-48
WP_033955705.1|3761394_3761673_+	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	98.9	9.9e-41
WP_033955708.1|3761665_3761899_+	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	97.4	1.3e-33
WP_045404389.1|3761895_3762660_+	phage-like protein	NA	A0A1W6JTB2	Pseudomonas_phage	98.0	4.5e-136
WP_023124259.1|3762656_3762887_+	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	98.7	2.0e-39
WP_023086959.1|3762883_3763723_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	96.1	7.9e-150
WP_052159129.1|3763898_3764519_+	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	99.0	6.5e-109
WP_059399862.1|3764515_3765913_+	AAA family ATPase	NA	A0A1W6JTB3	Pseudomonas_phage	99.8	8.5e-266
WP_015648203.1|3765909_3766188_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	100.0	2.3e-45
WP_004353175.1|3766184_3766574_+	hypothetical protein	NA	A0A1W6JTD2	Pseudomonas_phage	99.2	2.2e-70
WP_011805433.1|3767109_3768531_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_023086963.1|3769284_3769617_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	98.2	2.2e-55
WP_094069683.1|3769613_3770231_+	glycoside hydrolase family 19 protein	NA	A0A1W6JTC9	Pseudomonas_phage	89.2	1.2e-102
WP_094069743.1|3770230_3770470_+	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	51.9	1.1e-19
WP_094069684.1|3770466_3770937_+|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	91.0	3.1e-71
WP_094069685.1|3770933_3771677_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	99.2	1.4e-134
WP_003159067.1|3771796_3772342_+	DNA packaging dimer small subunit	NA	A0A1B0Z033	Pseudomonas_phage	98.9	2.1e-95
WP_023086966.1|3772313_3774278_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	98.3	0.0e+00
WP_003159069.1|3774268_3774484_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	100.0	6.5e-32
WP_019486499.1|3774483_3776130_+|portal	phage portal protein	portal	A0A1W6JTB6	Pseudomonas_phage	99.8	0.0e+00
WP_019486498.1|3776089_3778183_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	99.3	0.0e+00
WP_019486497.1|3778249_3778567_+	DUF2190 family protein	NA	A0A1W6JT93	Pseudomonas_phage	99.0	1.7e-49
WP_019486496.1|3778563_3778893_+	hypothetical protein	NA	A0A1W6JT71	Pseudomonas_phage	98.2	1.2e-56
WP_023101769.1|3778889_3779360_+	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	99.4	2.0e-86
WP_034068506.1|3779363_3779558_+	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	95.3	1.3e-26
WP_023086968.1|3779559_3780312_+	hypothetical protein	NA	A0A1W6JT83	Pseudomonas_phage	99.2	8.1e-138
WP_071538383.1|3780636_3780828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029528987.1|3780884_3781187_+|tail	phage tail assembly protein	tail	A0A1W6JT80	Pseudomonas_phage	98.0	5.9e-47
WP_034068508.1|3781289_3783773_+	tape measure protein	NA	A0A1B0YZV6	Pseudomonas_phage	98.3	0.0e+00
WP_029528986.1|3783812_3784334_+	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	97.7	2.8e-97
WP_074227459.1|3784333_3786031_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	96.5	0.0e+00
WP_019486489.1|3786033_3786444_+	hypothetical protein	NA	A0A1B0YZV0	Pseudomonas_phage	88.9	1.1e-59
WP_073659933.1|3787000_3787405_+	hypothetical protein	NA	A0A0A0YR47	Pseudomonas_phage	99.3	1.5e-66
WP_023086972.1|3787401_3789072_+	hypothetical protein	NA	A0A0A0YRR5	Pseudomonas_phage	61.8	7.0e-206
WP_023086973.1|3789099_3789687_+	hypothetical protein	NA	A0A0U4B0K9	Pseudomonas_phage	96.4	3.0e-103
WP_023086974.1|3789679_3789871_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	98.4	2.0e-29
WP_019486484.1|3789875_3790436_+	hypothetical protein	NA	A0A1W6JT84	Pseudomonas_phage	99.5	2.9e-100
WP_023103825.1|3790436_3790718_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	98.9	1.8e-45
WP_031640388.1|3790710_3791274_+	hypothetical protein	NA	A0A0A0YRS1	Pseudomonas_phage	100.0	1.9e-99
WP_023103826.1|3791273_3791576_+	hypothetical protein	NA	A0A0A0YUD8	Pseudomonas_phage	98.0	1.4e-48
WP_019486481.1|3791572_3791812_+	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	92.2	5.0e-33
WP_019486480.1|3791884_3792109_+	hypothetical protein	NA	A0A1W6JT95	Pseudomonas_phage	98.6	4.7e-33
WP_021264318.1|3792745_3793624_-	hypothetical protein	NA	NA	NA	NA	NA
3792329:3792357	attR	GTTTGGTGGAGCCGGGGGGATTTGAACCC	NA	NA	NA	NA
WP_003085795.1|3793711_3794395_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085798.1|3794503_3795445_+	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	33.3	4.4e-08
>prophage 7
NZ_CP022525	Pseudomonas aeruginosa strain Ocean-1175 chromosome, complete genome	6943220	5075070	5128650	6943220	terminase,head,integrase	Pseudomonas_phage(84.51%)	76	5075707:5075722	5078791:5078806
WP_003111315.1|5075070_5076660_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	5.9e-61
5075707:5075722	attL	CTGGCGGTGCAGCTTC	NA	NA	NA	NA
WP_033989293.1|5076690_5077908_-|integrase	site-specific integrase	integrase	A0A125RNP5	Pseudomonas_phage	99.0	6.6e-230
WP_071537486.1|5078186_5078621_-	DUF2591 family protein	NA	A0A125RNP6	Pseudomonas_phage	96.5	3.8e-79
WP_094069691.1|5078617_5078977_-	hypothetical protein	NA	A0A1L2C9A6	Pseudomonas_phage	40.9	2.5e-12
5078791:5078806	attR	GAAGCTGCACCGCCAG	NA	NA	NA	NA
WP_094069692.1|5078973_5079633_-	hypothetical protein	NA	Q9MC82	Pseudomonas_phage	53.5	1.5e-50
WP_124142510.1|5079629_5079833_-	hypothetical protein	NA	A0A127KNH7	Pseudomonas_phage	100.0	3.8e-34
WP_094069693.1|5079833_5080118_-	hypothetical protein	NA	V5JXG1	Pseudomonas_phage	63.0	4.4e-28
WP_094069694.1|5080120_5080606_-	hypothetical protein	NA	W6MVE9	Pseudomonas_phage	97.5	1.4e-87
WP_094069695.1|5080777_5081095_-	hypothetical protein	NA	A0A1B0Z2L6	Pseudomonas_phage	93.3	7.1e-51
WP_094069696.1|5081139_5081460_-	hypothetical protein	NA	A0A0A1IUI9	Pseudomonas_phage	89.1	3.7e-15
WP_003159448.1|5081452_5081653_-	hypothetical protein	NA	A0A0S2SY76	Pseudomonas_phage	100.0	2.9e-34
WP_016852531.1|5081642_5082305_-	hypothetical protein	NA	Q9MC60	Pseudomonas_phage	51.8	4.9e-46
WP_016852532.1|5082297_5082579_-	DUF4031 domain-containing protein	NA	A0A125RNQ7	Pseudomonas_phage	100.0	3.6e-46
WP_094069697.1|5083822_5084047_-	hypothetical protein	NA	A0A0U4J8X2	Pseudomonas_phage	94.6	6.5e-35
WP_094069698.1|5084209_5084809_-	hypothetical protein	NA	A0A0U4JEE7	Pseudomonas_phage	98.0	2.8e-109
WP_094069699.1|5084872_5085154_-	hypothetical protein	NA	A0A0H5AW97	Pseudomonas_phage	74.3	1.7e-24
WP_094069700.1|5085157_5085775_-	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	45.8	4.0e-42
WP_070136378.1|5085743_5086277_-	hypothetical protein	NA	A0A0F7L6F4	uncultured_marine_virus	35.6	9.2e-11
WP_094069701.1|5086867_5087677_-	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	50.9	1.7e-61
WP_094069702.1|5087796_5088663_-	hypothetical protein	NA	A5H1K2	Xanthomonas_virus	38.8	9.4e-21
WP_059399942.1|5088659_5089025_-	hypothetical protein	NA	B5WZX0	Pseudomonas_phage	95.0	1.2e-62
WP_058011984.1|5089697_5090075_-	hypothetical protein	NA	W6MWX7	Pseudomonas_phage	98.4	1.4e-66
WP_094069703.1|5090108_5090438_-	hypothetical protein	NA	A0A0S2SY55	Pseudomonas_phage	96.3	3.6e-05
WP_124142509.1|5090608_5091208_-	hypothetical protein	NA	J7I0S5	Pseudomonas_phage	46.0	7.9e-43
WP_094069704.1|5091381_5091639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024008042.1|5092229_5092670_-	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	99.3	2.4e-81
WP_031294330.1|5092678_5093185_-	hypothetical protein	NA	A0A0S2SYL8	Pseudomonas_phage	98.8	1.1e-82
WP_124142508.1|5093582_5093954_-	hypothetical protein	NA	A0A0S2SYA3	Pseudomonas_phage	97.6	3.7e-59
WP_033986515.1|5093940_5094735_-	hypothetical protein	NA	A0A0S2SYC3	Pseudomonas_phage	100.0	3.0e-143
WP_071562130.1|5094892_5095381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033949562.1|5095428_5096094_-	helix-turn-helix domain-containing protein	NA	H2BDH4	Pseudomonas_virus	39.7	3.0e-43
WP_023099006.1|5096383_5096695_+	hypothetical protein	NA	H6WRX6	Salmonella_phage	50.6	1.8e-14
WP_024007929.1|5096770_5097523_+	hypothetical protein	NA	A0A059VF66	Pseudomonas_phage	56.4	6.8e-68
WP_024007930.1|5097522_5098329_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	90.2	1.2e-142
WP_094069706.1|5098318_5099134_+	ATP-binding protein	NA	A0A059VK34	Pseudomonas_phage	53.6	5.3e-74
WP_094069707.1|5099275_5100043_+	HNH endonuclease	NA	A0A2I7S653	Vibrio_phage	39.0	6.4e-21
WP_023910158.1|5100039_5100549_+	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	98.8	2.9e-86
WP_023111248.1|5100550_5100760_+	hypothetical protein	NA	A0A0S2SYW7	Pseudomonas_phage	79.1	1.2e-22
WP_079382865.1|5100759_5100957_+	hypothetical protein	NA	A0A0U4JX40	Pseudomonas_phage	81.5	1.1e-25
WP_023081919.1|5100956_5101208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124148375.1|5101200_5101476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003101074.1|5101468_5102056_+	DUF1367 family protein	NA	Q9MC49	Pseudomonas_phage	100.0	1.9e-110
WP_094069708.1|5102052_5102313_+	hypothetical protein	NA	H2BDI5	Pseudomonas_virus	52.2	5.5e-09
WP_157740144.1|5102309_5102468_+	hypothetical protein	NA	A0A0S2SYG6	Pseudomonas_phage	98.1	1.2e-19
WP_033989763.1|5102464_5102698_+	hypothetical protein	NA	A0A0S2SYK5	Pseudomonas_phage	97.4	4.7e-36
WP_094069709.1|5102694_5103336_+	hypothetical protein	NA	Q9MC46	Pseudomonas_phage	92.5	4.0e-109
WP_033959088.1|5103335_5103653_+	hypothetical protein	NA	Q9MC45	Pseudomonas_phage	95.2	4.7e-47
WP_094069710.1|5103723_5104410_+	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	97.4	4.8e-129
WP_094069711.1|5104802_5105135_+	peptidase M48, Ste24p	NA	A0A125RNL3	Pseudomonas_phage	99.1	1.7e-55
WP_023098997.1|5105137_5105410_+	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	100.0	8.8e-42
WP_043090794.1|5105406_5106030_+	hypothetical protein	NA	A0A125RNL5	Pseudomonas_phage	98.6	5.7e-121
WP_023098995.1|5106061_5106529_+	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	100.0	2.3e-82
WP_094069712.1|5106509_5107766_+|terminase	terminase	terminase	H2BD76	Pseudomonas_phage	99.5	5.5e-248
WP_033986527.1|5107765_5107963_+	hypothetical protein	NA	H2BD77	Pseudomonas_phage	98.5	1.2e-27
WP_094069713.1|5107965_5109336_+	DUF1073 domain-containing protein	NA	A0A125RNL9	Pseudomonas_phage	98.7	2.7e-264
WP_094069714.1|5109292_5110222_+|head	phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	97.4	1.2e-167
WP_094069715.1|5110225_5111503_+	hypothetical protein	NA	A0A125RNM1	Pseudomonas_phage	99.1	1.5e-213
WP_094069716.1|5111506_5111956_+	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	98.0	2.4e-76
WP_094069717.1|5111971_5113066_+	hypothetical protein	NA	J7I0Q9	Pseudomonas_phage	98.4	9.2e-207
WP_023083731.1|5113076_5113535_+	hypothetical protein	NA	A0A125RNM4	Pseudomonas_phage	74.3	8.7e-50
WP_094069718.1|5113619_5114021_+	hypothetical protein	NA	J7HX89	Pseudomonas_phage	97.7	2.3e-70
WP_058134970.1|5114017_5114356_+	hypothetical protein	NA	A0A125RNM7	Pseudomonas_phage	99.1	5.2e-60
WP_058134968.1|5114357_5114762_+	hypothetical protein	NA	H2BD87	Pseudomonas_phage	98.5	4.8e-68
WP_003127992.1|5114758_5115133_+	hypothetical protein	NA	J7I407	Pseudomonas_phage	100.0	5.7e-68
WP_094069719.1|5115147_5116143_+	Ig domain-containing protein	NA	H2BD89	Pseudomonas_phage	95.8	2.5e-166
WP_016852772.1|5116139_5116757_+	hypothetical protein	NA	A0A125RNN1	Pseudomonas_phage	99.5	2.6e-113
WP_094069720.1|5116756_5119246_+	tape measure protein	NA	J7HXG0	Pseudomonas_phage	92.2	0.0e+00
WP_023082503.1|5119242_5119710_+	hypothetical protein	NA	H2BD92	Pseudomonas_phage	98.7	7.1e-92
WP_023517963.1|5119693_5120185_+	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	99.4	4.9e-91
WP_094069721.1|5120189_5120597_+	hypothetical protein	NA	J7HX80	Pseudomonas_phage	94.1	5.1e-70
WP_094069722.1|5120568_5123292_+	hypothetical protein	NA	A0A127KNI3	Pseudomonas_phage	84.7	0.0e+00
WP_094069723.1|5123352_5125410_+	structural protein	NA	J7HXC9	Pseudomonas_phage	90.7	0.0e+00
WP_011805433.1|5125887_5127309_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_094069724.1|5127395_5128025_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	93.8	3.0e-109
WP_094069725.1|5128021_5128390_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	75.4	1.5e-39
WP_094069726.1|5128386_5128650_+	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	93.1	9.7e-38
>prophage 8
NZ_CP022525	Pseudomonas aeruginosa strain Ocean-1175 chromosome, complete genome	6943220	5931327	5987919	6943220	terminase,tail,holin,integrase	Pseudomonas_phage(62.5%)	64	5937584:5937601	5998336:5998353
WP_034017583.1|5931327_5931840_+	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	92.3	3.5e-92
WP_003102455.1|5931843_5932110_-	hypothetical protein	NA	L7TP56	Pseudomonas_virus	98.9	1.8e-44
WP_034017585.1|5932145_5932406_-	hypothetical protein	NA	H2BDD7	Pseudomonas_virus	88.4	2.6e-35
WP_094069591.1|5932402_5932771_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	60.7	1.8e-29
WP_003088477.1|5932767_5933397_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	94.7	1.0e-109
WP_011805433.1|5933483_5934905_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_031300639.1|5935361_5936102_-	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	59.4	3.1e-57
WP_094069592.1|5937445_5941012_-|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	80.5	0.0e+00
5937584:5937601	attL	CAGCGGCTCGCCGTTGGC	NA	NA	NA	NA
WP_031688063.1|5941070_5941571_-	DNA-binding protein	NA	Q9XJS9	Pseudomonas_phage	65.9	2.2e-59
WP_094069593.1|5941894_5942458_-|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	68.6	2.8e-66
WP_094069594.1|5942454_5943210_-	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	78.1	1.9e-118
WP_033997423.1|5943212_5943959_-|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	76.7	8.7e-116
WP_009314083.1|5943955_5944294_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	52.7	1.1e-28
WP_094069595.1|5944283_5947442_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	4.8e-107
WP_094069596.1|5947787_5948276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046720515.1|5948334_5949504_-	Ig-like domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	39.4	7.6e-58
WP_094069597.1|5949565_5949973_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_033977277.1|5949969_5950368_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	48.4	5.8e-26
WP_094069598.1|5950367_5950832_-	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	48.4	1.5e-25
WP_094069599.1|5950746_5951739_-	hypothetical protein	NA	A0A2H4IY91	uncultured_Caudovirales_phage	49.9	2.3e-84
WP_023121533.1|5951735_5952254_-	hypothetical protein	NA	A0A059VG19	Pseudomonas_phage	55.3	1.3e-38
WP_094069600.1|5952311_5952755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003116763.1|5952767_5953697_-	DUF2184 domain-containing protein	NA	L7TMZ5	Rhizobium_phage	60.2	1.2e-103
WP_058183093.1|5953706_5954162_-	DUF2190 family protein	NA	A0A2R3UAC1	Siphoviridae_environmental_samples	59.1	7.5e-38
WP_058183095.1|5954161_5955283_-	DUF2213 domain-containing protein	NA	A0A059VF71	Pseudomonas_phage	61.6	1.9e-114
WP_094069601.1|5955285_5957094_-	DUF1073 domain-containing protein	NA	A0A2H4J4I9	uncultured_Caudovirales_phage	61.3	3.4e-214
WP_094069602.1|5957093_5958380_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.0	1.4e-145
WP_094069603.1|5958366_5958963_-|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	60.5	4.4e-46
WP_003116758.1|5958971_5959256_-|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	100.0	1.2e-41
WP_004349441.1|5959248_5959638_-	hypothetical protein	NA	H2BD73	Pseudomonas_phage	100.0	9.9e-63
WP_033997397.1|5959752_5960439_-	hypothetical protein	NA	H2BD72	Pseudomonas_phage	99.6	2.2e-129
WP_094069604.1|5960467_5960911_-	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	94.6	1.4e-73
WP_058010341.1|5960903_5962319_-	replicative DNA helicase	NA	H2BD70	Pseudomonas_phage	99.6	1.2e-262
WP_094069605.1|5962311_5963334_-	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	97.1	2.9e-186
WP_157740136.1|5963371_5963614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094069606.1|5963604_5964177_-	hypothetical protein	NA	H2BD67	Pseudomonas_phage	98.9	4.6e-101
WP_003451709.1|5964208_5964427_-	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	64.7	2.9e-19
WP_052435791.1|5964804_5965377_+	LexA family transcriptional regulator	NA	H2BD63	Pseudomonas_phage	91.7	3.2e-86
WP_094069607.1|5966163_5966496_-	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	94.4	2.2e-47
WP_094069608.1|5966897_5967161_+	hypothetical protein	NA	H2BD57	Pseudomonas_phage	98.9	2.8e-45
WP_034086322.1|5967193_5967565_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	98.4	3.2e-63
WP_003099037.1|5968199_5968421_+	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_094069610.1|5968417_5968606_+	hypothetical protein	NA	Q9MC67	Pseudomonas_phage	100.0	1.5e-24
WP_124142433.1|5968592_5968808_+	hypothetical protein	NA	A0A0U4JX53	Pseudomonas_phage	66.7	3.7e-19
WP_094069611.1|5968946_5969858_+	endonuclease	NA	Q858E0	Salmonella_phage	71.6	4.8e-124
WP_094069612.1|5969870_5970770_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	72.9	1.2e-103
WP_009314053.1|5970776_5970977_+	hypothetical protein	NA	J7I437	Pseudomonas_phage	100.0	1.9e-30
WP_094069613.1|5971974_5973717_+	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	91.5	1.6e-282
WP_157740137.1|5973997_5974648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094069614.1|5974764_5976828_+	DNA methyltransferase	NA	Q5QF27	Pseudomonas_virus	99.9	0.0e+00
WP_094069735.1|5976824_5977631_+	class I SAM-dependent methyltransferase	NA	A0A2K8I312	Pseudomonas_phage	98.9	1.3e-154
WP_094069615.1|5977627_5978056_+	hypothetical protein	NA	H2BD44	Pseudomonas_phage	95.8	1.2e-72
WP_094069736.1|5978205_5978700_+	DUF550 domain-containing protein	NA	A0A1B0YZX5	Pseudomonas_phage	90.2	2.1e-86
WP_094069616.1|5978696_5979020_+	DUF4406 domain-containing protein	NA	H2BD42	Pseudomonas_phage	99.1	4.7e-58
WP_094069617.1|5979016_5979658_+	hypothetical protein	NA	Q5QF31	Pseudomonas_virus	99.1	2.7e-126
WP_094069618.1|5979654_5980416_+	hypothetical protein	NA	Q5QF32	Pseudomonas_virus	97.6	1.1e-147
WP_031692817.1|5980423_5980825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033955468.1|5980821_5981328_+	hypothetical protein	NA	L7TI83	Pseudomonas_virus	93.5	5.0e-83
WP_094069619.1|5981425_5982019_+	hypothetical protein	NA	L7TKP8	Pseudomonas_virus	36.6	1.9e-28
WP_094069620.1|5982112_5982499_+	hypothetical protein	NA	A0A2K8HZQ6	Pseudomonas_phage	98.4	2.3e-64
WP_071549158.1|5982554_5982788_+	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	50.7	1.9e-13
WP_079388946.1|5982816_5983854_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	58.6	6.2e-112
WP_021264888.1|5984316_5984850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021264889.1|5984940_5987919_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.4	2.0e-33
5998336:5998353	attR	CAGCGGCTCGCCGTTGGC	NA	NA	NA	NA
>prophage 9
NZ_CP022525	Pseudomonas aeruginosa strain Ocean-1175 chromosome, complete genome	6943220	6014926	6021820	6943220	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_021264895.1|6014926_6015595_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	81.6	1.9e-90
WP_023099506.1|6015705_6016101_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	4.5e-47
WP_003090389.1|6016097_6016457_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_021264896.1|6016456_6016762_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_021264897.1|6016758_6017094_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	68.5	9.5e-38
WP_003108776.1|6017090_6018074_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_003097628.1|6018161_6019136_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108773.1|6019140_6020538_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097631.1|6020539_6021820_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
>prophage 10
NZ_CP022525	Pseudomonas aeruginosa strain Ocean-1175 chromosome, complete genome	6943220	6124173	6163694	6943220	lysis,transposase,head,integrase	Pseudomonas_phage(100.0%)	53	6120258:6120278	6163835:6163855
6120258:6120278	attL	GCAGCGCCATCGGCTTCGCCG	NA	NA	NA	NA
WP_003127781.1|6124173_6124542_-	hypothetical protein	NA	J9SGX4	Pseudomonas_phage	100.0	1.1e-63
WP_003117363.1|6124538_6125087_-	hypothetical protein	NA	J9RWB3	Pseudomonas_phage	100.0	2.1e-98
WP_014603985.1|6125086_6125653_-	regulatory protein GemA	NA	J9SVT5	Pseudomonas_phage	100.0	5.4e-102
WP_016852433.1|6125639_6126107_-	hypothetical protein	NA	J9STM8	Pseudomonas_phage	100.0	8.5e-77
WP_003127807.1|6126106_6126298_-	hypothetical protein	NA	J9SNB0	Pseudomonas_phage	100.0	8.6e-28
WP_003127809.1|6126299_6126989_-	DUF2786 domain-containing protein	NA	J9SGY5	Pseudomonas_phage	100.0	2.0e-127
WP_003094190.1|6126990_6127614_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	100.0	2.0e-110
WP_003148482.1|6127606_6127807_-	hypothetical protein	NA	J9SVU3	Pseudomonas_phage	100.0	2.7e-32
WP_023123655.1|6127799_6128333_-	hypothetical protein	NA	J9STN6	Pseudomonas_phage	99.4	2.5e-93
WP_023123656.1|6128322_6129003_-	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	98.7	2.6e-127
WP_014603990.1|6129002_6129287_-	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	100.0	3.4e-44
WP_023123657.1|6129283_6129625_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	100.0	5.4e-57
WP_016852441.1|6129626_6130793_-	AAA family ATPase	NA	J9SVV1	Pseudomonas_phage	100.0	1.0e-216
WP_031694143.1|6130792_6132577_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	98.3	0.0e+00
WP_010791821.1|6132580_6133555_-	hypothetical protein	NA	J9RW58	Pseudomonas_phage	98.1	1.0e-153
WP_003142307.1|6133564_6133879_-	hypothetical protein	NA	J9SUN0	Pseudomonas_phage	98.1	2.9e-49
WP_003142306.1|6133875_6134136_-	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	95.3	1.5e-38
WP_010791820.1|6134128_6134617_-	hypothetical protein	NA	J9SNL8	Pseudomonas_phage	99.4	2.8e-91
WP_015649394.1|6134740_6134965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003142304.1|6135249_6135480_-	DNA-binding protein	NA	J9RW65	Pseudomonas_phage	100.0	2.5e-37
WP_031633370.1|6135586_6135925_+	helix-turn-helix domain-containing protein	NA	J9SH16	Pseudomonas_phage	82.6	2.4e-12
WP_010791819.1|6135941_6136445_+	hypothetical protein	NA	J9RWD8	Pseudomonas_phage	92.8	4.0e-80
WP_003094225.1|6136635_6136893_+	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_010791818.1|6137050_6137680_+	transglycosylase SLT domain-containing protein	NA	J9SH25	Pseudomonas_phage	99.5	2.2e-120
WP_019485965.1|6137881_6138505_+|lysis	Rz lysis protein	lysis	J9SVX5	Pseudomonas_phage	99.0	1.0e-109
WP_003117315.1|6138504_6138825_+	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	100.0	5.1e-49
WP_003121465.1|6138821_6139124_+	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	99.0	4.1e-48
WP_003121466.1|6139126_6139675_+	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	98.9	6.4e-76
WP_003126996.1|6139676_6141350_+	hypothetical protein	NA	J9RWF2	Pseudomonas_phage	99.3	0.0e+00
WP_003126994.1|6141352_6142918_+	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	96.4	5.8e-287
WP_003126992.1|6142907_6144146_+	hypothetical protein	NA	J9STS2	Pseudomonas_phage	99.5	1.0e-241
WP_015649417.1|6144147_6144723_+	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	99.0	1.7e-103
WP_003129234.1|6144933_6146043_+	hypothetical protein	NA	J9SH47	Pseudomonas_phage	99.7	5.3e-202
WP_003121593.1|6146048_6146453_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	100.0	1.8e-67
WP_003127513.1|6146467_6147364_+|head	head protein	head	J9SVY7	Pseudomonas_phage	100.0	1.3e-171
WP_003121493.1|6147595_6147811_+	hypothetical protein	NA	J9STT1	Pseudomonas_phage	100.0	1.5e-33
WP_003121492.1|6147813_6148329_+	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	100.0	3.5e-92
WP_003127511.1|6148325_6148778_+	hypothetical protein	NA	J9SH57	Pseudomonas_phage	100.0	5.5e-81
WP_003127509.1|6148774_6148978_+	hypothetical protein	NA	J9RWG5	Pseudomonas_phage	100.0	1.7e-29
WP_010791812.1|6148984_6149725_+	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	100.0	1.2e-136
WP_023086241.1|6149727_6150210_+	hypothetical protein	NA	J9STT8	Pseudomonas_phage	100.0	1.3e-83
WP_049967619.1|6150164_6150347_-	hypothetical protein	NA	J9SNJ6	Pseudomonas_phage	100.0	1.2e-26
WP_031655034.1|6150463_6154096_+	tape measure protein	NA	J9SH65	Pseudomonas_phage	96.3	0.0e+00
WP_023123676.1|6154095_6155052_+	hypothetical protein	NA	L7P7S3	Pseudomonas_phage	94.3	1.9e-184
WP_023127652.1|6155053_6155977_+	hypothetical protein	NA	J9SVR7	Pseudomonas_phage	96.1	3.8e-177
WP_023123220.1|6155979_6157686_+	hypothetical protein	NA	Q5ZQW3	Pseudomonas_phage	96.7	0.0e+00
WP_023123221.1|6157672_6158491_+	DUF2163 domain-containing protein	NA	J9SN93	Pseudomonas_phage	99.3	3.8e-165
WP_023117665.1|6158513_6158744_+	hypothetical protein	NA	J9SHJ9	Pseudomonas_phage	100.0	2.7e-36
WP_033946000.1|6158957_6161168_+	bacteriophage protein	NA	A0A0S4L2V2	Pseudomonas_phage	97.3	0.0e+00
WP_003094288.1|6161164_6162313_+	hypothetical protein	NA	J9SP76	Pseudomonas_phage	92.9	9.0e-213
WP_003094290.1|6162309_6162600_+	hypothetical protein	NA	A0A0A7DJU8	Pseudomonas_phage	95.7	2.6e-44
WP_015649444.1|6162738_6162930_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	73.0	6.6e-20
WP_031800187.1|6162899_6163694_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	90.5	2.3e-143
6163835:6163855	attR	CGGCGAAGCCGATGGCGCTGC	NA	NA	NA	NA
>prophage 11
NZ_CP022525	Pseudomonas aeruginosa strain Ocean-1175 chromosome, complete genome	6943220	6382402	6422632	6943220	transposase,protease,integrase	Burkholderia_phage(16.67%)	34	6405579:6405594	6423126:6423141
WP_026006646.1|6382402_6383380_-|transposase	IS5-like element ISPsp6 family transposase	transposase	E5E3P6	Burkholderia_phage	58.9	8.2e-98
WP_094069624.1|6383452_6384199_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_034021343.1|6384278_6385079_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_034021344.1|6385211_6385775_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102059483.1|6387149_6388727_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	43.4	3.7e-108
WP_082431507.1|6388798_6389086_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_034021398.1|6389121_6389499_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_034021348.1|6390621_6391254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060427508.1|6391257_6392370_+	NAD-binding protein	NA	NA	NA	NA	NA
WP_034021350.1|6392499_6393132_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034081111.1|6393294_6393573_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_055646740.1|6393619_6394195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034021357.1|6395257_6396367_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_034021360.1|6396446_6397061_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034021363.1|6397149_6398610_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_060427634.1|6398844_6399750_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034021365.1|6399846_6400632_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014003920.1|6400719_6401700_+|transposase	IS5-like element ISPa41 family transposase	transposase	Q38213	Escherichia_phage	59.2	1.4e-102
WP_060546574.1|6403043_6406199_+	hypothetical protein	NA	NA	NA	NA	NA
6405579:6405594	attL	TTCGACCAGGCGGGCA	NA	NA	NA	NA
WP_114260891.1|6406697_6407210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114260892.1|6407310_6407757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034021374.1|6407883_6410268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034021402.1|6410373_6412308_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	49.1	1.5e-103
WP_012613931.1|6412902_6413676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098798.1|6413737_6414400_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_021264209.1|6414409_6414892_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003090906.1|6414888_6415779_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003130830.1|6415861_6418222_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.3	1.3e-45
WP_003090908.1|6418240_6418732_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003090910.1|6418728_6419214_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.0	8.1e-22
WP_003090911.1|6419325_6419724_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003090913.1|6419908_6421120_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003115276.1|6421170_6421623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090915.1|6421756_6422632_+|protease	protease HtpX	protease	NA	NA	NA	NA
6423126:6423141	attR	TGCCCGCCTGGTCGAA	NA	NA	NA	NA
